MUSHROOM LINE N-S34, INCORPORATED INTO HYBRID MUSHROOM STRAIN LA3782, AND DERIVATIVES THEREOF

Abstract

The present invention relates to the development of a homokaryotic Agaricus bisporus (Lange) Imbach mushroom fungus line culture designated N-s34 and to cultures obtained, descended, or otherwise derived from line N-s34. More particularly, the present invention relates to cultures incorporating at least one set of chromosomes having a genotype present in the genotype of the chromosomes found in line N-s34. The present invention further relates to F1 hybrids, and to a particular F1 hybrid strain, designated LA3782, descended from N-s34. This particular strain indeed displays an excellent yield weight of the harvested crop, especially in the third-flush, and a very good shelf-life of the mushroom products. The invention additionally relates to progeny, lines and strains derived from or descended from, or otherwise developed or obtained from, line N-s34 and from said hybrid strain LA3782. The invention further relates to methods of use of the cultures described hereinabove.

Claims

1.-19. (canceled)

20. An Agaricus bisporus culture comprising a complete set of chromosomes of Agaricus bisporus line N-s34, a representative culture of said line N-s34 having been deposited under CNCM Accession Number I-5528, wherein said set of chromosomes comprises the sequence-characterized allelic markers listed in Table I.

21. The Agaricus bisporus culture of claim 20, wherein said culture is selected from the group consisting of: (a) the line N-s34, and (b) F1 hybrid strains produced by mating the line N-s34 to a second line.

22. The Agaricus bisporus culture of claim 20, wherein said culture comprises F1 hybrid strains produced by mating the line N-s34 to a homokaryon obtained from strain BP-1, a representative culture of said strain BP-1 having been deposited under ATCC Accession Number PTA-6903.

23. The Agaricus bisporus culture of claim 20, wherein said culture comprises strain LA3782, a representative culture of said strain LA3782 having been deposited under CNCM Accession Number I-5527.

24. An Agaricus bisporus culture comprising a haploid set of chromosomes of strain LA3782, a representative culture of said strain LA3782 having been deposited under CNCM Accession Number I-5527, said haploid set of chromosomes comprising the sequence-characterized allelic markers listed in Table II, provided that said culture is not strain BP-1, a representative culture of said strain BP-1 having been deposited under ATCC Accession Number PTA-6903.

25. The Agaricus bisporus culture of claim 24, wherein said culture is selected from the group consisting of: (a) a homokaryon of the strain LA3782, and (b) F2 hybrids produced by mating said homokaryon of (a) with a second line.

26. An Agaricus bisporus culture of F2, F3, F4, or F5 generation descended from F1 hybrids produced by mating a first parent which is line N-s34, a representative culture of said line N-s34 having been deposited under CNCM Accession Number I-5528, with a second parent; wherein said second parent is optionally strain LA3782 or a strain derived therefrom, a representative culture of strain LA3782 having been deposited under CNCM Accession Number I-5527, wherein said F2 generation comprises at least 40-60% of the Single-Nucleotide Polymorphisms (SNPs) present in the genome of the strain LA3782; wherein said F3 generation comprises at least 20-30% of the SNPs present in the genome of the strain LA3782; wherein said F4 generation comprises at least 10-15% of the SNPs present in the genome of the strain LA3782; and wherein said F5 generation comprises at least 4-8% of the SNPs present in the genome of the strain LA3782.

27. The Agaricus bisporus culture of claim 26, wherein said second parent is the strain LA3782 or a strain derived therefrom; and wherein said culture comprises at least about 100 allelic markers of the sequence-characterized allelic markers listed in Table II, at least about 50 allelic markers of the sequence-characterized allelic markers in Table II, or at least about 25 of the sequence-characterized allelic markers in Table II.

28. The Agaricus bisporus culture of claim 26, wherein said second parent is the strain LA3782 or a strain derived therefrom, and wherein said culture comprises at least 40-60%, at least 20-30%, at least 10-15%, or at least 4-8% of the sequence-characterized allelic markers listed in Table II or Table III.

29. An Agaricus bisporus culture that is derived from an initial culture, wherein said initial culture is selected from the group consisting of: a) strain LA3782, a representative culture of said strain LA3782 having been deposited under CNCM Accession Number I-5527, b) line N-s34, a representative culture of said line N-s34 having been deposited under CNCM Accession Number I-5528.

30. The Agaricus bisporus culture of claim 29, wherein said culture comprises at least 65% of the sequence-characterized allelic markers of the line N-s34 listed in Table I or 65% of the sequence-characterized allelic markers of the strain LA3287 listed in Table II.

31. A composition comprising cells, hyphae, mycelium, mushrooms, germinated spores, ungerminated spores, homokaryons, heterokaryons, and/or aneuploids obtained from the culture of claim 20.

32. A composition comprising cells, hyphae, mycelium, mushrooms, germinated spores, ungerminated spores, homokaryons, heterokaryons, and/or aneuploids obtained from the culture of claim 24.

33. A composition comprising cells, hyphae, mycelium, mushrooms, germinated spores, ungerminated spores, homokaryons, heterokaryons, and/or aneuploids obtained from the culture of claim 26.

34. A composition comprising cells, hyphae, mycelium, mushrooms, germinated spores, ungerminated spores, homokaryons, heterokaryons, and/or aneuploids obtained from the culture of claim 29.

35. A method for developing a new Agaricus bisporus culture, said method comprising applying at least one mushroom strain development technique to the culture of claim 20, wherein said new Agaricus bisporus culture comprises the line N-s34, a homokaryon of strain LA3782, a representative culture of said strain LA3782 having been deposited under the CNCM Accession Number I-5527, or a progeny thereof.

36. The method of claim 36, wherein said new Agaricus bisporus culture is characterized in that: (a) yield performance of crops produced from said new Agaricus bisporus culture is equal to or exceeds yield performance of crops of a BR06/Heirloom strain of Agaricus bisporus, and (b) a third-flush yield of crops produced from said new Agaricus bisporus culture exceeds that of the BR06/Heirloom strain, and (c) mushroom product of crops produced from said new Agaricus bisporus culture retains more weight after a number of days of post-harvest storage at 4 degrees Celsius than does mushroom product of the BR06/Heirloom strain, the number of days selected from the group comprising 3, 4, 5, 6, 7, and 8 days.

37. The method of claim 36, wherein said new Agaricus bisporus culture is an F2, F3, F4, or F5 generation descended from the strain LA3782, or from a strain derived from the strain LA3782, and comprising respectively at least 40-60%, at least 20-30%, at least 10-15%, or at least 4-8% of the Single-Nucleotide Polymorphisms (SNPs) present in the genome of the strain LA3782.

38. The method of claim 36, wherein said new Agaricus bisporus culture comprises at least about 100 allelic markers of the sequence-characterized allelic markers listed in Table II, at least about 50 allelic markers of the sequence-characterized allelic markers listed in Table II or at least about 25 of the sequence-characterized allelic markers listed in Table II.

39. The method of claim 36, wherein said new Agaricus bisporus culture comprises at least 40-60%, at least 20-30%, at least 10-15%, or at least 4-8% of the sequence-characterized allelic markers listed in Table II or Table III.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0027] Genetic identity (e.g., genotype), genealogy, and pedigree are all inextricably interrelated in a strain development or breeding program, as in the cultures of the present invention. The following information on life cycles and heterokaryotic and homokaryotic genotypes, and on parents, offspring, hybrids and descended strains, and derived strains may help to clarify relationships and expectations.

[0028] Mushroom-forming fungi exhibit an alternation of generations, from heterokaryotic (N+N, with two haploid nuclei, functionally like the 2N diploid state) to homokaryotic (1N) and further upon mating to become heterokaryotic again. In most eukaryotes, a parent is conventionally considered to be either diploid or heterokaryotic. The haploid ‘generation’ is often, but not always, termed a gamete (e.g., pollen, sperm). In fungi, which are microorganisms, the haploid generation can live and grow indefinitely and independently, for example in laboratory cell culture; while these haploid homokaryons function as gametes in matings, they are equivalent to inbred lines (e.g., of plants) and are more easily referred to as lines (or ‘homokaryon-parents’ of hybrids). Herein, the standalone term ‘parent’ refers, depending on context, to the heterokaryotic culture that is either a, or the, direct progenitor of a haploid line culture, or else the progenitor-once-removed of a strain belonging to the subsequent heterokaryotic generation obtained from a mating of at least one such line. The term ‘line’ thus refers narrowly to a haploid (N) homoallelic culture within the lifecycle. The N+N heterokaryon resulting from a mating, or comprising a breeding stock, or comprising a culture used to produce a crop of mushrooms, may be called a ‘strain’.

[0029] Now, with respect to the invention and as noted hereinabove, the present invention relates to at least a homokaryotic line, and more specifically, a culture comprising at least one set of chromosomes of an Agaricus bisporus line designated N-s34, and methods for using the line designated N-s34. The N-s34 line is a homokaryon and its genome and genotype are haploid and thus is entirely homoallelic (although some limited regions of duplicated DNA may be present in its genome).

[0030] In a first aspect, the present invention is directed to an Agaricus bisporus culture comprising at least the set of chromosomes of the Agaricus bisporus line N-s34, a representative culture of said line having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5528.

[0031] The deposit of a culture of the Agaricus bisporus line N-s34, as disclosed herein, has been made by Somycel, 4 Rue Carnot-ZI Sud, 37130 Langeais, with the Collection Nationale de Cultures de Microorganismes (CNCM). The culture deposited was taken from the same culture maintained by Somycel, Langeais, France, the assignee, since prior to the filing date of this application, and the inventors and assignee have received authorization to refer to this deposited biological material in any and all patent applications. All restrictions upon the deposit have been removed, and the deposit is intended to meet all deposit requirements under the Budapest Treaty. The date of deposit was Jun. 30, 2020. Moreover, the deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of any patent, whichever is longer, and will be replaced as necessary during this period. The culture of this deposit will be irrevocably and without restriction of condition released to the public upon the filing of the patent application or upon the issuance of a patent, whichever is required by the applicable patent laws.

[0032] Agaricus bisporus mushroom line N-s34 is, based on whole-genome sequencing, a haploid, homokaryotic filamentous basidiomycete culture which in vegetative growth produces a branching network of hyphae, i.e., a mycelium. Growth can produce an essentially two-dimensional colony on the surface of solidified (e.g., agar-based) media, or a three-dimensional mass in liquid or solid-matrix material.

[0033] A culture comprising at least one set of chromosomes of an Agaricus bisporus line designated N-s34 may be either a homokaryon or a heterokaryon. It may be (a) line N-s34 itself, (b) a culture having full genotypic identity with N-s34, in agreement with the allelic genotype of N-s34 presented in Table I, (c) a culture having at least one set of genotypic markers which are a subset of those of the genotype of N-s34 representing at least 65%, 70%, 75%, or 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, of the markers present in N-s34, or comprising at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or at least 100 markers out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I (d) a culture having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% genotypic identity with N-s34, and (e) an F1 hybrid having N-s34 as a direct parent, said hybrid displaying all the allelic markers listed in Table I (on at least one of its two alleles).

[0034] Cultures of the invention include a culture having at least one genealogical relationship with the culture N-s34, wherein the genealogical relationship is selected from the group of consisting of (1) identity: i.e., self, clone, subculture, (2) descent: i.e., inbred descendent, outbred descendent, back-bred descendent, F1 hybrid, F2 hybrid, F3 hybrid, F4 hybrid, F5 hybrid, and (3) derivation: i.e., derived culture, somatic selection, tissue selection, mutagenized culture, transformed culture. Note that when a relationship involves descent solely from a single parent, the resultant cultures can also be considered to have been ‘derived’ from that parental culture.

[0035] In a preferred embodiment, the Agaricus bisporus culture of the invention is selected from the group consisting of: [0036] (a) the line N-s34, a representative culture of same having been deposited under the CNCM Accession Number I-5528 at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, [0037] (b) F1 hybrid strains produced by mating the line N-s34 to a second line.

[0038] The present invention also targets the homokaryons of said F1 hybrid strains defined in (b), the genome of said homokaryons containing at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, of the markers present in N-s34, among which at least one marker is present in N-s34 but is absent from the second line.

[0039] In a preferred embodiment, said second line is an homokaryon obtained from strain BP-1 (also known as AA0096 or ARP023 or PTA-6903).

[0040] LA3782 is one example of an F1 hybrid heterokaryon strain having outbred descent from the homokaryotic line N-s34. It is also called Tuscan820. More precisely, it has been obtained by mating the line N-s34 with an homokaryon of strain BP-1 also known as AA-0096 and ARP-023. This strain BP-1 has been deposited under Budapest Treaty governing the deposit of organisms at the American Type Culture Collection (ATCC), Rockville, Md., USA, under ATCC Accession Number PTA-6903.

[0041] Mushrooms produced in crops by strain LA3782 are about 39 kg/m.sup.2 (S.D.±1.98) over 3 flushes in phase 3 system, and typically each weigh about 20-45 grams for medium size mushrooms. Cap color measurements on mushrooms of LA3782 produced L-a-b color of L:71,49 (S.D±2,9) a:7,12 (S.D.±1,02) b:23,28 (S.D.±1,28) when measurements were taken on 30 mushrooms using a Minolta Chromameter.

[0042] In a preferred embodiment, the culture of the invention is the strain LA3782, a representative culture of said strain having been deposited under the CNCM Accession Number I-5527 at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020. The deposit of a culture of the Agaricus bisporus strain LA3782, as disclosed herein, has been made by Somycel, 4 Rue Carnot-ZI Sud, 37130 Langeais, with the Collection Nationale de Cultures de Microorganismes (CNCM). The culture deposited was taken from the same culture maintained by Somycel, Langeais, France, the assignee, since prior to the filing date of this application, and the inventors and assignee have received authorization to refer to this deposited biological material in any and all patent applications. All restrictions upon the deposit have been removed, and the deposit is intended to meet all deposit requirements of the Budapest Treaty. The date of deposit was Jun. 30, 2020. Moreover, the deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of any patent, whichever is longer, and will be replaced as necessary during this period. The culture of this deposit will be irrevocably and without restriction of condition released to the public upon the filing of the patent application or upon the issuance of a patent, whichever is required by the applicable patent laws.

[0043] Mushroom cultures are most reliably identified by their genotypes, in part because successful cultivar strains are required by the market to conform to a narrow phenotypic range. The genotype can be characterized through a genetic marker profile, which can identify isolates (clones or subcultures) of the same line, strain or culture, or a genealogically related culture including a descendent or a culture derived entirely from an initial culture, or additionally can be used to determine or validate a strain development pedigree over generations.

[0044] In Inventor's experience in evaluating whole genome sequences of many dozens of diverse Agaricus bisporus lines and strains, a typical number of SNP markers distinguishing any two unrelated homokaryons is roughly 300,000. This means that transmission of even 1% of a set of chromosomes or genotypic markers in a genealogy still represents about 3,000 distinctive identifying markers for a relationship to N-s34. 200 markers, or even 6 highly polymorphic ones, can establish identity, paternity, and derivation among cultures beyond question, while many thousands of available SNP markers can cumulatively provide a robustly-supported method for establishing genealogical relatedness over multiple generations.

[0045] Means of obtaining genetic marker profiles using diverse techniques including whole genome sequencing (WGS) plus Single Nucleotide Polymorphism (SNP) marking and Sequence Characterized Amplified Region (SCAR) marking are well known in the art. Since both approaches can analyze the sequences of specific loci, both provide identical results for any locus (note that in heterokaryon analysis, WGS provides more insight into the distribution of SNPs on the haploid sequences; i.e., confirmation of allelic sequences).

[0046] The whole genomic sequence of line N-s34 has been obtained and, consequently, about 95% (about 30.2 Mb) of the entire DNA sequence genotype of line N-s34 is known to the Assignee with certainty. The total number of SNP markers distinguishing the reference genome H97 from line N-s34, and which are known to the Assignee, is at least 141,923. That number is expected to be higher when distinguishing N-s34 from other homokaryons. A brief excerpt of the genotype of line N-s34 and strain LA3782 at numerous sequence-characterized marker loci distributed at intervals along each of the 13 chromosomes of N-s34 and LA3782 is provided in Tables I and II. Only for information, the sequences of the same marker loci are provided for the homokaryotic line J147566s3 disclosed in WO2018/102990.

TABLE-US-00001 TABLES I & II 203 SNP marker genotypes for relevant lines and strains N-s34 LA3782 Scaffold ID Ref Pos H97 vers 2.0 Table I Table II J147566s3 scaffold_1 99995 CTACATTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA scaffold_1 101993 GAAGGACAT GAAGcustom-character ACAT GAAGcustom-character ACAT GAAGcustom-character ACAT scaffold_1 349966 AAGGTGGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT scaffold_1 660050 TCACCATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA scaffold_1 849951 GATGGAGGA GATGcustom-character AGGA GATGcustom-character AGGA GATGcustom-character AGGA scaffold_1 850014 ATTCCTTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT scaffold-1 867820 GTCACTATT GTCACTATT GTCACTATT GTCACTATT scaffold-1 867860 ATTCTAAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC scaffold-1 867868 CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA scaffold-1 867923 ATCCAGATG ATCCAGATG ATCCrGATG ATCCAGATG scaffold-1 867914 AAAGCATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG scaffold-1 867967 TCAACTGGT TCcustom-character ACTGGT TCcustom-character ACTGGcustom-character TCcustom-character ACTGGT scaffold-1 868085 GGATT--CT --------- ggatt--ct --------- scaffold_1 1099971 GTCGACACC GTCGcustom-character CACC GTCGcustom-character CACC GTCGcustom-character CACC scaffold_1 1353901 AGATAACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA scaffold_1 1599956 AATAAGCGC AATAcustom-character GCGC AATAcustom-character GCGC AATAcustom-character GCGC scaffold_1 1850032 CGAGTAATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT scaffold_1 2119049 ACAATCCAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA scaffold_1 2401751 CGGATAAAT CGGATAAAT CGGAcustom-character AAAT CGGATAAAT scaffold_1 2635654 TGCGGTTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG scaffold_1 2804522 GAAGACGAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC scaffold_1 2858975 GCCGTTCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT scaffold_1 3256057 TATCTGTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT scaffold_2 101820 ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT scaffold_2 128192 TGGACCAGG Tcustom-character GACCAGG Tcustom-character GAcustom-character AGG Tcustom-character GACCAGG scaffold_2 279652 AAGGCATGT AAGGCATGT AAGGCATGT AAGGCATGT scaffold_2 350156 TCGGGGGTG TCGGGGGTG TCGGcustom-character GGTG TCGGGGGTG scaffold_2 450323 CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG scaffold_2 600112 ATGTATACG ATGTATACG ATGTcustom-character TACG ATGTATACG scaffold_2 850338 TGGTGCTAA TGGTGCTAA TGGTcustom-character CTAA TGGTGCTAA scaffold_2 1099413 CCTGACTCA CCTGACTCA CCTGcustom-character CTCA CCTGACTCA scaffold_2 1189976 ACGGCCCAA ACGGCCCAA ACGGcustom-character CCAA ACGGCCCAA scaffold_2 1293936 GTGTTTGTT GTGTTTGTT GTGTcustom-character TGTT GTGTTTGTT scaffold_2 1349512 CTCAGCAGT CTCAGCAGT CTCAcustom-character CAGT CTCAGCAGT scaffold_2 1378074 TCCACTTCA TCCACTTCA TCCAcustom-character TTCA TCCACTTCA scaffold_2 1378104 TTTCCAGAT TTTCCAGAT TTcustom-character Ccustom-character AGAT TTTCCAGAT scaffold_2 1600085 CACAATGCC CACAATGCC CACAcustom-character TGCC CACAATGCC scaffold_2 1643101 CATCTTCTT CATCcustom-character TCTT CATCcustom-character TCTT CATCcustom-character TCTT scaffold_2 1901773 ACTCGAATT ACTCcustom-character AATT ACTcustom-character AATT ACTCcustom-character AATT scaffold_2 2150162 TGCTTAGGG TGCTTAGGG TGCTcustom-character AGGG TGCTTAGGG scaffold_2 2389428 GGATTTCAA GGATcustom-character TCAA GGATcustom-character TCAA GGATcustom-character TCAA scaffold_2 2400281 TCAAAACCC TCAAcustom-character ACcustom-character C custom-character CAAcustom-character ACcustom-character C TCAAcustom-character ACcustom-character C scaffold_2 2650136 ATAATTCCT ATAAcustom-character TCCT ATAAcustom-character TCCT ATAATTCCT scaffold_2 2904101 TGTTGAGGT TGTTGAGGT TGTTcustom-character AGGT TGTTGAGGT scaffold_2 3049515 GAAAAGCTT GAAAAGCTT GAAAcustom-character GCTT GAAAcustom-character GCTT scaffold_3 57118 TATAGCAGC TATAGCAGC TATcustom-character CAGC TATcustom-character CAGC scaffold_3 118150 GTTTGTCCT GTTTGTCCT GTTTcustom-character TCCT GTTTGTCCT scaffold_3 131389 AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG scaffold_3 175472 CTTTATTTC CTTTATTTC CTTTcustom-character TTTC CTTTATTTC scaffold_3 250112 GCAGGAGAG GCAGGAGAG GCcustom-character Gcustom-character AGAG GCAGGAGAG scaffold_3 379203 ATAGCGGAA ATAGCGGAA ATAGcustom-character GGAA ATAGCGGAA scaffold_3 614937 CAAAATCTG CAAAATCTG CAAAcustom-character TCGT CAAAATCTG scaffold_3 750074 GTTCTTTTC GTTCTTTTC GTTCcustom-character TTTC GTTCTTTTC scaffold_3 1126997 TCAAAGGCG TCAAAGGCG TCAAcustom-character GGCG TCAAAGGCG scaffold_3 1250161 AGTCTCCTT AGTCTCCTT AGTCcustom-character CCTT AGTCTCCTT scaffold_3 1296141 ATCGGTCAT ATCGGTCAT ATCGcustom-character TCAT ATCGGTCAT scaffold_3 1510819 CCACTGATT CCACTGATT CCACcustom-character GATT CCACTGATT scaffold_3 1774892 CCGTATGGG CCGTATGGG CCGTcustom-character TGGG CCGTATGGG scaffold_3 2008438 AGCATAGCC AGCATAGCC AGCAcustom-character AGCC AGCATAGCC scaffold_3 2250000 CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT scaffold_3 2274053 AAACCAAGA AAACCAAGA AAACcustom-character AAGA AAACCAAGA scaffold_3 2384173 TGACCAAGC TGACCAAGC TGACcustom-character AAGC TGACCAAGC scaffold_3 2520748 TAATTCCAC TAATTCCAC TAATcustom-character CCAC TAATTCCAC scaffold_3 2523207 CAGTCCATA CAGTCCATA CAGTcustom-character ATA CAGTCCATA scaffold_4 100004 GAGTGATAA GAGTGATAA GAGTGATAA GAGTGATAA scaffold_4 460303 TCCTATAAC TCCTATAAC TCCTcustom-character TAAC TCCTATAAC scaffold_4 490648 CGATCGCGT CGATCGCGT CGATcustom-character GCGT CGATCGCGT scaffold_4 649317 GAGGCAATG GAGGCAATG GAGGcustom-character AATcustom-character GAGGCAATG scaffold_4 752893 AAGTCCCAA AAGTCCCAA AAGTCCCAA AAGTCCCAA scaffold_4 753018 TGGGCAAGC TGGGCAAGC TGGGcustom-character AAGC TGGGCAAGC scaffold_4 753116 --------- --------- --------- --------- scaffold_4 753134 AACATAACT AACATAACT AACAcustom-character AACT AACATAACT scaffold_4 753165 TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG scaffold_4 753221 CTGTTGGAC CTGTCGGAC CTGTcustom-character GGAC CTGTTGGAC scaffold_4 878926 CTGATCAAT CTGATCAAT Ccustom-character GAcustom-character CAAT CTGATCAAT scaffold_4 1100085 GATGCCGAA GATGCCGAA GATGcustom-character CGAA GATGCCGAA scaffold_4 1163185 CAAGCTACT CAAGCTACT CAAGcustom-character TACT CAAGCTACT scaffold_4 1350536 CGAACTCGG CGAACTCGG CGAAcustom-character CGG CGAACTCGG scaffold_4 1599885 GATACTTGC GATACTTGC GATACTTGC GATACTTGC scaffold_4 1850288 ATTCGTGTA ATTCGTGTA ATTCcustom-character GTA ATTCGTGTA scaffold_4 1889549 ACAACAGAA ACAACAGAA ACAAcustom-character AGAA ACAACAGAA scaffold_4 2100356 TCAGAGACC TCAGcustom-character GACC TCAGcustom-character GACC TCAGcustom-character GACC scaffold_4 2284257 TCTGGACTG TCTGcustom-character ACTG TCTGcustom-character ACTG TCTGcustom-character ACTG scaffold_5 87962 GATTAAGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG scaffold_5 100211 TCCTTGAAT TCCTcustom-character GAAT TCCTcustom-character GAAT TCCTcustom-character GAAT scaffold_5 350872 GGCGTGCCC GGCGcustom-character GCCC GGCGcustom-character GCCC GGCGcustom-character GCCC scaffold_5 599922 CGTCATTCA CGTCcustom-character TTCA CGTCcustom-character TTCA CGTCcustom-character TTCA scaffold_5 851262 TAATTCTCT TAATcustom-character TCT TAATcustom-character TCT TAATcustom-character TCT scaffold_5 1099776 ACATTGACA ACATcustom-character GACA ACATcustom-character GACA ACATcustom-character GACA scaffold_5 1352539 TTGTGATCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC scaffold_5 1599904 AACTTCCTT AACTcustom-character CCTT AACTcustom-character CCTT AACTcustom-character CCTT scaffold_5 1851487 TTCCGCTCC TTCCGCTCC TTCCcustom-character CTCC TTCCGCTCC scaffold_5 2100025 CCCTTAGTC CCCTcustom-character AGTC CCCTcustom-character AGTC CCCTcustom-character AGTC scaffold_5 2278878 GGTCGAAAA GGTCcustom-character AAAA GGTCcustom-character AAAA GGTCcustom-character AAAA scaffold_6 106480 GCCCACTTG GCCCACTTG GCCCcustom-character CTTG GCCCACTTG scaffold_6 350337 CATTTGGTT CATTTGGTT CATTcustom-character GGTT CATTTGGTT scaffold_6 600047 GGAGCATTT GGAGCATTT GGAGcustom-character ATTT GGAGCATTT scaffold_6 849990 AGTTCAGGA AGTTCAGGA AGTTcustom-character AGGA AGTTCAGGA scaffold_6 1098535 CAAAGATTG CAAAGATTG CAAAcustom-character ATTG CAAAGATTG scaffold_6 1349453 TGTCGGTAG TGTCGGTAG TGTCcustom-character TAG TGTCGGTAG scaffold_6 1600000 AAACCTGGA AAACCTGGA AAACCTGGA AAACCTGGA scaffold_6 1764645 AACCGGATT AACCGGATT AACCcustom-character GATT AACCGGATT scaffold_6 2000087 GATTTTGCG GATTTTGCG GATTTTGCG GATTTTGCG scaffold_6 2007502 AATTGATAA AATTGATAA AATTcustom-character ATAA AATTGATAA scaffold_7 100284 GAAATTCAG GAAATTCAG GAAAcustom-character TCAG GAAATTCAG scaffold_7 348994 CCGGAGTTT CCGGAGTTT CCGGcustom-character GTTT CCGGAGTTT scaffold_7 600111 CAATTATTA CAATTATTA CAATcustom-character ATTA CAATTATTA scaffold_7 850516 TGACGCATA TGACGCATA TGACcustom-character CATA TGACGCATA scaffold_7 873221 AATAGACCT AATAGACCT AATAcustom-character ACCT AATAGACCT scaffold_7 1100248 TCACGGAAG TCACGGAAG TCACcustom-character GAAG TCACGGAAG scaffold_7 1352529 TAAATATAT TAAATATAT TAAATATAT TAAATATAT scaffold_7 1605059 GACAAGCAA GACAAGCAA GACAcustom-character GCAA GACAAGCAA scaffold_7 1991524 CAACCCACC CAACCCACC CAACcustom-character CACC CAACCCACC scaffold_8 350000 ATTGACGCG ATTGACGCG ATTGcustom-character CGCG ATTGcustom-character CGCG scaffold_8 606991 GTGTATTCT GTGTATTCT GTGTcustom-character TTCT GTGTcustom-character TTCT scaffold_8 610549 GGAACTTGA GGAACTTGA GGAAcustom-character TTGA GGAAcustom-character TTGA scaffold_8 829832 CTGTACAAC CTGTACAAC CTGTcustom-character CAAC CTGTACAAC scaffold_8 829846 TTCGAGTGA TTCGAGTGA TTCGAGTGA TTCGAGTGA scaffold_8 830003 AACTGGCAG AACTGGCAG AACTGGCAG AACTcustom-character GCAG scaffold_8 830070 ATTAGGATT ATTAGGATT ATTAGGATT ATTAGGATT scaffold_8 830078 TACTAGACG TACTAGACG TACTcustom-character GACG TACTcustom-character GACG scaffold_8 830105 ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT scaffold_8 830159 AATTAGAAG AATTAGAAG AATTAGAAG AATTAGAAG scaffold_8 830169 GACGACTGG GACGACTGG GACGACTGG GACGACTGG scaffold_8 830215 AGTGTATCT AGTGTATCT AGTGcustom-character ATCT AGTGcustom-character ATCT scaffold_8 830250 TCCAATGCA TCCAATGCA TCCAcustom-character TGCA TCCAcustom-character TGCA scaffold_8 1100000 CATACGATC CATACGATC CATACGATC CATACGATC scaffold_8 1350240 ACGGGTACT ACGGGTACT ACGGcustom-character TACT ACGGGTACT scaffold_8 1354068 AGAATGCCT AGAATGCCT AGAAcustom-character GCCT AGAAcustom-character GCCT scaffold_8 1614036 TTATCAGTA TTATCAGTA TTATcustom-character AGTA TTATCAGTA scaffold_8 1869238 TGGAGGTTG TGGAGGTTG TGGAcustom-character GTTG TGGAcustom-character GTTG scaffold_9 100447 CTATTTTCT CTATTTTCT CTATcustom-character TTCT CTATcustom-character TTCT scaffold_9 350569 AGAATATAC AGAAcustom-character ATAC AGAAcustom-character ATAC AGAAcustom-character ATAC scaffold_9 599950 TGGTATCCC Tcustom-character GTATCCC Tcustom-character GTcustom-character TCCC TGGTcustom-character TCCC scaffold_9 611788 TCTGTAATC Tcustom-character TGTAATC Tcustom-character TGcustom-character ATC Tcustom-character TGTAATC scaffold_9 721973 TGTATACGT TGTAcustom-character ACGT TGTAcustom-character ACGT TGTAcustom-character ACGT scaffold_9 1010845 GGGTGGTGA GGGTGGTGA Gcustom-character GTGGTGA GGGTcustom-character GTGA scaffold_9 1250830 TTGTGGGGA TTGTcustom-character GGGA TTGTcustom-character GGGA TTGTcustom-character GGGA scaffold_9 1499265 AGTCAGACA AGTCAGACA AGTCcustom-character GACA AGTCcustom-character GACA scaffold_9 1499300 TATGACACC TATGcustom-character CACC TATGcustom-character Ccustom-character CC TATGACACC scaffold_9 1676755 CTGCCGTTT CTGCcustom-character GTTT CTGCcustom-character GTTT CTGCcustom-character GTTT scaffold_9 1702348 AGACGCATC AGACGCATC AGACcustom-character CATC AGACcustom-character CATC scaffold_9 1702552 CAAAGTCAT CAAAGTCAT CAAAGTCAT CAAAGTCAT scaffold_9 1702583 ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG scaffold_9 1702658 TTGTCGTGG TTGTcustom-character TGG TTGTcustom-character TGG TTGTCcustom-character TGG scaffold_10 100470 TCACCATCG TCACCATCG TCACcustom-character ATCG TCACCATCG scaffold_10 350030 GCGGCTCAA GCGGCTCAA GCGGcustom-character TCAA GCGGcustom-character TCAA scaffold_10 354531 AATCAATCA AATCAATCA AATCcustom-character ATCA AATCcustom-character ATCA scaffold_10 633622 TGGGCAAAG TGGGCAAAG TGGGcustom-character AAAG TGGGcustom-character AAAG scaffold_10 860249 CCGCAAATT CCGCAAATT CCGCcustom-character AATT CCGCAAATT scaffold_10 863401 ATAAAATTT ATAAAATTT ATAAAATTT ATAAAcustom-character TTT scaffold_10 1107782 CAACCCCAC CAACCCCAC CAACCCCAC CAACCCCAC scaffold_10 1338596 GTGCATCAT GTGCATCAT GTGCcustom-character TCAT GTGCcustom-character TCAT scaffold_10 1477092 AGATGCAAA AGATGCAAA AGATcustom-character CAAA AGATGCAAA scaffold_10 1612161 TCTTCGGAG TCTTCGGAG TCTTCGGAG TCTTCGGAG scaffold_10 1612569 ATTATATTC ATTATATTC ATTATATTC ATTATATTC scaffold_10 1612630 TGGCTCCTT TGGCTCCTT TGGCTCCTT TGGCcustom-character CCTT scaffold_10 1612671 GGAATCGTC GGAATCGTC GGAATCGTC GGAAcustom-character CGTC scaffold_11 101855 CCAGCCTGT CCAGCCTGT CCAGcustom-character CTGT CCAGCCTGT scaffold_11 173230 AGCGGGCGA AGCGGGCGA AGCGGGCGA AGCGGGCGA scaffold_11 350000 GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG scaffold_11 378409 TGATTGGGG TGATTGGGG TGATcustom-character GGGG TGATTGGGG scaffold_11 600001 TGGGCGCGC TGGGCGCGC TGGGcustom-character GCGC TGGGcustom-character GCGC scaffold_11 627221 TCTTCGCCC TCTTCGCCC TCTTcustom-character GCCC TCTTcustom-character GCCC scaffold_11 929659 GGAATATCA GGAATATCA GGAAcustom-character TCA GGAATATCA scaffold_11 931877 GACCTCACC GACCTCACC GACCcustom-character CACC GACCcustom-character CACC scaffold_11 1155850 T-TGCCACG T-TGCCACG Tcustom-character TGcustom-character CACG Tcustom-character Tcustom-character CCACG scaffold_11 1240230 ACAAGATTC ACAAGATTC ACAAcustom-character ATTC ACAAGATTC scaffold_11 1250447 GAGGCTACA GAGGCTACA GAGGcustom-character TACA GAGGcustom-character TACA scaffold_12 109790 GTCTGCACC GTCTGCACC GTCTcustom-character CACC GTCTGCACC scaffold_12 272255 CCGAGTGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT scaffold_12 281720 CTTCCGGCG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG scaffold_12 281763 TCTGCAGCC TCTGCAGCC TCTGcustom-character AGCC TCTGCAGCC scaffold_12 554582 ACTCCGGTC ACTCCGGTC ACTCcustom-character GGTC ACTCcustom-character GGTC scaffold_12 770075 GAACGTTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT scaffold_12 909536 CTATGGAGG CTATGGAGG CTATcustom-character GAGG CTATGGAGG scaffold_12 1000000 CGAGGAGGA CGAGGAGGA CGAGcustom-character AGGA CGAGcustom-character AGGA scaffold_13 100697 ACGTCTTTA ACGTCTTTA ACGTCTTTA ACGTCTTTA scaffold_13 119283 ACGTTACTG ACGTTACTG ACGcustom-character ACTG ACGcustom-character ACTG scaffold_13 363867 ATCCACTGC ATCCACTGC ATCCcustom-character CTGC ATCCcustom-character CTGC scaffold_13 370521 TTTGAGTCA TTTGAGTCA TTTGcustom-character GTCA TTTGcustom-character GTCA scaffold_13 604345 CTTCAGCAT CTTCAGCAT CTTCAGCAT CTTCAGCAT scaffold_13 866136 GTTGGTCAG GTTGGTCAG GTTGcustom-character TCAG GTTGcustom-character TCAG scaffold_14 113109 AGGGAAATA AGGGAAATA AGGGcustom-character AATA AGGGAAATA scaffold_14 372086 CGATCCCTT CGATCCCTT CGATcustom-character CCTT CGATCCCTT scaffold_14 603118 GGCCCGCCT GGCCCGCCT GGCCcustom-character GCCT GGCCCGCCT scaffold_14 725687 AGTTCGAAA AGTTCGAAA AGTTcustom-character Gcustom-character AA Acustom-character TTcustom-character GAAA scaffold_14 808308 AAGGTATGG AAGGTATGG AAGcustom-character ATGG AAGGcustom-character ATGG scaffold_15 101381 TAAACAGAT TAAACAGAT TAAAcustom-character AGAT TAAAcustom-character AGAT scaffold_15 150013 GTGGCCCGT GTGGCCCGT GTGGcustom-character CCGT GTGGCCCGT scaffold_15 367204 CGCGCCCTA CGCGCCCTA CGCGcustom-character CCTA CGCGcustom-character CCTA scaffold_16 106292 AAGCTGGAA AAGCcustom-character GGAA AAGCcustom-character GGAA AAGCcustom-character GGAA scaffold_16 205778 CAAGGTCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG scaffold_16 400000 CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT scaffold_16 403998 CAAAGTACG CAAAGTACG CAAAcustom-character TACG CAAAGTACG scaffold_17 134688 CCCGCTTCA CCCGCTTCA CCCGcustom-character TTCA CCCGCTTCA scaffold_17 370858 GACACAACG GACAcustom-character AACG GACAcustom-character AACG GACAcustom-character AACG scaffold_17 449833 ATCAGACAA ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A scaffold_17 472545 CCGTTCATG CCGTTCATG CCGTcustom-character Ccustom-character TG CCGTTCATG scaffold_18 112940 GCGGGTGGG GCGGGTGGG GCGGcustom-character TGGG GCGGGTGGG scaffold_18 126322 CCTCTTCCG CCTCTTCCG CCTCcustom-character TCCG CCTCcustom-character TCCG scaffold_19 87323 CCCAAGCAA CCCAAGCAA CCCAcustom-character GCAA CCCAAGCAA scaffold_19 98782 AAAATTGTT AAAATTGTT AAAAcustom-character TGTT AAAATTGTT

[0047] Tables I and II comprise sets of SNP markers present in N-s34 and LA3782, respectively, described as 9-mers. Positional information refers to the 17 substantial contigs of the H97 V. 2.0 genome sequence assembly (JGI). Because a heterokaryon incorporates two sets of chromosomes, one from each haploid parent, there are two allelic copies (two characters or elements of the genotype) at each marker locus for LA3782. The IUPAC nucleotide and so-called “ambiguity” codes, (also see Annex C, Appendix 2, Table 1, Nucleotide and Amino Acid Symbols as set forth in Standard ST. 25 of the Handbook on Industrial Property Information and Documentation (WIPO) (December 2009)) which are actually heteroallelism codes when used to represent a heterokaryon or diploid genotype, are used in Tables I and II to represent heteroallelic DNA sequence positions, wherein each of two alleles incorporates a different nucleotide at a particular position, in the observed 9-base DNA marker sequences reported above, each of which represents a genotypic marker locus. The identity of each marker locus is specified by the scaffold and SNP position information derived from the H97 V2.0 standard reference genome sequence published by the U.S. Department of Energy Joint Genome Institute (Morin et al. 2012), incorporated herein by reference.

[0048] It will be appreciated however that any suitable Polymerase Chain Reaction (PCR) primers that bracket the defined marker regions may be used for identifying the alleles, using methods of designing and using suitable PCR primers that are well known in the art. Distinctions between the homoallelic genotypes of line N-s34 and line H97 are evident, as is the composite nature of the example heteroallelic genotype of F1 hybrid strain LA3782, in which the presence of the genome of N-s34 is evident, as expected, by virtue of perfect conformity, with no conflicts, with the presence of the alleles known to be evident in LA3782. The genotype of strain LA3782 is a composite of those of line N-s34 and the BP-1 homokaryon, and demonstrates that the N-s34 chromosome set can be observed within the F1 hybrid genotype. Methods employing these and other markers to determine genealogical relationships between cultures are provided below.

[0049] Alternatively, one can use the six SCAR marker loci p1 n150, ITS, MFPC-1-ELF, AS, AN, and FF as described in U.S. Pat. Nos. 7,608,760, 9,017,988 and below. Each have approximately 10 (or more) known alleles, so that the number of heterokaryotic genotypes possible is on the order of one trillion (1012). These six markers are the six most commonly referenced marker loci in the industry and are considered art standard designations in that all six of the marker loci have been used, in one form or another, to characterize the genotype of Agaricus strains in at least one public source publication. Brief descriptions of relevant alleles at these six unlinked marker loci are provided in Table Ill. Genotypes at these six loci were determined both by Whole Genome Sequencing and by SCAR-PCR, as described in the experimental part below.

TABLE-US-00002 TABLE III allelic markers in the N-s34 line and LA3782 strain of the invention Scaffold ID Ref Pos H97 vers 2.0 N-s34 LA3782 p1n150-G3-2 (scaffold_1) 868615 1T 2 2/5 ITS (scaffold_10) 1612110 I1 I1 I1/I5 MFPC-ELF (scaffold_8) 829770 E1 E1 E1/E3 AN (scaffold_9) 1701712 N1 N2 N2/N3 AS (scaffold_4) 752867 SD SD SA/SD FF (scaffold_12) 281674 FF1 FF1 FF1/FF3

[0050] The markers of Tables I to III can be used for example to empirically determine inclusion of a culture within the scope. Genotype analysis including either Polymerase Chain Reaction (PCR) based analysis of polymorphic regions, or whole genome sequencing, is routinely used to establish the degree and nature of genetic identity with an initial culture to define the class of cultures directly or indirectly derived therefrom in Agaricus bisporus. Either all markers in the derived strain or culture will correspond to markers in the initial strain or culture, or else representation of the markers will typically be higher than 90%, but not lower than 65 or 70%, preferably not lower than 75%, in the derived strain or culture. Using a sufficient number of genetic markers, and especially the 6 highly polymorphic markers of table 1111, the status of a derived strain or culture can be unambiguously determined, and statistically beyond challenge. Similar analyses can establish the nature of the relationship between two cultures, including self, clone, subculture, somatic selection, tissue selection, inbred descendent, outbred descendent, back-bred descendent, transformed culture, mutagenized culture, F1 hybrid, and subsequent generations of hybrids, with high statistical confidence.

[0051] In some embodiments, the culture of the invention may be obtained using at least one strain development technique selected from the group consisting of inbreeding, including intramixis, outbreeding, i.e., heteromixis, selfing, backmating, introgressive trait conversion, derivation, somatic selection, tissue selection, single-spore selection, multispore selection, pedigree-assisted breeding, marker assisted selection, mutagenesis and transformation, and applying said at least one strain development technique to a first mushroom culture, or parts thereof, said first culture comprising at least one set of chromosomes of an Agaricus bisporus line N-s34.

[0052] If one parental line carries allele ‘p’ at a particular locus, and the other parental line carries allele ‘q’, the F1 hybrid resulting from a mating of these two lines will carry both alleles, and the genotype at that locus can be represented as ‘p/q’ (or ‘pq’, or ‘p+q’). Sequence-characterized markers are ordinarily codominant and both alleles will be evident when an appropriate sequencing protocol is carried out on cellular DNA of the hybrid. After determining the genotypic profile of a strain or hybrid, reference to the genotypic profile of line N-s34 can therefore be used to identify hybrids comprising line N-s34 as a parent, or parental, line, since such hybrids will comprise two sets of alleles, one of which sets will be from, and will match that of, line N-s34. The match can be demonstrated by subtraction of the second allele from the genotype, leaving the N-s34 allele evident at every locus. A refinement of this approach is possible with hybrids of Agaricus bisporus as a consequence of the heterokaryon (N+N) condition existing in hybrids. The two (pre-meiotic, non-recombinant) haploid nuclei can be physically isolated by various known techniques (e.g., protoplasting) into viable ‘neohaplont’ subcultures, and each may then be characterized independently. One of the two neohaplont nuclear genotypes from the F1 hybrid will be that of line N-s34, demonstrating its prior use in the mating step of the method, and its presence in the hybrid. Obtaining deheterokaryotized neohaplont homokaryons from a heterokaryon, including a heterokaryotic culture of the invention, by repartitioning individual haploid nuclei using protoplasting, fragmentation, hyphal tip excision, or other technique, is one method of culture derivation.

[0053] As described in the experimental part below, LA3782 has an improved yield, a more balanced yield due to improved third-break yield, and mushrooms with improved keeping qualities, compared to a leading commercial strain, Heirloom/BR06. It achieves these improvements by virtue of a novel genotype which is more than 30% different from other known brown-capped strains (see table VI). That genotype also confers a phenotype that is incompatible with other leading brown-capped strains, providing a barrier to infection by endogenous viruses, a trait which can be exploited by farm hygiene regimens. Further, the genetic distinctness provides genetic diversification of the global mushroom crop, which will provide new opportunities to meet existing and emerging challenges in the diverse markets in which edible Agaricus bisporus mushrooms are grown and sold.

[0054] In a preferred embodiment of the invention, the strain culture of the invention is characterized in that the total yield performance of the crops of said culture are equal to or exceed the total yield performance of crops of a BR06/Heirloom or J15051 strain of Agaricus bisporus. Total yield performance can be measured as defined below in large scale trials. During such trials, incubation period can be for example of 18 days in bulk phase III tunnel, spawning rate can be 8 litres/ton of compost phase II. Trays can be filled with 135 kg incubated compost with a filling rate of 90 kg/m.sup.2. Mc substrate supplement can be added at the rate of 1.33 kg/m.sup.2. Carbo 9 casing from supplier Euroveen can be applied with 1200 g/m.sup.2 compost casing, premixed. Airing can start on day 4 after casing. To collect yield, mushrooms can be picked and weighed daily, on at least three replicates. Data can be collected over several flushes. Total yields should be compared on the same number of flushes.

[0055] In another embodiment of the invention, the strain culture of the invention is characterized in that the third-flush yield of the crops of said culture significantly exceeds that of the BR06/Heirloom strain. Yield performance can be measured as defined above. Data are preferably collected over at least three flushes. In a preferred embodiment, the third-flush yield of the strain of the invention exceeds the BR06/Heirloom third-flush yield by more than 15%, preferably by more than 20%, more preferably by more than 30% when cultured and picked in the same conditions. The examples below demonstrate that the third-flush yield of LA3782 is also higher than the third-flush yield measured for two other strains of the prior art, namely Tuscan and J15051 (Table VIII). In a preferred embodiment, the third-flush yield of the strain of the invention exceeds the Tuscan and the J15051 third-flush yields by more than 15%, preferably by more than 20%, more preferably by more than 30% when cultured and picked in the same conditions.

[0056] In another embodiment, the culture of the invention is a strain of Agaricus bisporus that produces mushrooms which have a significantly higher piece weight than do mushrooms produced by BR06/Heirloom. This trait can be assessed during the first and second flush of mushroom production, on several medium size mushrooms (typically 4-5 cm in diameter). Each replicate is individually weighed. In a preferred embodiment, the mushroom piece weight of the strain of the invention after the first flush exceeds the BR06/Heirloom and Tuscan mushroom piece weight by more than 10%, preferably by more than 20%, more preferably by more than 30% when cultured and picked in the same conditions (Table X below).

[0057] In another embodiment, the mushroom product of the crops of said culture retains more weight after a number of days of post-harvest storage at 4 degrees Celsius than does the mushroom product of the BR06/Heirloom strain, the number of days selected from the group comprising 3, 4, 5, 6, 7, and 8 days. This measurement can be done as disclosed in the experimental part below. Piece weight collection can be carried out as disclosed in the example part below. Piece weight is preferably evaluated in Flush 1, for example for three to five replicate styrofoam tills per strain. Briefly, the weight of the empty till is recorded, then a define number mushrooms are placed into each till, spaced enough to not touch each other. They are placed with the stem up, and immediately weighed. This weight corresponds to the “initial weight”. Then the tills are placed at 4° C. for 8 days in a walk-in cooler. The till weights are recorded each day. After subtracting the weight of the empty till, percentage of weight retention can be calculated.

[0058] By “significantly”, it is herein meant that the third-flush yield/mushroom weight of the strain of the invention is superior to the yield/mushroom weight of the reference strain with a probability/p-value inferior or equal to 0.05 or less, according to a t-test or other parametric statistical test that compares a series of quantitative results from two or more treatments.

[0059] In another embodiment, the strain culture of the invention is able to produce a mushroom whose cap-color is similar to the one of LA3782, as described in Table XI below.

[0060] In a preferred embodiment of the invention, the culture of the invention as described hereinabove is characterized in that: (a) the yield performance of the crops of said culture are equal to or exceed the yield performance of crops of a BR06/Heirloom strain of Agaricus bisporus, (b) a third-flush yield of the crops of said culture significantly exceeds that of the BR06/Heirloom strain, and (c) the mushroom product of the crops of said culture retains more weight after a number of days of post-harvest storage at 4 degrees Celsius than does the mushroom product of the BR06/Heirloom strain, the number of days selected from the group comprising 3, 4, 5, 6, 7, and 8 days. The strain BR06/Heirloom is the one that has been deposited under Budapest Treaty governing the deposit of organisms at the American Type Culture Collection (ATCC), Rockville, Md., USA, under ATCC accession number PTA-6876.

[0061] Another genetically-determined phenomenon exhibited by Agaricus bisporus and other basidiomycete fungi is vegetative incompatibility. Empirically, it is regularly observed that, in physical contact, a first strain is unable to fuse (anastomose) freely and grow together with any other genetically distinct strain, in other words, with any other strain having less than complete genetic identity with a first strain. The genetics are only partially understood for ‘model’ basidiomycetes, but are known to involve multiple genes and alleles, providing such a large number of combinations that, for practical purposes, each genotype (and each independent strain, including wild strains, cultivars, and hybrids) is extremely unlikely to reoccur in a second strain, and therefore, is effectively unique. The vegetative incompatibility phenotype has two significant commercial and technical implications. First, by using protocols that pair two strains in cropping tests and assess their interaction, it provides a practical test of identity or non-identity between pairs of strains, independent of ‘genetic fingerprinting’. Second, vegetative incompatibility between non-identical strains retards or even prevents the transmission of detrimental viruses between different strains, which can improve facility hygiene and profitability.

[0062] In a preferred embodiment of the invention, the culture of the invention is vegetatively incompatible with the strains of the prior art, in particular with the strain BR06/Heirloom or B14528/Tuscan, as shown below.

[0063] In a preferred embodiment, the culture of the invention is a culture of a strain of Agaricus bisporus that has less than 99%, 98%, 97%, 96%, 95%, 90%, 80%, 75%, 70%, or 60% genetic similarity to BR06/Heirloom and B14528/Tuscan, and preferably, to a group of any brown-capped strains having both a history of commercial sales and a presence in the record of patent cases in the prior art, the group specifically comprising S600/X618, Bs526, Fr24, Brawn, J15051, BR06/Heirloom and B14528/Tuscan.

[0064] In other embodiments, the culture of the invention results from a strain development technique and is a culture derived, descended, or otherwise obtained from the line/strain culture of the invention. The resulting culture thus has at least one genealogical relationship with the initial culture, wherein that genealogical relationship is selected from the group consisting of (1) identity, i.e., self, clone, subculture, (2) descent, i.e., inbred descendent, outcrossed descendent, backcrossed descendent, F1 hybrid, F2 hybrid, F3 hybrid, F4 hybrid, F5 hybrid, and (3) derivation, i.e., derived culture.

[0065] LA3782 is an F1 hybrid strain having N-s34 as one parent and a homokaryon from strain BP-1 as a second parent. In strains of the F1 generation incorporating a set of chromosomes and genotypic markers from N-s34, by virtue of direct descent from the N-s34 parent, 50% of the heterokaryotic strain's genotypic markers will be those of the set from N-s34. An F2 hybrid in this genealogy descending from N-s34 will have on average 25%, and typically about 20-30%, of its genotypic markers from those of N-s34. An F3 hybrid in this genealogy descending from N-s34 will have on average 12.5%, and typically about 10-15%, of its genotypic markers from those of N-s34. An F4 hybrid in this genealogy descending from N-s34 will have on average 6.25%, and typically about 4-8%, of its genotypic markers from those of N-s34. An F5 hybrid in this genealogy descending from N-s34 will have on average 3.13%, and typically about 1.5-4.5%, of its genotypic markers from those of N-s34. In other words, the F1 offspring of N-s34 will comprise about 100 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I, the F2 offspring will comprise about 50 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I, the F3 offspring of N-s34 will comprise about 25 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I, and the F4 offspring will comprise about 10 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I,

[0066] The culture of the invention is a strain of Agaricus bisporus that has a genealogical relationship of identity, descent, or derivation from (a) line N-s34 or from (b) strain LA3782. More precisely, the culture of the invention may have, as the initial culture from which it is derived, one of the following cultures: an Agaricus bisporus haploid line culture N-s34, a haploid line culture comprising at least one set of chromosomes of an Agaricus bisporus line N-s34, a hybrid heterokaryotic culture obtained by mating N-s34 with a second culture to produce an F1 generation, any culture of generation F2, F3, F4, F5, inclusive, that is obtained from the F1 generation of the invention, a culture obtained from line N-s34 by using at least one strain development technique, an inbred descendent of N-s34, an outcrossed descendent of N-s34, and a derived variety of any culture that was obtained from N-s34 by using at least one strain development technique.

[0067] In a particular aspect, the present invention relates to an Agaricus bisporus mushroom strain culture of the F2, F3, F4, or F5 generation, descended from the F1 hybrid as defined above, and preferably from the F1 hybrid LA3782, or from a strain derived from strain LA3782. Said strain preferably comprises respectively at least 40-60%, at least 20-30%, at least 10-15%, or at least 4-8% of the Single-Nucleotide Polymorphisms (SNPs) present in the genome of the Agaricus bisporus strain LA3782, a representative culture of said line having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5527.

[0068] More precisely, the F1 offspring of LA3782 (F2 offspring of N-s34) will comprise at least about 100 allelic markers out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II and at least about 50 allelic markers out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I; the F2 offspring will comprise at least about 50 out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II and at least about 25 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I; and the F3 offspring of LA3782 will comprise at least about 25 out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II and at least about 10 out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I,

[0069] In other words, the strain culture of the invention preferably comprises at least about 100 out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II (F1 offspring of LA3782), at least about 50 out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II (F2 offspring of LA3782) or at least about 25 out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II (F3 offspring of LA3782).

[0070] The strain culture of the invention is not the strain BP-1 having been deposited under Budapest Treaty governing the deposit of organisms at the American Type Culture Collection (ATCC), Rockville, Md., USA, under ATCC Accession Number PTA-6903. In a preferred embodiment, the strain culture of the invention differs from BP-1 on at least 10%, 20%, 30%, 40%, or at least 50% of its allelic markers. In other words, the strain culture of the invention does not have more than 90%, 80%, 70%, 60% or 50% of identity with BP-1.

[0071] In one embodiment, the culture of the invention has a set of chromosomes having at least 65%, at least 70%, or at least 75% genotypic and genomic identity with the chromosomes of the culture of line N-s34, preferably with the culture of the F1 hybrid produced by mating line N-s34 with a second, different Agaricus bisporus culture, more preferably with the strain LA3782.

[0072] In a particular embodiment, the strain of the invention is an F2 hybrid having the F1 hybrid heterokaryon culture LA3782 as at least one parent, and having at least one haploid chromosome set comprising 50% of the allelic markers present in the genotype of the F1 hybrid; an F3 hybrid having said F2 hybrid as at least one parent, and having at least one haploid chromosome set comprising 50% of the allelic markers present in the genotype of the F2 hybrid; an F4 hybrid having said F3 hybrid as at least one parent, and having at least one haploid chromosome set comprising 50% of the allelic markers present in the genotype of the F3 hybrid; an F5 hybrid having said F4 hybrid as at least one parent, and having at least one haploid chromosome set comprising 50% of the allelic markers present in the genotype of the F4 hybrid.

[0073] The SNPs present in the genome of the Agaricus bisporus line N-s34 can be easily identified by whole genome sequencing or by using conventional markers such as those described in U.S. Pat. No. 7,608,760 or 9,017,988. Table I gives a number of useful sequences that characterize the line N-s34 of the invention. Any other SNP can however be used to identify progenies of the lines of the invention.

[0074] The SNPs present in the genome of the Agaricus bisporus strain LA3782 can be easily identified by whole genome sequencing or by using conventional markers such as those described in U.S. Pat. No. 7,608,760 or 9,017,988. Table II and Table III give a number of useful sequences that characterize the strain LA3782 of the invention. Any other SNP can however be used to identify progenies of the strains of the invention.

[0075] In a preferred embodiment, the Agaricus bisporus mushroom strain culture of the invention descends from line N-s34 and contains approximately 50%, approximately 25%, approximately 12.5%, approximately 6.25%, or approximately 3.13% of the SNPs present in the genome of the Agaricus bisporus line N-s34, preferably of the SNPs disclosed in Table I. In another preferred embodiment, the Agaricus bisporus mushroom strain culture of the invention descends from line N-s34 and contains at least about 100, between 50 and 100, between 25 and 50 or between 10 and 25 allelic markers out of the 203 sequence-characterized allelic markers of N-s34 listed in Table I.

[0076] In a preferred embodiment, the Agaricus bisporus mushroom strain culture of the invention descends from the strain LA3782 and contains approximately 50%, approximately 25%, approximately 12.5%, approximately 6.25%, or approximately 3.13% of the SNPs present in the genome of the Agaricus bisporus strain LA3782, preferably of the SNPs disclosed in Table II or Table III. In another preferred embodiment, the Agaricus bisporus mushroom strain culture of the invention descends from the strain LA3782 and contains at least about 100, between 50 and 100, between 25 and 50 or between 10 and 25 allelic markers out of the 203 sequence-characterized allelic markers of LA3782 listed in Table II,

[0077] The term “approximately” or “about” herein inculcates a range of plus or minus 20% above or below the stated value.

[0078] To calculate the percentage of SNPs between two strains, one can compare the composite 9-mer genotype at each locus and assign a value if 1 for a perfect match, or a 0 for anything less than a perfect match. Then the values can be totaled for all loci in each pairwise comparison between strains, and divided by the total number of loci compared. The resulting decimal can be eventually converted to %.

[0079] In another embodiment, the culture of the invention comprises at least one set of chromosomes having at least 65%, 70%, 75%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% genetic identity with the chromosomes of N-s34. In a further embodiment, the culture of the invention comprises at least one set of chromosomes having a genotype with at least 65%, 70%, 75%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% representation of the markers present on the chromosomes of N-s34.

[0080] More precisely, the Agaricus bisporus mushroom culture of the invention can be derived from the initial culture chosen in the group consisting of: [0081] a) the strain LA3782, a representative culture of said strain having been deposited under the CNCM Accession Number I-5527 at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, [0082] b) the Agaricus bisporus line N-s34, a representative culture of said line having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5528, and [0083] c) any culture that is defined above.

[0084] Preferably, said culture is characterized in that it comprises at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or even 100% of the sequence-characterized allelic markers of N-s34 listed in Table I or of LA3782 listed in Table II.

[0085] In another aspect, the present invention relates to cells, hyphae, mycelium, mushrooms, germinated spores, ungerminated spores, homokaryons, and heterokaryons including SNPs, NSNPs, and aneuploids obtained from the progeny and derived culture described above.

[0086] The present invention also relates to methods for producing the lines and strains of the invention. In particular, the present invention relates to a method for developing a new Agaricus bisporus culture, said method comprising applying at least one mushroom strain development technique to the homokaryon line N-s34, a representative culture of which having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5528 or to a progeny thereof, to provide a new culture.

[0087] Also, the present invention relates to a method for developing a new Agaricus bisporus culture, said method comprising applying at least one mushroom strain development technique to an homokaryon of the strain LA3782, a representative culture of which having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5527, or to a progeny thereof, to provide a new culture.

[0088] Preferably, said new culture will have any of the features described above for the strains of the invention.

[0089] Specifically, said new culture will preferably have any of the following desired traits: (a) an enhanced total yield performance, (b) an enhanced third-flush yield, (c) a good weight, and/or (d) a brown color.

[0090] In a preferred embodiment, said new culture will have: [0091] (a) a yield performance of the crops that is equal to or exceeds the yield performance of crops of a BR06/Heirloom strain of Agaricus bisporus, and/or [0092] (b) a third-flush yield of the crops that exceeds that of the BR06/Heirloom strain, and/or [0093] (c) mushroom product of the crops that retains more weight after a number of days of post-harvest storage at 4 degrees Celsius than does the mushroom product of the BR06/Heirloom strain, the number of days selected from the group comprising 3, 4, 5, 6, 7, and 8 days.

[0094] These features have been described in details above. The strain BR06/Heirloom is the one that has been deposited under Budapest Treaty governing the deposit of organisms at the American Type Culture Collection (ATCC), Rockville, Md., USA, under ATCC accession number PTA-6876.

[0095] In a particularly preferred embodiment, this new culture will be the F2, F3, F4, or F5 generation descended from the F1 hybrid LA3782, or from a strain derived from strain LA3782. As such, it may comprise respectively at least 40-60%, at least 20-30%, at least 10-15%, or at least 4-8% of the Single-Nucleotide Polymorphisms (SNPs) present in the genome of the Agaricus bisporus strain LA3782, a representative culture of said line having been deposited at the Collection Nationale de Cultures de Microorganismes (CNCM), Institut Pasteur, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, on Jun. 30, 2020, under the CNCM Accession Number I-5527.

[0096] Preferably, said SNPs are the complete set of SNPs of said hybrid, or a subset thereof, for example the subset disclosed in Table II or Table III.

[0097] A number of strain development techniques are known in the art. Some of them are detailed below, in the definition part of the application. Any known technique can be used.

[0098] Introducing a desired trait into a culture, for example into Agaricus bisporus line N-s34, can comprise the steps of: (1) physically mating the culture of Agaricus bisporus line N-s34 to a second resultant culture of Agaricus bisporus having the desired trait, to produce a hybrid; (2) obtaining an offspring that carries at least one gene that determines the desired trait from the hybrid; (3) mating said offspring of the hybrid with the culture of Agaricus bisporus line N-s34 to produce a new hybrid; (4) repeating steps (2) and (3) at least once to produce a subsequent hybrid; (5) obtaining a homokaryotic line carrying at least one gene that determines the desired trait and comprising at least 75% of the alleles of line N-s34, for example at the sequence-characterized marker loci described in Table I, from the subsequent hybrid of step (4).

[0099] The number “75% of parental DNA in a back-mating (backcross) is an approximation because in the meiosis occurring in the F1 hybrid, random assortment of recombined or unrecombined chromosomes will result in haploid/homokaryotic nuclei having more or less DNA from each of the two parents, balanced around a mean value of 50% (which becomes a mean of 25% in the back-mating).

[0100] In another aspect, the present invention relates to a method of producing a mushroom culture comprising the steps of: [0101] (a) growing a progeny culture produced by mating the culture of the invention (typically N-s34 or LA3782) with a second Agaricus bisporus culture; [0102] (b) mating the progeny culture with itself or a different culture to produce a progeny culture of a subsequent generation; [0103] (c) growing a progeny culture of a subsequent generation and mating the progeny culture of a subsequent generation with itself or a different culture; and [0104] (d) repeating steps (b) and (c) for an additional 0-5 generations to produce a mushroom culture.

[0105] In a particular embodiment, said method comprises the steps of: [0106] (a) obtaining a molecular marker profile of Agaricus bisporus mushroom line N-s34 or LA3782; [0107] (b) obtaining an F1 hybrid culture comprising at least one set of chromosomes of Agaricus bisporus line N-s34 or of the strain LA3782; [0108] (c) mating a culture obtained from the F1 hybrid culture (b) with a different mushroom culture; and [0109] (d) selecting progeny that possess characteristics of said molecular marker profile of line N-s34 or of strain LA3782.

[0110] In another aspect, the present invention relates to a method of producing edible mushrooms, including the step of inoculating compost with a heterokaryotic culture of the invention to produce a crop of mushrooms. A yet further embodiment of the invention is a method of improving farm hygiene, including the step of inoculating compost with the culture of the invention. Yet another embodiment of the invention is a method of crop diversification, including the step of inoculating compost with a culture of the invention.

[0111] In another aspect, the present invention also relates to any product incorporating the culture of the invention, including spawn, inoculum, mushrooms, mushroom parts, mushroom pieces, processed foods. All these terms are defined in the “definitions” below.

Definitions

[0112] Initially, in order to provide clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided. [0113] Allele: one of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome; a heritable unit of the genome at a defined locus, ultimately identified by its DNA sequence (or by other means). [0114] Amphithallism: A reproductive syndrome in which heteromixis and intramixis are both active. [0115] Anastomosis: Fusion of two or more hyphae that achieves cytoplasmic continuity. [0116] Basidiomycete: A monophyletic group of fungi producing meiospores on basidia; a member of a corresponding subdivision of Fungi such as the Basidiomycetales or Basidiomycotina. [0117] Basidium: The meiosporangial cell, in which karyogamy and meiosis occur, and upon which the basidiospores are formed. [0118] Bioefficiency: For mushroom crops, the net fresh weight of the harvested crop divided by the dry weight of the compost substrate at the time of spawning, for any given sampled crop area or compost weight. [0119] Breeding: Development of strains, lines or cultures using methods that emphasize sexual mating. [0120] Cap: Pileus; part of the mushroom, the gill-bearing structure. [0121] Cap Roundness: Strictly, a ratio of the maximum distance between the uppermost and lowermost parts of the cap, divided by the maximum distance across the cap, measured on a longitudinally bisected mushroom; typically averaged over many specimens; subjectively, a ‘rounded’ property of the shape of the cap. [0122] Carrier substrate: A medium having both nutritional and physical properties suitable for achieving both growth and dispersal of a culture; examples are substrates that are formulated for mushroom spawn, casing inoculum, and other inoculum. [0123] Casing layer, casing soil, casing: A layer of non-nutritive material such as peat or soil that is applied to the upper surface of a mass of colonized compost in order to permit development of the mushroom crop. [0124] Casing inoculum (CI): A formulation of inoculum material incorporating a mushroom culture, typically of a defined heterokaryotic strain, suitable for mixing into the casing layer. [0125] Cloning: Somatic propagation without selection; produces a clone, which is one category of genealogical relationship (i.e., ‘identity’). [0126] Combining ability: The capacity of an individual to transmit superior performance to its offspring. General combining ability is an average performance of an individual in a particular series of matings. [0127] Compatibility: See heterokaryon compatibility, vegetative compatibility, sexual compatibility; incompatibility is the opposite of compatibility. [0128] Culture: The tangible living organism; the organism propagated on various growth media and substrates; a portion of, or the entirety of, one physical strain, line, homokaryon or heterokaryon; the sum of all of the parts of the culture, including hyphae, mushrooms, spores, cells, protoplasts, nuclei, mitochondria, cytoplasm, DNA, RNA, and proteins, cell membranes and cell walls. [0129] Derivation: Development of strains, lines or cultures generally using methods other than sexual mating, and/or undertake development solely or predominantly from an initial strain or culture; see Derived strain, Derived culture. [0130] Derived culture: A culture obtained by derivation as defined above, exemplified by but not restricted to ‘derived strain’ or ‘derived line’; one category of genealogical relationship. [0131] Derived lineage group: The set of strains or cultures derived solely from a single initial strain or culture (which is the earliest member of the group). [0132] Derived strain/line: A strain/line developed solely or predominantly from a single initial strain/line. Methods employed to obtain derived strains/lines from an initial strain/line include somatic selection, tissue culture selection, single-spore germination, multiple-spore germination, selfing, repeated mating back to the initial culture, mutagenesis, and transformation, to provide some examples. In Agaricus bisporus, properties of derived strains include a high fidelity to the genotype and phenotype of the initial strain. In somatic selection and tissue culture selection, the derived culture may be a clone, or virtually a clone, of the initial culture, and, as with mutagenesis, it may not be feasible to specify an actual difference with the initial strain; measurable genetic identity with the initial strain may reach 100%. In a transformed-derived strain, 99.99+% of the genetic composition is that of the initial strain; the small portion of introduced DNA is ordinarily identifiable. In single-spore germinations and multiple-spore germinations, 100% of the genetic composition of the derived strain is that of the initial strain; however on average about 1% (ranging at about 0-5%) of the initial genetic material may be absent in the derived strain due to recombinational loss of heteroallelism (‘heterozygosity’), thus the ‘derived genotype’ is a subset of the ‘master set’ of the initial strain. In a selfed sibling mating between two compatible haploid homokaryotic offspring from an initial strain, 100% of the genetic composition of the derived strain is that of the initial strain; however on average the loss of initial heteroallelism is about 20%, which is less than the Mendelian expectation of almost 25% due to enforced preservation of heteroallelism on the large Chromosome 1, where the mating compatibility locus MAT is present. Only in a mating of an F1 hybrid back to an initial strain is a substantial portion of the derived genotype, on average about 25%, not present in the initial culture; with repeated back matings to an initial culture, that percentage of non-initial genetic material decreases and approaches zero. When the goal is to preserve a particular trait not present in the initial strain, back-mating may be called ‘single trait conversion.’ [0133] Descent: Genealogical descent over a limited number (e.g., 10 or fewer) of sexual generations; one category of genealogical relationship. [0134] Diploid: Having two haploid chromosomal complements within a single nuclear envelope. [0135] Directed mutagenesis: a process of altering the DNA sequence of at least one specific gene locus. [0136] Flesh Thickness: A ratio of the maximum distance between the top of the stem and the uppermost part of the cap, divided by the maximum distance across the cap, measured on a longitudinally bisected mushroom; typically averaged over many specimens; subjectively called ‘meatiness’.

[0137] Flush: A period of mushroom production within a cropping cycle, separated by intervals of non-production; the term flush encompasses the terms ‘break’ and ‘wave’ and can be read as either of those terms. [0138] Fungus: A microorganism classified as a member of the Kingdom Fungi. [0139] Genealogical relationship: A familial relationship of identity, descent, or derivation from one or more progenitors, for example that between parents and offspring. [0140] Genetic identity: The genetic information that distinguishes an individual, including representations of said genetic information such as, and including: genotype, genotypic fingerprint, genome sequence, genetic marker profile; “genetically identical”=100% genetic identity, “X % generically identical”=having X % genetic identity, etc. % genetic similarity may be used instead of % generic identity when that percentage is less than 100. [0141] Genotypic fingerprint: A description of the genotype at a defined set of marker loci; the known genotype. [0142] Genetic similarity (or genotypic similarity): an expression of the degree to which one set of genetic markers, i.e., one genotype, resembles another. Any representative set of genetic markers, for example SNP markers, can be used. The proportion of markers shared in the genotypes of two individuals or cultures can be expressed to quantify the degree of resemblance between the two cultures, and is an inversely proportional measure of their distinctiveness. The terms can be used interchangeably with (percent) genetic or genotypic identity. The percentage of similarity can be based on the genotypes for any set of markers. [0143] Gill: Lamella; part of the mushroom, the hymenophore- and basidium-bearing structure. [0144] Haploid: Having only a single complement of nuclear chromosomes; see homokaryon. [0145] Heteroallelic: Having two different alleles at a locus; analogous to heterozygous. [0146] Heteroallelism: Differences between homologous chromosomes in a heterokaryotic genotype; [0147] analogous to heterozygosity.

[0148] Heterokaryon: As a term of art this refers to a sexual heterokaryon: a culture which has two complementary (i.e., necessarily heteroallelic at the MAT locus) types of haploid nuclei in a common cytoplasm, and is thus functionally and physiologically analogous to a diploid individual (but cytogenetically represented as N+N rather than 2N), and which is reproductively competent (in the absence of any rare interfering genetic defects at loci other than MAT), and which exhibits vegetative incompatibility reactions with other heterokaryons; also called a strain or stock in the strain development context. [0149] Heterokaryon compatibility: The absence of antagonism observed during physical proximity or contact between two heterokaryons that are not genetically identical; see Heterokaryon Incompatibility. [0150] Heterokaryon incompatibility: The phenomenon of antagonism observed during physical proximity or contact between two heterokaryons that are not genetically identical; a multilocus self/non-self recognition system; i.e., a genetic system that allows one heterokaryon culture to discriminate and recognize another culture as being either self or not-self, that operates in basidiomycete heterokaryons to limit anastomosis (hyphal fusion) and cytoplasmic contact; vegetative incompatibility. [0151] Heterokaryotic: Having the character of a heterokaryon: two haploid nuclei in a common cytoplasm; ordinarily taken to mean two sexually complementary nuclei, but there are exceptions. [0152] Heteromixis: Life cycle involving mating between two different non-sibling haploid individuals or gametes; outbreeding. [0153] Homoallelic: Having not more than one allele at a locus. The equivalent term in a diploid organism is ‘homozygous’. Haploid lines are by definition entirely homoallelic at all non-duplicated loci. [0154] Homokaryon: A haploid culture with a single type (or somatic lineage) of haploid nucleus (cytogenetically represented as N), and which is ordinarily reproductively incompetent, and which does not exhibit typical self/non-self incompatibility reactions with heterokaryons, and which may function as a gamete in sexually complementary anastomoses; a ‘line’ which, as with an inbred plant line, transmits a uniform genotype to offspring; a predominantly homoallelic line that mates well and fruits poorly is a putative homokaryon for strain development purposes; see discussion below. [0155] Homokaryotic: Having the character of a homokaryon; haploid. [0156] Hybrid: Of biparental origin, usually applied to heterokaryotic strains and cultures produced in controlled matings. [0157] Hybridizing: Physical association, for example on a petri dish containing a sterile agar-based nutrient medium, of two cultures, usually homokaryons, in an attempt to achieve anastomosis, plasmogamy, and formation of a sexual heterokaryon (=mating); succeeding in the foregoing. [0158] Hyphae: Threadlike elements of mycelium, composed of cell-like compartments. [0159] Inbreeding: Matings that include sibling-line matings (‘selfing’), back-matings to parent lines or strains, and intramixis; reproduction involving parents that are genetically related. [0160] Induced mutagenesis: a non-spontaneous process of altering the DNA sequence of at least one gene locus. [0161] Initial strain, initial culture: A strain or culture which is used as the sole or predominant starting material in a strain derivation process; more particularly a strain or culture from which a derived strain or derived culture is obtained; the earliest member of a derived lineage group. [0162] Incompatibility: See heterokaryon incompatibility. [0163] Inoculum: A culture in a form that permits transmission and propagation of the culture, for example onto new media; specialized commercial types of inoculum include spawn and CI, wherein the culture is present on a carrier substrate. [0164] Intramixis: A uniparental sexual life cycle involving formation of a complementary ‘mated’ pair of postmeiotic nuclei within the basidium or individual spore; superficially appears to be an asexual process. [0165] Introgressive trait conversion: mating offspring of a hybrid to a parent line or strain such that a desired trait from one strain is introduced into a predominating genetic background of the other parent line or strain. [0166] Lamella: see ‘gill’. [0167] Line: A culture used in matings to produce a hybrid strain; ordinarily a homokaryon which is thus homoallelic, otherwise a non-heterokaryotic (non-NSNPP) culture which is highly homoallelic; practically, a functionally homokaryotic and entirely or predominantly homoallelic culture; analogous in plant breeding to an inbred line which is predominantly or entirely homozygous. [0168] Lineage group: see ‘derived lineage group’. The set of strains or cultures derived solely from a single initial strain or culture. [0169] Locus: A defined contiguous part of the genome, homologous although often varying among different genotypes; plural: loci. [0170] Marker assisted selection: Using linked genetic markers including molecular markers to track trait-determining loci of interest among offspring and through pedigrees. [0171] MAT: The mating-type locus, which determines sexual compatibility and the heterokaryotic state. [0172] Mating: The sexual union of two cultures via anastomosis and plasmogamy; methods of obtaining controlled matings between mushroom cultures are well known in the art. [0173] Mycelium: The vegetative body or thallus of the mushroom organism, comprised of threadlike hyphae. [0174] Mushroom: The reproductive structure of an agaric fungus; an agaric; a cultivated food product of the same name. [0175] Neohaplont: A haploid culture or line obtained by physically deheterokaryotizing (reducing to haploid components) a heterokaryon; a somatically obtained homokaryon; a derived homokaryon. [0176] Offspring: Descendants, for example of a parent heterokaryon, within a single generation; most often used to describe cultures obtained from spores from a mushroom of a strain. [0177] Outbreeding: Mating among unrelated or distantly related individuals. [0178] Parent: An immediate progenitor of an individual; a parent strain is a heterokaryon; a parent line is a homokaryon; a heterokaryon may be the parent of an F1 heterokaryon via an intermediate parent line/homokaryon offspring. [0179] Pedigree-assisted breeding: The use of genealogical information to identify desirable combinations of lines in controlled mating programs. [0180] Phenotype: Observable characteristics of a strain or line as expressed and manifested in an environment. [0181] Plasmogamy: Establishment, via anastomosis, of cytoplasmic continuity leading to the formation of a sexual heterokaryon. [0182] Progenitor: Ancestor, including parent (i.e., the direct progenitor). [0183] Progeny: See Offspring. [0184] Selfing: Mating among sibling lines; see also intramixis. [0185] Sexual compatibility: A condition among different lines having allelic non-identity at the MAT locus, such that two lines are able to mate to produce a stable and reproductively competent heterokaryon. The opposite condition, sexual incompatibility, occurs when two lines each have the same allele at the MAT locus. [0186] Somatic: ‘Of the vegetative mycelium’. [0187] Spawn: A mushroom culture, typically a pure culture of a heterokaryon, typically on a sterile substrate which is friable and dispersible particulate matter, in some instances cereal grain; commercial inoculum for compost; reference to spawn includes reference to the culture on a substrate. [0188] Spore: Part of the mushroom, the reproductive propagule. [0189] Stem: Stipe; part of the mushroom, the cap-supporting structure. [0190] Sterile Growth Media: Nutrient media, sterilized by autoclaving or other methods, that support the growth of the organism; examples include agar-based solid nutrient media such as Potato Dextrose Agar (PDA), nutrient broth, and many other materials. [0191] Stipe: see ‘stem’. [0192] Strain: A heterokaryon with defined characteristics or a specific identity or ancestry. [0193] Targeted mutagenesis: a process of altering the DNA sequence of at least one specific gene locus. Tissue culture: A de-differentiated vegetative mycelium obtained from propagation of a differentiated tissue of the mushroom. [0194] Trait conversion: A method for the selective introduction of the genetic determinants of one (i.e., a single-locus conversion) or more desirable traits into the genetic background of an initial strain while retaining most of the genetic background of the initial strain. See ‘Introgressive trait conversion’ and ‘Transformation’. [0195] Transformation: A process by which the genetic material carried by an individual cell is altered by the incorporation of foreign (exogenous) DNA into its genome or cytoplasm; a method of obtaining a trait conversion including a single-locus conversion, or a novel trait. [0196] Vegetative compatibility: The absence of the phenomenon of antagonism observed during physical proximity or contact between two heterokaryons that are not genetically identical, determined by a multilocus self/non-self recognition system that operates in basidiomycete heterokaryons to limit anastomosis (hyphal fusion) and cytoplasmic contact; Heterokaryon compatibility; the opposite of Vegetative incompatibility. [0197] Vegetative incompatibility: The phenomenon of antagonism observed during physical proximity or contact between two heterokaryons that are not genetically identical, determined by a multilocus self/non-self recognition system that operates in basidiomycete heterokaryons to limit anastomosis (hyphal fusion) and cytoplasmic contact; heterokaryon incompatibility. [0198] Virus-breaking: Using multiple incompatible strains, i.e., strains exhibiting heterokaryon incompatibility, successively in a program of planned strain rotation within a mushroom production facility to reduce the transmission of virus from on-site virus reservoirs into newly planted crops. [0199] Yield: The net fresh weight of the harvest crop, normally expressed in kilograms per square meter. [0200] Yield pattern: The distribution of yield within each flush and among all flushes; influences size, quality, picking costs, and relative disease pressure on the crop and product.

[0201] With respect to the definition of homokaryon above, it is noted that homokaryons and homoallelic lines are subject to technical and practical considerations: A homokaryon in classical terms is a haploid culture which is axiomatically entirely homoallelic. In practical terms, for fungal strain development purposes, the definition is broadened somewhat to accommodate both technical limitations and cytological variation, by treating all predominately homoallelic lines as homokaryons. Technical limitations include the fact that genomes contain duplicated DNA regions including repeated elements such as transposons, and may also include large duplications of chromosomal segments due to historical translocation events. Two different A. bisporus genomes sequenced by the Joint Genome Institute (JGI), a U.S. federal facility, differ in estimated length by 4.4%, and in gene numbers by 8.2%, suggesting a considerable amount of DNA duplication or rearrangement within different strains of the species. No presently available genome of A. bisporus can completely account for the physical arrangement of such elements and translocations, and so the assembled genome sequences of haploid lines may have regions that appear to be heteroallelic using currently available genotyping methods. Cytologically, a homokaryotic offspring will ordinarily be a spore that receives one haploid, postmeiotic nucleus. However, a spore receiving two third-division nuclei from the basidium will be genetically equivalent to a homokaryon. A spore receiving two second-division ‘sister’ postmeiotic nuclei will be a functional homokaryon even though some distal ‘islands’ of heteroallelism may be present due to crossovers during meiosis. Also, a meiosis that has an asymmetrical separation of homologues can produce an aneuploid, functionally homokaryotic spore in which an extra chromosome, producing a region of heteroallelism, is present. All of these cultures are highly homoallelic and all function as homokaryons. Technological limitations make it impractical to distinguish among such cultures, and also to rule out DNA segment duplication as an explanation for limited, isolated regions of the genome sequence assembly that appear to be heteroallelic. Therefore, in the present application, the use of the term ‘homoallelic’ to characterize a line includes entirely or predominately homoallelic lines, and cultures described in this way are functional homokaryons, are putatively homokaryotic, and are all defined as homokaryons in the present application.

[0202] Agaricus bisporus has a reproductive syndrome known as amphithallism, in which two distinct life cycles, namely heteromixis and intramixis, operate concurrently. As in other fungi, the reproductive propagule is a spore. Agaricus produces spores meiotically, on a meiosporangium known as a basidium. In a first life cycle, A. bisporus spores each receive a single haploid postmeiotic nucleus; these spores are competent to mate but are not competent to produce mushrooms. These haploid spores germinate to produce homokaryotic offspring or lines which can mate with other sexually compatible homokaryons to produce novel hybrid heterokaryons that are competent to produce mushrooms. Heterokaryons generally exhibit much less ability to mate than do homokaryons. This lifecycle is called heteromixis, or more commonly, outbreeding. This life cycle, which may be carried out to obtain new hybrid strains in strain development programs, operates but typically does not predominate in strains of Agaricus bisporus var. bisporus.

[0203] A second, inbreeding life cycle called intramixis predominates in most strains of Agaricus bisporus var. bisporus. Most spores, typically 90%-99.9%, receive two post-meiotic nuclei, and most such pairs of nuclei, typically at least 90%, consist of Non-Sister Nuclear Pairs (NSNPs) which have a heteroallelic genotype at most or all centromeric-linked loci including the MAT (=mating type) locus. That MAT genotype determines the expression of the heterokaryotic phenotype of these offspring, which are reproductively competent strains and can produce a crop of mushrooms. Unusually among eukaryotes, relatively lower amounts of chromosomal crossing-over (3.9 crossovers per haploid offspring per generation with the U1 strain as the parent, per Wei Gao, 2014) is observed to have occurred in postmeiotic offspring of Agaricus bisporus; empirically, very little heteroallelism (analogous to heterozygosity), usually not more than 1% on average, per Sonnenberg et al. (2011) is lost among heterokaryotic offspring of a heterokaryotic strain. Consequently, parental and heterokaryotic offspring genotypes and phenotypes tend to closely resemble each other, as noted above. In other words, heterokaryotic offspring of Agaricus bisporus are usually functionally equivalent to, and ordinarily indistinguishable from, their parent, although trivial genetic rearrangements of the parental genome may be present.

[0204] A heterokaryotic selfed offspring of an F1 hybrid that itself has a ‘p/q’ genotype at a hypothetical locus will in the example have a genotype of ‘pip’, ‘q/q’, or 134. Two types of selfing lead to differing expectations about representation of alleles of line N-s34 present in the F1 hybrid in the next heterokaryotic generation obtained from a mating of N-s34. When two randomly obtained haploid offspring from the same F1 hybrid, derived from individual spores of different meiotic tetrads, are mated (i.e., in inter-tetrad selfing), representation of the line N-s34 marker profile in each recombined haploid parental line and in each sib-mated heterokaryon will be 50% on average, and slightly more than 75% (to about 85%) of heteroallelism present in the F1 hybrid will on average be retained in the sib-mated heterokaryon (note that the expectation over 75% is due to the mating-compatibility requirement for heteroallelism at the mating type locus (MAT) on the large Chromosome 1, which comprises about 10% of the nuclear genome). Distinctively, in addition, Agaricus bisporus regularly undergoes a second, characteristic, spontaneous intra-tetrad form of selfing called intramixis, producing heterokaryotic postmeiotic spores carrying two different recombined haploid nuclei almost always having complementary, heteroallelic MAT alleles. An offspring developing from any one of these spores is a postmeiotic self-mated heterokaryon with ca. 100% retention of the heteroallelism present in the single F1 parent around all 13 pairs of centromeres. In theory this value would decrease to an average of 66.7% retention of F1 heteroallelism for distal markers unlinked to their centromeres; however empirical observations suggest higher rates of retention even for such distal markers, in conjunction with limited amount of crossing-over. Applicant typically observes 95%-100% retention of heteroallelism in such heterokaryotic offspring; Sonnenberg et al. (2011) reported an average of 99% retention among such offspring of the U1 strain. Transmission of the line N-s34 marker profile in such selfed offspring may be incomplete by a small percentage (typically 0-5%) due to the effects of infrequent meiotic crossovers however while DNA (and genotypic markers) from N-s34 will still represent 50% on average of the resulting heterokaryotic genome. Both types of selfed offspring are considered to be derived strains from the initial F1 hybrid, and the latter type comprises most (often [95-] 99 [-100]%) of the initial genotype of the F1 hybrid, and may express a very similar phenotype to that of the F1 hybrid, and be functionally equivalent to it.

[0205] When the relationship is one of inbred descent from a heterokaryon, via offspring homokaryons, the two cultures will have a degree of genetic identity with on average about 85% representation and 100% commonality of origin (with respect to the parental culture). When the relationship is one of intramictic inbred descent from a heterokaryon, via a single heterokaryotic spore, the two cultures will have a degree of genetic identity with on average about 95%-99%-100% representation and 100% commonality of origin (with respect to the parental culture). When the relationship is one of back-bred descent from an F1 heterokaryon, via mating an offspring homokaryon to a parental homokaryon such as N-s34, the representation and commonality of origin of the parental homokaryon genotype in the back-bred heterokaryon will both be roughly 75% on average. Somatic selection cultures and tissue selection cultures will effectively have 100% genetic identity with the initial culture, possibly with epigenetic alterations, or rearrangements, or rare mutations, often present at the same rate as in unselected clonal subcultures, and which are virtually impossible to detect. Mutagenized cultures will similarly have effectively 100% genetic identity with their initial culture, except for one or more random point mutations that are impractical to detect. Transformed cultures will typically have at least 99.99% to 100% genetic identity with their initial culture, plus one small piece of exogenous DNA which may or may not be integrated into the Agaricus genome.

EXAMPLES

[0206] A. Distinction of the Lines/Strains of the Invention from Known Brown Prior Art Strains

[0207] The LA3782 strain is substantially different from other brown-capped Agaricus bisporus strains in the prior art.

[0208] To demonstrate this, here are provided the allelic genotype data for six standard markers that were previously reported as SCAR markers (U.S. Pat. Nos. 7,608,760, 9,017,988, and subsequent). Brief descriptions of relevant alleles at these six unlinked marker loci are provided below. Genotypes at these six loci were determined both by Whole Genome Sequencing and by SCAR-PCR, as described below.

[0209] For the SCAR-PCR method, the amplified PCR product DNA was sequenced by a contractor, Eurofins, using methods of their choice, and the genotypes were determined by direct inspection of these sequences followed by SNP analysis and comparison to Applicant's database of reference marker/allele sequences.

[0210] These 6 markers are defined as follows:

[0211] The “p1n150-3G-2” marker is a refinement of the p1n150 marker reported on Chromosome 1 by Kerrigan, R. W., et al. “Meiotic behavior and linkage relationships in the secondarily homothallic fungus Agaricus bisporus.” Genetics 133, 225-236 (1993), and shown to be linked to the MAT (mating type) locus by Xu et al., “Localization of the mating type gene in Agaricus bisporus.” App. Env. Microbiol. 59(9): 3044-3049 (1993) and has also been used in other published studies. While several different primers can be and have been used to amplify segments of DNA in which the p1n150-3G-2 marker is present and from which it can be sequenced, digested, electrophoretically characterized, or otherwise analyzed, the primer sequences employed by the inventors for the development of the disclosed data were: Forward: 5′-aggcrycccatcttcasc-3′ (SEQ ID NO:1); Reverse: 5′-gttcgacgacggactgc-3′ (SEQ ID NO:2), with 35 PCR cycles, 56° C. anneal temperature, 1 min. extension time.

[0212] The “ITS” marker has been adopted as the official ‘barcode’ sequence for all fungi (Schoch et al., Fungal Barcoding Consortium, “Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.” Proc. Nat. Acad. Sci. <www.pnas.org/cgi/content/short/1117018109> (2012)), and has been used in innumerable publications, including Morin et al., “Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche.” Proc. Nat'l Acad. Sci. USA 109: 17501-17506 (2012) on the complete A. bisporus genome sequence. White et al. (1990), Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications. (Innis M A, Gelfand D H, Sninsky J J, White T J, eds). Academic Press, New York, USA: 315-322, published many primer sequences for the ITS marker, of which the inventors used primers ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ (SEQ ID NO:3) and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′ (SEQ ID NO:4), with 35 PCR cycles, 56° C. anneal temperature, 1 min. extension time.

[0213] The “MFPC-1-ELF” marker is derived from a sequence mapped by Marie Foulongne-Oriol et al., “An expanded genetic linkage map of an intervarietal Agaricus bisporus var. bisporus-A. bisporus var. burnettii hybrid based on AFLP, SSR and CAPS markers sheds light on the recombination behaviour of the species.” Fungal Genetics and Biology 47: 226-236 (2010) that is linked to the PPC-1 locus described by Callac et al., “Evidence for PPC1, a determinant of the pilei-pellis color of Agaricus bisporus fruit bodies.” Fungal Genet. Biol. 23, 181-188 (1998). An equivalent linked marker has been used as described in Loftus et al., “Use of SCAR marker for cap color in Agaricus bisporus breeding programs.” Mush. Sci. 15, 201-205 (2000). While several different primers can be and have been used to amplify segments of DNA in which the MFPC-1-ELF marker is present and from which it can be sequenced, digested, electrophoretically characterized, or otherwise analyzed, the primer sequences employed by the inventors for the development of the disclosed data were: Forward: 5′-aytcrcaamaacataccttcaac-3′ (SEQ ID NO:5); reverse: 5′-cattcggcgattttctca-3′ (SEQ ID NO:6), with 35 PCR cycles, 55° C. anneal temperature, 0.5 min. extension time.

[0214] The AN, AS, and FF markers were designed from sequences obtained from PCR products produced by the use of primers disclosed by Robles et al., U.S. Pat. No. 7,608,760, and/or from contiguous or overlapping genome sequences, to improve upon the performance, reliability, and consistency of results, as compared to the markers as originally described by Robles et al.; they are genotypically and genomically equivalent. While several different primers can be and have been used to amplify segments of DNA in which either the AN, AS, or FF marker is present and from which it can be sequenced, digested, electrophoretically characterized, or otherwise analyzed, the primer sequences employed by the inventors for the development of the disclosed data were: [0215] AN: Forward: 5′-gacgatgcgggactggtggat-3′ (SEQ ID NO:7); Reverse: 5′-ggtctggcctacrggagtgttgt-3′ (SEQ ID NO:8), with 35 PCR cycles, 64 C anneal temperature, 2 min. extension time. [0216] AS: Forward: 5′-ccgccagcacaaggaatcaaatg-3′ (SEQ ID NO:9); Reverse: 5′-tcagtcggccctcaaaacagtcg-3′ (SEQ ID NO:10), with 35 PCR cycles, 64 C anneal temperature, 2 min. extension time. [0217] FF: Forward: 5′-TCGGGTGGTTGCAACTGAAAAG-3′ ((SEQ ID NO:11); Reverse: TTCCTTTCCGCCTTAATTGTTTCT (SEQ ID NO:12), with 35 PCR cycles, 64° C. anneal temperature, 2 min. extension time.

[0218] All the brown strains commercially available in the prior art (Heirloom, Tuscan, S-600, Bs526, Fr24 and Brawn) have been compared to show that the strains of the invention are different. The brown prior art mushroom strain J15051 (NRRL accession number 67316) disclosed in WO2018102290 was also included.

TABLE-US-00003 TABLE IV allelic SCAR markers of various strains H97 vers Scaffold ID Ref Pos 2.0 N-s34 LA3782 Heirloom Tuscan S-600 Bs526 Fr 24 Brawn J15051 p1n150-G3-2 868615 1T 2 2/5 1T/5 2/5 1T/2 1T/3 2/3 1T/5 2/5 (scaffold_1) ITS 1612110 I1 I1 I1/I5 I1/I1 I1/I2 I2/? I1/I3 I3/I4 I1/I1 I1/I5 (scaffold_10) MFPC-ELF 829770 E1 E1 E1/E3 E3/E4 E3/E4 E1/E6 E3/E6 E2/E7? E3/E4 E3/E6 (scaffold_8) AN 1701712 N1 N2 N2/N3 N2/N3 N3/N4 N3/N4 N4/N4 N6/N6? N2/N3 N3/N4 (scaffold_9) AS 752867 SD SD SA/SD SA/SD SC/SD SC/SD SC/SD SC/SD SB/SD SA/SD (scaffold_4) FF 281674 FF1 FF1 FF1/FF3 FF1/FF3 FF1/FF3 FF2/FF2 FF1/FF2 FF2/FF2 FF1/FF3 FF2/FF2 (scaffold_12)

[0219] Table IV below summarizes the allelic markers at these 6 loci for the cultures of the invention and for a number of other prior art strains.

[0220] Whole-genome sequences were aligned by contigs with reference to the H97 V2.0 reference sequence, using the Seqman NGen module of the Lasergene software package (DNAStar, Inc.). By inspecting the aligned sequences of two or more cultures, SNPs at individual loci have been determined and compared directly.

[0221] Tables V and VI below show the genotypes of the relevant strains at the 203 SNP marker loci used in Tables I and II, and also the overall genetic similarity calculation between each strain and LA3782.

TABLE-US-00004 TABLE V Genotypes of LA3782 and six other commercial brown-capped strains (“poor depth” meaning that they were too few sequence reads to detect the allelic sequence) and of J15051 disclosed in WO2018102290. Heirloom/ Tuscan/ Scaffold Ref Pos LA3782 BR06 B14528 S-600 Bs526 Fr 24 Brawn J15051 scaffold_1 99995 CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA CTACcustom-character TTGA scaffold_1 101993 GAAGcustom-character ACAT GAAGcustom-character ACAT GAAGcustom-character ACAT GAAGGACAT GAAGGACAT GAAGGACAT GAAGcustom-character ACAT GAAGcustom-character ACAT scaffold_1 349966 AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT AAGGcustom-character GGTT scaffold_1 660050 TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA TCACcustom-character ATGA scaffold_1 849951 GATGcustom-character AGGA GATGGAGGA GATGcustom-character AGGA GATGcustom-character AGGA GATcustom-character AGGA GATGcustom-character AGGA GATGGAGGA GATGcustom-character AGGA scaffold_1 850014 ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT ATTCcustom-character TTTT scaffold_1 867820 GTCACTATT GTCACTATT GTCACTATT GTCACTATT GTCAcustom-character TATT GTCAcustom-character TATT GTCACTATT GTCACTATT scaffold_1 867860 ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC ATTCcustom-character AAAC scaffold_1 867868 CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA CCTTTCCCA scaffold_1 867923 ATCCcustom-character GATG ATCCcustom-character GATG ATCCcustom-character GATG ATCCAGATG ATCCAGATG ATCCAGATG ATCCcustom-character GATG ATCCcustom-character GATG scaffold_1 867914 AAAGGATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG AAAGcustom-character ATCG scaffold_1 867967 TCcustom-character ACTGGcustom-character TCcustom-character ACTGGcustom-character TCcustom-character ACTGGcustom-character TCcustom-character ACTGGT TCAACTGGT TCcustom-character ACTGGT TCcustom-character ACTGGcustom-character TCcustom-character ACTGGcustom-character scaffold_1 868085 ggatt--ct ggatt--ct --------- ggatt--ct ggatt--ct ggatt--ct ggatt--ct poor depth scaffold_1 1099971 GTCGcustom-character CACC GTCGACACC GTCGcustom-character CACC GTCGcustom-character CACC GTCGACACC GTCGcustom-character CACC GTCGACACC GTCGcustom-character CACC scaffold_1 1353901 AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA AGATcustom-character ACTA scaffold_1 1599956 AATAcustom-character GCGC AATAAGCGC AATAcustom-character GCGC AATAcustom-character GCGC AATAAGCGC AATAAGCGC AATAAGCGC AATAcustom-character GCGC scaffold_1 1850032 CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT CGAGcustom-character AATT scaffold_1 2119049 ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA ACAAcustom-character CAA scaffold_1 2401751 CGGAcustom-character AAAT CGGAcustom-character AAAT CGGAcustom-character AAAT CGGATAAAT CGGAcustom-character AAAT CGGAcustom-character AAAT CGGAcustom-character AAAT CGGAcustom-character AAAT scaffold_1 2635654 TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG TGCGcustom-character TTTG scaffold_1 2804522 GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC GAAGcustom-character GAC scaffold_1 2858975 GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT GCCGcustom-character TCTT scaffold_1 3256057 TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT TATCcustom-character GTTT scaffold_2 101820 ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT ATTAAAGAT scaffold_2 128192 Tcustom-character GAcustom-character AGG TGGAcustom-character AGG Tcustom-character GAcustom-character AGG Tcustom-character GAcustom-character CAGG TGGAcustom-character CAGG TGGACCAGG TGGAcustom-character AGG Tcustom-character GAcustom-character AGG scaffold_2 279652 AAGGCATGT AAGGcustom-character ATGT AAGGCATGT AAGGcustom-character ATGT AAcustom-character Gcustom-character ATGT AAGGcustom-character ATGT AAGGcustom-character ATGT AAGGCATGT scaffold_2 350156 TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG TCGGcustom-character GGTG scaffold_2 450323 CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG CTACCCTTG scaffold_2 600112 ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG ATGTcustom-character TACG scaffold_2 850338 TGGTcustom-character CTAA TGGTGCTAA TGGTcustom-character CTAA TGGTGCTAA TGGTGCTAA TGGTGCTAA TGGTcustom-character CTAA TGGTcustom-character CTAA scaffold_2 1099413 CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA CCTGcustom-character CTCA scaffold_2 1189976 ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA ACGGcustom-character CCAA scaffold_2 1293936 GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT GTGTcustom-character TGTT scaffold_2 1349512 CTCAcustom-character CAGT CTCAcustom-character Ccustom-character GT CTCAcustom-character CAGT CTCAcustom-character Ccustom-character GT CTCAcustom-character Ccustom-character GT CTCAcustom-character Ccustom-character GT CTCAcustom-character Ccustom-character GT CTCAcustom-character CAGT scaffold_2 1378074 TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA TCCAcustom-character TTCA scaffold_2 1378104 TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT TTcustom-character Ccustom-character AGAT scaffold_2 1600085 CACAcustom-character TGCC CACAATGCC CACAcustom-character TGCC CACAATGCC CACAATGCC CACAATGCC CACAcustom-character TGCC CACAcustom-character TGCC scaffold_2 1643101 CATCcustom-character TCTT CATCTTCTT CATCcustom-character TCTT CATCcustom-character TCTT CATCcustom-character TCTT CATCcustom-character TCTT CATCcustom-character TCTT CATCcustom-character TCTT scaffold_2 1901773 ACTcustom-character AATT ACTCGAATT ACTcustom-character AATT ACTCcustom-character AATT poor depth ACTCGAATT ACTcustom-character AATT ACTcustom-character AATT scaffold_2 2150162 TGCTcustom-character AGGG TGCTTAGGG TGCTcustom-character AGGG TGCTTAGGG TGCTTAGGG TGCTTAGGG TGCTcustom-character AGGG TGCTcustom-character AGGG scaffold_2 2389428 GGATcustom-character TCAA GGATkTCAA GGATcustom-character TCAA GGATcustom-character TCAA GGATcustom-character TCAA GGATcustom-character TCAA GGATcustom-character TCAA GGATcustom-character TCAA scaffold_2 2400281 custom-character CAAcustom-character ACcustom-character C TCAAcustom-character ACCC custom-character CAAcustom-character ACcustom-character C TCAAcustom-character ACcustom-character C TCAAcustom-character ACCC TCAAcustom-character ACCC custom-character CAAcustom-character ACCC custom-character CAAcustom-character ACcustom-character C scaffold_2 2650136 ATAAcustom-character TCCT ATAATTCCT ATAAcustom-character TCCT ATAATTCCT ATAATTCCT ATAATTCCT ATAAcustom-character TCCT ATAAcustom-character TCCT scaffold_2 2904101 TGTTcustom-character AGGT TGTTGAGGT TGTTcustom-character AGGT TGTTGAGGT TGTTcustom-character AGGT TGTTGAGGT TGTTcustom-character AGGT TGTTcustom-character AGGT scaffold_2 3049515 GAAAcustom-character GCTT GAAAcustom-character GCTT GAAAcustom-character GCTT GAAAcustom-character GCTT GAAAcustom-character GCTT GAAAAGCTT GAAAcustom-character GCTT GAAAcustom-character GCTT scaffold_3 57118 TATcustom-character CAGC TATcustom-character CAGC TATAGCAGC TATcustom-character CAGC TATAGCAGC TATcustom-character CAGC TATcustom-character CAGC TATcustom-character CAGC scaffold_3 118150 GTTTcustom-character TCCT poor depth GTTTGTCCT GTTTGTCCT GTTTGTCCT GTTTGTCCT poor depth GTTTGTCCT scaffold_3 131389 AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG AGACCGGCG scaffold_3 175472 CTTTcustom-character TTTC CTTTcustom-character TTTC CTTTcustom-character TTTC CTTTATTTC CTTTATTTC CTTTcustom-character TTTC CTTTcustom-character TTTC CTTTATTTC scaffold_3 250112 GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG GCcustom-character Gcustom-character AGAG scaffold_3 379203 ATAGcustom-character GGAA ATAGcustom-character GGA ATAGcustom-character GGAA poor depth ATAGcustom-character GGAA ATAGcustom-character GGAA ATAGcustom-character GGAA ATAGcustom-character GGAA scaffold_3 614937 CAAAcustom-character TCGT CAAAcustom-character TCTG CAAAcustom-character TCcustom-character G CAAAATCTG CAAAATCTG CAAAATCTG CAAAcustom-character TCTG CAAAATCTG scaffold_3 750074 GTTCcustom-character TTTC GTTCcustom-character TTTC GTTCcustom-character TTTC GTTCcustom-character TTTC GTTCcustom-character TTTC GTTCTTTTC GTTCcustom-character TTTC GTTCcustom-character TTTC scaffold_3 1126997 TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG TCAAcustom-character GGCG scaffold_3 1250161 AGTCcustom-character CCTT AGTCcustom-character CCTT AGTCTCCTT AGTCcustom-character CCTT AGTCcustom-character CCTT AGTCcustom-character CCTT AGTCcustom-character CCTT AGTCcustom-character CCTT scaffold_3 1296141 ATCGcustom-character TCAT ATCGcustom-character TCAT ATCGcustom-character TCAT ATCGGTCAT ATCGGTCAT ATCGGTCAT ATCGcustom-character TCAT ATCGGTCAT scaffold_3 1510819 CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT CCACcustom-character GATT scaffold_3 1774892 CCGTcustom-character TGGG CCGTcustom-character TGGG CCGTcustom-character TGGG CCGTATGGG CCGTcustom-character TGGG CCGTcustom-character TGGG CCGTcustom-character TGGG CCGTcustom-character TGGG scaffold_3 2008438 AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC AGCAcustom-character AGCC scaffold_3 2250000 CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT CGTGGCGAT scaffold_3 2274053 AAACcustom-character AAGA AAACcustom-character AAGA AAACcustom-character AAGA AAACcustom-character AAGA AAACcustom-character AAGA AAACCAAGA AAACcustom-character AAGA AAACcustom-character AAGA scaffold_3 2384173 TGACcustom-character AAGC TGACcustom-character AAGC TGACcustom-character AAGC TGACcustom-character AAGC TGACcustom-character AAGC TGACCAAGC TGACcustom-character AAGC TGACCAAGC scaffold_3 2520748 TAATcustom-character CCAC TAATcustom-character CCAC TAATTCCAC TAATcustom-character CCAC TAATcustom-character CCAC TAATTCCAC TAATcustom-character CCAC TAATcustom-character CCAC scaffold_3 2523207 CAGTcustom-character ATA CAGTcustom-character ATA CAGTCCATA CAGTCCATA CAGTCCATA CAGTCCATA CAGTcustom-character ATA CAGTcustom-character ATA scaffold_4 100004 GAGTGATAA GAGTGATAA GAGTGATAA GAGTcustom-character ATcustom-character A GAGTcustom-character ATcustom-character A GAGTcustom-character ATcustom-character A GAGTGATAA GAGTGATAA scaffold_4 460303 TCCTcustom-character TAAC TCCTcustom-character TAAC TCCTcustom-character TAAC TCCTcustom-character TAAC TCCTcustom-character TAAC TCCcustom-character TAAC TCCTcustom-character TAAC TCCTcustom-character TAAC scaffold_4 490648 CGATcustom-character GCGT CGATcustom-character GCGT CGATCGCGT CGATCGCGT CGATCGCGT CGATCGCGT CGATCGCGT CGATcustom-character GCGT scaffold_4 649317 GAGGcustom-character AATcustom-character GAGGcustom-character AATcustom-character GAGGcustom-character AATcustom-character GAGGcustom-character AATcustom-character GAGGcustom-character AATcustom-character GAGGcustom-character AATcustom-character GAGGCAATG GAGGcustom-character AATcustom-character scaffold_4 752893 AAGTCCCAA AAGTCCCAA AAGTcustom-character CCAA AAGTcustom-character CCAA AAGTcustom-character CCAA AAGTcustom-character CCAA AAGTCCCAA AAGTCCCAA scaffold_4 753018 TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC TGGGcustom-character AAGC scaffold_4 753116 ------ ------ gatatc gatatc gatatc GATATC ------ ---- scaffold_4 753134 AACAcustom-character AACT AACAcustom-character AACT AACAcustom-character AACT AACAcustom-character AACT AACAcustom-character AACT AACAcustom-character AACT AACATAACT AACAcustom-character AACT scaffold_4 753165 TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG TTCC--GAG scaffold_4 753221 CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC CTGTcustom-character GGAC scaffold_4 878926 Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT Ccustom-character GAcustom-character CAAT scaffold_4 1100085 GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA GATGcustom-character CGAA scaffold_4 1163185 CAAGcustom-character TACT CAAGcustom-character TACT CAAcustom-character TACT CAAcustom-character TACT CAAcustom-character TACT CAAcustom-character TACT CAAcustom-character TACT CAAGcustom-character TACT scaffold_4 1350536 CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG CGAAcustom-character CGG scaffold_4 1599885 GATACTTGC GATACTTGC GATAcustom-character TTGC GATAcustom-character TTGC GATAcustom-character TTGC GATAcustom-character TTGC GATACTTGC GATACTTGC scaffold_4 1850288 ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA ATTCcustom-character GTA scaffold_4 1889549 ACAAcustom-character AGAA ACAAcustom-character AGAA ACAAcustom-character AGAA ACAACAGAA ACAAcustom-character AGAA ACAAcustom-character AGAA ACAAcustom-character AGAA ACAAcustom-character AGAA scaffold_4 2100356 TCAGcustom-character GACC TCAGcustom-character GACC TCAGAGACC poor depth TCAGAGACC TCAGcustom-character GACC TCAGcustom-character GACC TCAGcustom-character GACC scaffold_4 2284257 TCTGcustom-character ACTG TCTGcustom-character ACTG TCTGGACTG TCTGcustom-character ACTG TCTGGACTG TCTGcustom-character ACTG TCTGcustom-character ACTG TCTGcustom-character ACTG scaffold_5 87962 GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG GATTcustom-character AGGG scaffold_5 100211 TCCTcustom-character GAAT TCCTcustom-character GAAT TCCTcustom-character GAAT poor depth TCCTcustom-character GAAT TCCTcustom-character GAAT TCCTcustom-character GAAT TCCTcustom-character GAAT scaffold_5 350872 GGCGcustom-character GCCC GGCGcustom-character GCCC GGCGTGCCC GGCGcustom-character GCCC GGCGTGCCC GGCGTGCCC GGCGcustom-character GCCC GGCGcustom-character GCCC scaffold_5 599922 CGTCcustom-character TTCA CGTCcustom-character TTCA CGTCATTCA CGTCcustom-character TTCA CGTCATTCA CGTCATTCA CGTCcustom-character TTCA CGTCcustom-character TTCA scaffold_5 851262 TAATcustom-character TCT TAATcustom-character TCT TAATcustom-character TCT TAATcustom-character TCT TAATcustom-character TCT TAAcustom-character TCT TAATcustom-character TCT TAATcustom-character TCT scaffold_5 1099776 ACATcustom-character GACA ACATcustom-character GACA ACATcustom-character GACA poor depth ACATcustom-character GACA ACATcustom-character GACA ACATcustom-character GACA ACATcustom-character GACA scaffold_5 1352539 TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC TTGTcustom-character TCC scaffold_5 1599904 AACTcustom-character CCTT AACTcustom-character CCTT AACTcustom-character CCTT poor depth AACTcustom-character CCTT AACTcustom-character CCTT AACTcustom-character CCTT AACTcustom-character CCTT scaffold_5 1851487 TTCCcustom-character CTCC TTCCGCTCC TTCCGCTCC poor depth TTCCGCTCC TTCCcustom-character CTCC TTCCcustom-character CTCC TTCCcustom-character CTCC scaffold_5 2100025 CCCTcustom-character AGTC CCCTcustom-character AGTC CCCTcustom-character AGTC poor depth CCCTcustom-character AGTC CCCTcustom-character AGTC CCCTcustom-character AGTC CCCTcustom-character AGTC scaffold_5 2278878 GGTCcustom-character AAAA GGTCcustom-character AAAA GGTCGAAAA GGTCcustom-character AAAA GGTCGAAAA GGTCGAAAA GGTCcustom-character AAAA GGTCcustom-character AAAA scaffold_6 106480 GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG GCCCcustom-character CTTG scaffold_6 350337 CATTcustom-character GGTT CATTcustom-character GGTT CATTcustom-character GGTT CATTcustom-character GGTT CATTcustom-character GGTT CATTTGGTT CATTcustom-character GGTT CATTcustom-character GGTT scaffold_6 600047 GGAGcustom-character ATTT GGAGcustom-character ATTT GGAGcustom-character ATTT GGAGcustom-character ATTT GGAGcustom-character ATTT GGAGCATTT GGAGCATTT GGAGcustom-character ATTT scaffold_6 849990 AGTTcustom-character AGGA AGTTcustom-character AGGA AGTTcustom-character AGGA AGTTcustom-character AGGA AGTTcustom-character AGGA AGTTCAGGA AGTTCAGGA AGTTcustom-character AGGA scaffold_6 1098535 CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG CAAAcustom-character ATTG scaffold_6 1349453 TGTCcustom-character TAG TGTCcustom-character TAG TGTCcustom-character TAG TGTCcustom-character TAG TGTCcustom-character TAG TGTCGGTAG TGTCGGTAG TGTCcustom-character TAG scaffold_6 1600000 AAACCTGGA AAACCTGGA AAACCTGGA AAACCTGGA AAACCTGGA AAACCTGGA AAAcustom-character TGGA AAACCTGGA scaffold_6 1764645 AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT AACCcustom-character GATT scaffold_6 2000087 GATTTTGCG GATTcustom-character TGCG GATTcustom-character TGCG poor depth poor depth GATTcustom-character TGCG GATTcustom-character TGCG GATTTTGCG scaffold_6 2007502 AATTcustom-character ATAA AATTcustom-character ATAA AATTGATAA poor depth poor depth AATTcustom-character ATAA AATTcustom-character ATAA AATTcustom-character ATAA scaffold_7 100284 GAAAcustom-character TCAG GAAAcustom-character TCAG GAAAcustom-character TCAG poor depth GAAATTCAG GAAAcustom-character TCAG GAAAcustom-character TCAG GAAAcustom-character TCAG scaffold_7 348994 CCGcustom-character GTTT CCGGcustom-character GTTT CCGGcustom-character GTTT CCGGcustom-character GTTT CCGGcustom-character GTTT CCGGAGTTT CCGGcustom-character GTTT CCGGcustom-character GTTT scaffold_7 600111 CAATcustom-character ATTA CAATTATTA CAATcustom-character ATTA CAATcustom-character ATTA CAATcustom-character ATTA CAATcustom-character ATTA CAATcustom-character ATTA CAATcustom-character ATTA scaffold_7 850516 TGACcustom-character CATA TGACGCATA TGACcustom-character CATA TGACcustom-character CATA TGACcustom-character CATA TGACcustom-character CATA TGACcustom-character CATA TGACcustom-character CATA scaffold_7 873221 AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT AATAcustom-character ACCT scaffold_7 1100248 TCACcustom-character GAAG TCcustom-character Ccustom-character GAAG TCACcustom-character GAAG TCACGGAAG TCACcustom-character GAAG TCACcustom-character GAAG TCACcustom-character GAAG TCACcustom-character GAAG scaffold_7 1352529 TAAATATAT TAAAcustom-character ATcustom-character T TAAATATAT custom-character AAAcustom-character ATAT custom-character AAAcustom-character ATAT TAAAcustom-character ATcustom-character T TAAATATAT TAAATATAT scaffold_7 1605059 GACAcustom-character GCAA GACAcustom-character GCAA GACAkcustom-character GCAA GACAcustom-character GCAA GACAcustom-character CAA GACAAGCAA GACAcustom-character GCAA GACAcustom-character GCAA scaffold_7 1991524 CAACcustom-character CACC CAACcustom-character CACC CAACCCACC CAACcustom-character CACC CAACCCACC CAACcustom-character ACC CAACcustom-character CACC CAACcustom-character CACC scaffold_8 350000 ATTGcustom-character CGCG ATTGcustom-character CGCG ATTGcustom-character CGCG poor depth ATTGcustom-character CGCG ATTGcustom-character CGCG ATTGcustom-character CGCG ATTGcustom-character CGCG scaffold_8 606991 GTGTcustom-character TTCT GTGTcustom-character TTCT GTGTcustom-character TTCT GTGTcustom-character TTCT GTGTcustom-character TTCT GTGTATTCT GTGTcustom-character TTCT GTGTcustom-character TTCT scaffold_8 610549 GGAAcustom-character TTGA GGAAcustom-character GA GGAAcustom-character GA GGAAcustom-character TTGA GGAAcustom-character TGA GGAAcustom-character TTGA GGAAcustom-character GA GGAAcustom-character GA scaffold_8 829832 CTGTcustom-character CAAC CTGTcustom-character CAAC CTGTcustom-character CAAC CTGTACAAC CTGTACAAC CTGTACAAC CTGTcustom-character CAAC CTGTcustom-character CAAC scaffold_8 829846 TTCGAGTGA TTCGAGTGA TTCGAGTGA TTCGAGTGA TTCGAGTGA TTCGcustom-character GTGA TTCGAGTGA TTCGAGTGA scaffold_8 830003 AACTGGCAG AACTcustom-character GCAG AACTcustom-character GCAG AACTcustom-character GCAG AACTcustom-character GCAG AACTGGCAG AACTcustom-character GCAG AACTcustom-character GCAG scaffold_8 830070 ATTAGGATT ATTAGGATT ATTAGGATT ATTAGGATT ATTAcustom-character GATT ATTAGGATT ATTAGGATT ATTAGGATT scaffold_8 830078 TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG TACTcustom-character GACG scaffold_8 830105 ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT ATTTAGCAT scaffold_8 830159 AATTAGAAG AATTAGAAG AATTAGAAG AATTAGAAG AATTAGAAG AATTcustom-character GAAG AATTAGAAG AATTAGAAG scaffold_8 830169 GACGACTGG GACGACTGG GACGACTGG GACGACTGG GACGACTGG GACGcustom-character Ccustom-character GG GACGACTGG GACGACTGG scaffold_8 830215 AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT AGTGcustom-character ATCT scaffold_8 830250 TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA TCCAcustom-character TGCA scaffold_8 1100000 CATACGATC CATACGATC CATACGATC CATACGATO CATACGATC CATACGATC CATACGATC CATACGATC scaffold_8 1350240 ACGGcustom-character TACT ACGGcustom-character TACT ACGGcustom-character TACT ACGGGTACT ACGGGTACT ACGGGTACT ACGGcustom-character TACT ACGGcustom-character TACT scaffold_8 1354068 AGAAcustom-character GCCT AGAAcustom-character Gcustom-character T AGAAcustom-character Gcustom-character T AGAAcustom-character Gcustom-character T AGAAcustom-character Gcustom-character T AGAAcustom-character GCCT AGAAcustom-character Gcustom-character T AGAAcustom-character Gcustom-character T scaffold_8 1614036 TTATcustom-character AGTA TTATcustom-character AGTA TTATcustom-character AGTA TTATCAGTA TTATcustom-character AGTA TTATcustom-character AGTA TTATcustom-character AGTA TTATcustom-character AGTA scaffold_8 1869238 TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG TGGAcustom-character GTTG scaffold_9 100447 CTATcustom-character TTCT CTATcustom-character TTCT CTATcustom-character TTCT CTATcustom-character TTCT CTATcustom-character TTCT CTATTTTCT CTATcustom-character TTCT CTATcustom-character TTCT scaffold_9 350569 AGAAcustom-character ATAC AGAATATAC AGAAcustom-character ATAC AGAAcustom-character ATAC AGAAcustom-character ATAC AGAATATAC AGAATATAC AGAAcustom-character ATAC scaffold_9 599950 Tcustom-character GTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC TGGTcustom-character TCCC scaffold_9 611788 Tcustom-character TGcustom-character ATC Tcustom-character TGTAATC Tcustom-character TGcustom-character ATC Tcustom-character TGTAATC Tcustom-character TGTAATC Tcustom-character TGTAATC Tcustom-character TGTAATC Tcustom-character TGTAATC scaffold_9 721973 TGTAcustom-character ACGT TGTAcustom-character ACcustom-character T TGTAcustom-character ACGT TGTAcustom-character ACGT TGTAcustom-character ACGT TGTAcustom-character ACGT TGTAcustom-character ACcustom-character T TGTAcustom-character ACcustom-character T scaffold_9 1010845 Gcustom-character GTGGTGA GGGTGGTGA Gcustom-character GTcustom-character GTGA GGGTcustom-character GTGA GGGTcustom-character GTGA GGGTGGTGA GGGTGGTGA GGGTcustom-character GTGA scaffold_9 1250830 TTGTcustom-character GGGA TTGTGGGGA TTGTcustom-character GGGA TTGTcustom-character GGGA TTGTcustom-character GGGA TTGTcustom-character GGGA TTGTGGGGA TTGTcustom-character GGGA scaffold_9 1499265 AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA AGTCcustom-character GACA scaffold_9 1499300 TATGcustom-character Ccustom-character CC TATGACcustom-character CC TATGACcustom-character CC TATGACcustom-character CC TATGACcustom-character CC TATGACcustom-character CC TATGACcustom-character CC TATGACcustom-character CC scaffold_9 1676755 CTGCcustom-character GTTT CTGCcustom-character GTTT CTGCcustom-character GTTT CTGCcustom-character GTTT CTGCCGTTT CTGCcustom-character GTTT CTGCcustom-character GTTT CTGCcustom-character GTTT scaffold_9 1702348 AGACcustom-character CATC AGAcustom-character CATC AGACcustom-character CATC AGAcustom-character CATC AGACcustom-character CATC AGACcustom-character CATC AGAcustom-character CATC AGACcustom-character CATC scaffold_9 1702552 CAAAGTCAT CAAAGTCAT CAAAGTCAT CAAAGTCAT CAAAGTCAT CAAAGTCcustom-character T CAAAGTCAT CAAAGTCAT scaffold_9 1702583 ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG ACTCAGCTG scaffold_9 1702658 TTGTcustom-character TGG TTGTcustom-character TGG TTGTcustom-character TGG TTGTCcustom-character TGG TTGTCcustom-character TGG TTGTcustom-character GTGG TTGTcustom-character TGG TTGTcustom-character TGG scaffold_10 100470 TCACcustom-character ATCG TCACcustom-character ATCG TCACCATCG TCACCATCG TCACCATCG TCACCATCG TCACCATCG TCACCATCG scaffold_10 350030 GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA GCGGcustom-character TCAA scaffold_10 354531 AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA AATCcustom-character ATCA scaffold_10 633622 TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG TGGGcustom-character AAAG scaffold_10 860249 CCGCcustom-character AATT CCGCcustom-character AATT CCGCAAATT CCGCcustom-character AATT CCGCcustom-character AATT CCGCcustom-character AATT TGGGcustom-character AAAG CCGCcustom-character AATT scaffold_10 863401 ATAAAATTT ATcustom-character AAcustom-character TTT ATAAAATTT ATAAAATTT ATAAcustom-character ATTT ATAAAATTT ATcustom-character AAcustom-character TTT ATAAcustom-character TTT scaffold_10 1107782 CAACCCCAC CAACCCCAC CAACCCCAC poor depth poor depth CAACcustom-character CCAC CAACCCCAC CAACmCCAC scaffold_10 1338596 GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT GTGCcustom-character TCAT scaffold_10 1477092 AGATcustom-character CAAA Acustom-character ATcustom-character CAAA AGATGCAAA Acustom-character ATGCAAA Acustom-character ATGcustom-character Acustom-character A AGATGcustom-character Acustom-character A Acustom-character ATcustom-character CAAA AGATsCAAA scaffold_10 1612161 TCTTCGGAG TCTTCGGAG TCTTcustom-character GGAG TCTTcustom-character GGAG TCTTCGGAG TCTTCGGAG TCTTCGGAG TCTTCGGAG scaffold_10 1612569 ATTATATTC ATTATATTC ATTATATTC ATTATATTC ATTATATTC ATTATATTC ATTATATTC ATTATATTC scaffold_10 1612630 TGGCTCCTT TGGCTCCTT TGGCTCCTT TGGCTCCTT TGGCcustom-character CCTT TGGCcustom-character CCTT TGGCTCCTT TGGCcustom-character CCTT scaffold_10 1612671 GGAATCGTC GGAATCGTC GGAATCGTC GGAATCGTC GGAAcustom-character CGTC GGAAcustom-character CGTC GGAATCGTC GGAAcustom-character CGTC scaffold_11 101855 CCAGcustom-character CTGT CCAGCCTGT CCAGCCTGT poor depth CCAGCCTGT CCAGCCTGT CCAGcustom-character CTGT CCAGcustom-character CTGT scaffold_11 173230 AGCGGGCGA AGCGcustom-character GCGA AGCGcustom-character GCGA AGCGcustom-character GCGA AGCGcustom-character GCGA AGCGcustom-character GCGA AGCGGGCGA AGCGGGCGA scaffold_11 350000 GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG GTCAGCAAG scaffold_11 378409 TGATcustom-character GGGG TGATTGGGG TGATcustom-character GGGG TGATcustom-character GGGG TGATcustom-character GGGG TGATcustom-character GGGG TGATTGGGG TGATcustom-character GGGG scaffold_11 600001 TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC TGGGcustom-character GCGC scaffold_11 627221 TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC TCTTcustom-character GCCC scaffold_11 929659 GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA GGAAcustom-character TCA scaffold_11 931877 GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC GACCcustom-character CACC scaffold_11 1155850 Tcustom-character TGcustom-character CACG Tcustom-character TGCCACG Tcustom-character Tcustom-character CCACG Tcustom-character Tcustom-character CCACG Tcustom-character Tcustom-character CCACG Tcustom-character Tcustom-character CCACG Tcustom-character TGcustom-character CACG TrTryCACG scaffold_11 1240230  ACAAcustom-character ATTC ACAAcustom-character ATTC ACAAGATTC ACAAcustom-character ATTC ACAAGATTC ACAAGATTC ACAAcustom-character ATTC ACAAcustom-character ATTC scaffold_11 1250447 GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA GAGGcustom-character TACA scaffold_12 109790 GTCTcustom-character CACC GTCTcustom-character CACC GTCTcustom-character CACC GTCTGCACC GTCTGCACC GTCTGCACC GTCTcustom-character CACC GTCTcustom-character CACC scaffold_12 272255 CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT CCGAcustom-character TGCT scaffold_12 281720 CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG CTTCcustom-character CG scaffold_12 281763 TCTGcustom-character AGCC TCTGcustom-character AGCC TCTGcustom-character AGCC TCTGCAGCC TCTGCAGCC TCTGCAGCC TCTGcustom-character AGCC TCTGCAGCC scaffold_12 554582 ACTCcustom-character GGTC ACTCcustom-character GGTC ACTCcustom-character GGTC ACTCcustom-character GGTC ACTCcustom-character GGTC ACTCCGGTC ACTCcustom-character GGTC ACTCAGGTC scaffold_12 770075 GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT GAACcustom-character TTCT scaffold_12 909536 CTATcustom-character GAGG CTATcustom-character GAGG CTATcustom-character GAGG CTATGGAGG CTATcustom-character AGG CTATcustom-character AGG CTATcustom-character GAGG CTATGGAGG scaffold_12 1000000 CGAGcustom-character AGGA CGAGcustom-character AGGA CGAGcustom-character AGGA poor depth CGAGcustom-character AGGA CGAGcustom-character AGGA CGAGcustom-character AGGA CGAGcustom-character AGGA scaffold_13 100697 ACGTCTTTA ACGTCTTTA ACGTCTTTA ACGTcustom-character TTTA ACGTCTTTA ACGTcustom-character TTTA ACGTCTTTA ACGTCTTTA scaffold_13 119283 ACGcustom-character ACTG ACGcustom-character ACTG ACGTTACTG poor depth ACGcustom-character ACTG ACGcustom-character ACTG ACGcustom-character ACTG ACGcustom-character ACTG scaffold_13 363867 ATCCcustom-character CTGC ATCCcustom-character CTGC ATCCACTGC ATCCcustom-character CTGC ATCCcustom-character CTGC ATCCcustom-character CTGC ATCCcustom-character CTGC ATCCcustom-character CTGC scaffold_13 370521 TTTGcustom-character GTCA TTTGcustom-character GTCA TTTGAGTCA TTTGAGTCA TTTGcustom-character GTCA TTTGAGTCA TTTGcustom-character GTCA TTTGTGTCA scaffold_13 604345 CTTCAGCAT CTTCAGCAT CTTCAGCAT CTTCcustom-character GCAT CTTCAGCAT CTTCAGCAT CTTCAGCAT CTTCAGCAT scaffold_13 866136 GTTGcustom-character TCAG GTTGcustom-character TCAG GTTGGTCAG poor depth GTTGcustom-character TCAG GTTGcustom-character TCAcustom-character GTTGcustom-character TCAG GTTGcustom-character TCAG scaffold_14 113109 AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA AGGGcustom-character AATA scaffold_14 372086 CGATcustom-character CCTT CGATcustom-character CCTT CGATcustom-character Ccustom-character TT CGATcustom-character Ccustom-character TT CGATcustom-character Ccustom-character TT CGATcustom-character Ccustom-character TT CGATcustom-character CCTT CGATcustom-character CCTT scaffold_14 603118 GGCCcustom-character GCCT GGCCcustom-character GCCT GGCCSGCCT GGCCCGCCT GGCCCGCCT GGCCCGCCT GGCCcustom-character GCCT GGCCcustom-character GCCT scaffold_14 725687 AGTTcustom-character Gcustom-character AA AGTTcustom-character Gcustom-character AA AGTTcustom-character Gcustom-character AA Acustom-character TTcustom-character GAAA Acustom-character TTcustom-character GAAA Acustom-character TTcustom-character Gcustom-character AA AGTTcustom-character Gcustom-character AA Acustom-character TTcustom-character GAAA scaffold_14 808308 AAGcustom-character ATGG AAGcustom-character ATGG AAGGTATGG poor depth AAGGcustom-character ATGG AAGGcustom-character ATGG AAGcustom-character ATGG AAGcustom-character ATGG scaffold_15 101381 TAAAcustom-character AGAT TAAAcustom-character AGAT TAAACAGAT poor depth TAAAcustom-character AGAT TAAACAGAT TAAAcustom-character AGAT TAAAcustom-character AGAT scaffold_15 150013 GTGGcustom-character CCGT GTGGcustom-character CCGT GTGGCCCGT GTGGCCCGT GTGGCCCGT GTGGCCCGT GTGGcustom-character CCGT GTGGcustom-character CCGT scaffold_15 367204 CGCGcustom-character CCTA CGCGcustom-character CCTA CGCGCCCTA CGCGcustom-character CCTA CGCGcustom-character CCTA CGCGcustom-character CCTA CGCGcustom-character CCTA CGCGcustom-character CCTA scaffold_16 106292 AAGCcustom-character GGAA AAGCcustom-character GGAA AAGCTGGAA AAGCcustom-character GGAA AAGCTGGAA AAGCcustom-character GGAA AAGCcustom-character GGAA AAGCcustom-character GGAA scaffold_16 205778 CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG CAAGcustom-character TCTG scaffold_16 400000 CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT CCTCGGATT scaffold_16 403998 CAAAcustom-character TACG CAAAGTACG CAAAcustom-character TACG poor depth CAAAcustom-character TACG CAAAcustom-character TACG CAAAcustom-character TACG CAAAcustom-character TACG scaffold_17 134688 CCCGcustom-character TTCA CCCGcustom-character TTCA CCCGcustom-character TTCA CCCGCTTCA CCCGCTTCA CCCGCTTCA CCCGcustom-character TTCA CCCGCTTCA scaffold_17 370858 GACAcustom-character AACG GACAyAACG GACAcustom-character AACG GACAcustom-character AACG GACACAACG GACACAACG GACAcustom-character AACG GACAcustom-character AACG scaffold_17 449833 ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A ATCAGACAA ATCAGACAA ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A ATCAcustom-character ACcustom-character A scaffold_17 472545 CCGTcustom-character Ccustom-character TG CCGTcustom-character Ccustom-character TG CCGTcustom-character Ccustom-character TG CCGTTCATG CCGTcustom-character Ccustom-character TG CCGcustom-character TCAcustom-character G CCGTcustom-character Ccustom-character TG CCGTcustom-character Ccustom-character TG scaffold_18 112940 GCGGcustom-character TGGG GCGGcustom-character TGGG GCGGGTGGG GCGGGTGGG GCGGGTGGG GCGGGTGGG GCGGGTGGG GCGGcustom-character TGGG scaffold_18 126322 CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG CCTCcustom-character TCCG scaffold_19 87323 CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA CCCAcustom-character GCAA scaffold_19 98782 AAAAcustom-character TGTT AAAAcustom-character TGTT AAAAcustom-character TGTT AAAAcustom-character Tcustom-character TT AAAAcustom-character Tcustom-character TT AAAATTGTT AAAAcustom-character TGTT AAAAcustom-character  TGTT

[0222] The use of these markers to determine calculated % genetic similarity (identity) between two heterokaryotic cultures or strains is presented in Table VI.

[0223] The 9-mers containing the reported SNPs in the tables have been treated as composites of two unitary alleles (in heterokaryon comparisons).

[0224] The composite 9-mer genotype has been compared at each locus and assigned a value if 1 for a perfect match, or a 0 for anything less than a perfect match. Then the values were totaled for all loci in each pairwise comparison between strains, and divided by the total number of loci compared, and the resulting decimal was converted to %.

TABLE-US-00005 TABLE VI Calculation of % similarity (identity) between strain LA3782 and seven other heterokaryotic strains Comparison Heirloom/ Tuscan/ w/LA3782 BR06 B14528 S-600 Bs526 Fr 24 Brawn J15051 Similarity 54% 57% 35% 26% 25% 59% 67% (N = 203) Similarity 51% 55% 30% 22% 23% 57% 70% (N = 170)

[0225] Results are similar for the full set of SNP markers (N=203) and for a smaller set (N=170) excluding the SNPs that define alleles at the six SCAR marker loci (and which have a shorter interval distribution). The highest % genetic similarity or identity observed for LA3782 compared to the heterokaryotic genotypes of seven other strains is 67%. Identity for two clones of LA3782 would be 100%.

[0226] B. Vegetative Incompatibility

[0227] Substantial genetic dissimilarity (i.e., 100%−% genetic identity) is known to be associated with heterokaryon or ‘vegetative’ incompatibility. Incompatibility interferes with anastomosis and with mushroom production. From the data in Table VI, it would be expected that LA3782 would be incompatible with the other leading commercial brown-capped Agaricus bisporus strains. Table VII demonstrates this empirically.

TABLE-US-00006 TABLE VII Vegetative incompatibility between LA3782, Tuscan and Heirloom: Numbers of harvested mushrooms after 16 days of cultivation. Strain in the compost LA3782 HRLM Tuscan Strain LA3782 a 5 0 0 In b 4 0 0 the c 2 0 0 casing Compatible Incompatible Incompatible p value <0.0001 0.001 Heirloom/ a 0 1 0 BR06 b 0 1 0 c 0 1 0 Incompatible Compatible Incompatible p value 0.014 0.001 Tuscan/ a 0 0 2 B14528 b 0 0 3 c 0 0 3 Incompatible Incompatible Compatible p value 0.014 <0.0001

[0228] General t-test analysis on three replicates (a-c); the difference between compatible and incompatible combinations is significant with p-value a ≤0.05 in all cases. In each treatment, one of the three strains was inoculated into compost, and after colonization, casing soil inoculated with one of the three strains was applied over the compost. Cultivation containers with 0.07 square meters of surface were used in standard growing conditions. Note that only combinations scored as compatible (marked with *) produced mushrooms.

[0229] C. Crop Yield

[0230] Yield performance was measured in large-scale trials. During these trials, incubation period was 18 days in bulk phase III tunnel, spawning rate was 8 litres/ton of compost phase II. Trays were filled with 135 kg incubated compost with a filling rate of 90 kg/m.sup.2. Mc substrate supplement was added at the rate of 1.33 kg/m.sup.2. Carbo 9 casing from supplier Euroveen was applied with 1200 g/m.sup.2 compost casing, premixed. In the growing room we tested strains with 12 replications distributed across 5 growing levels.

[0231] Airing started on day 4 after casing. To collect yield, mushrooms were picked and weighted daily on 12 replicates. Data were collected over 3 flushes.

[0232] The mushroom crop yield of strain LA3782 was found to be greater (better) than that of the BR06/Heirloom strain on third flush and also when aggregated over flushes 1, 2 and 3, as shown in Table VIII.

TABLE-US-00007 TABLE VIII Yield comparisons of LA3782 with Heirloom, Tuscan and J15051 strains 1st flush 2nd Flush 3rd flush Total LA3782 Yield 17.4 12.5 9.4 39.4 sd 1.06 1.06 1.23 1.98 Heirloom/ Yield 17.3 11.7 6 34.9 BR06 sd 0.72 1.78 0.9 2.4 p value 0.66 0.17 < 0.0001 < 0.0001 Tuscan/ Yield 16.5 12.9 9.3 38.6 B14528 sd 1.44 1.99 0.61 3.01 p value 0.08 0.60 0.83 0.53 J15051 Yield 15.0 12.1 6.2 33.3 sd 2.34 1.46 3.01 6.80 p value 0.51 0.003 0.835 0.141 Flush yield and cumulative crop yields of LA3782, Heirloom, Tuscan and J15051 after 1; 2 and 3 flushes, expressed in kg/m2. Standard cultivation and harvest procedures were used. General t-test analysis: the difference with LA3782 is significant at p-value ≤0.05.

[0233] From Table VIII, strain LA3782 is shown to be highly productive, and also to have an improved flush-yield balance due to the higher third-flush yield, as compared to all the prior art strains that have been tested.

[0234] D. Weight Retention

[0235] The mushrooms produced by strain LA3782 also have improved weight retention during post-harvest storage, compared to those of the Heirloom strain, as shown in Table IX.

[0236] Trait data collection was carried out by a method in which mushroom samples were collected on the day of peak harvest during a ‘flush’ of mushroom production. A flush lasts four or five days, often with peak production on the second day; typically, three flushes occur at weekly intervals. The expression of the trait in Flush 1 was evaluated. During this test, five replicate styrofoam tills per strain were evaluated. A till is a tray that can hold over 1 kg. The weight of the empty till was recorded. Thirty mushrooms approximately 4-5 cm in diameter, with tightly closed veils were placed into each till. They were spaced enough to not touch each other and placed with the stem up, they were immediately weighed. An initial weight was recorded. The tills were placed at 4° C. for 8 days in a walk-in cooler. Filled till weights were recorded each day beginning on day 3. After subtracting the weight of the empty till, percentage of weight retention was calculated as described above.

TABLE-US-00008 TABLE IX Percentage of initial weight retained after 3-8 days of post-harvest storage at 4° C. % of % of % of % of % of % of weight weight weight weight weight weight Strain at D3 at D4 at D5 at D6 at D7 at D8 LA3782 90.2% 87.6% 84.5% 81.4% 78.6% 75.4% LA3782 91.5% 89.2% 87.1% 84.7% 82.7% 79.8% LA3782 92.2% 90.0% 87.9% 85.5% 83.4% 80.4% LA3782 92.2% 90.0% 87.5% 85.6% 83.6% 80.4% LA3782 90.6% 88.2% 85.5% 83.2% 80.5% 77.3% Average 91.3% 89.0% 86.5% 84.1% 81.8% 78.7% HRLM 87.5% 83.5% 80.4% 76.8% 73.9% 70.2% HRLM 87.9% 84.3% 81.3% 78.1% 75.3% 71.9% HRLM 88.0% 84.3% 81.0% 77.8% 75.1% 71.7% HRLM 88.1% 84.5% 81.2% 78.0% 75.3% 72.1% HRLM 88.7% 85.2% 82.0% 79.1% 76.6% 73.5% Average 88.1% 84.3% 81.2% 78.0% 75.2% 71.9% p value <0.0001 <0.0001 <0.0001 0.0001 0.0002 0.0003 Tuscan 89.5% 86.5% 82.7% 79.9% 77.3% 74.3% Tuscan 88.8% 86.0% 82.9% 80.0% 77.4% 74.2% Tuscan 89.1% 86.5% 83.5% 80.5% 78.1% 74.6% Tuscan 90.0% 87.8% 85.3% 82.9% 80.6% 77.3% Tuscan 90.3% 88.1% 85.8% 83.7% 81.5% 78.6% Tuscan 90.3% 88.1% 85.8% 83.7% 81.5% 78.6% Average 89.7% 87.3% 84.7% 82.1% 79.8% 76.7% p value 0.007 0.012 0.026 0.043 0.061 0.07

[0237] E. Mushroom Piece Weight

[0238] Table X shows that the piece weight (mean individual harvested mushroom weight) in crops from LA3782 is significantly greater than that of the Heirloom or Tuscan strains, especially in first flush. A greater piece weight can reduce the costs of harvesting the crop.

[0239] Trait data collection was carried out by a method in which mushroom samples were collected during the first and second flush of mushroom production. The expression of the trait in Flush 1 and Flush 2 was evaluated. During this test, 20 replicate medium size mushrooms (4-5 cm in diameter) per strain over 4 different levels were evaluated. Each replicate was individually weighed.

TABLE-US-00009 TABLE X Weights of individual mushrooms harvested (i.e., piece weight) 1st Flush 2nd flush Piece p Piece p weight(g) sd value weight (g) sd value LA3782 35.87 7.91 / 34.8 9.54 / HRLM 29.33 8.27 0.009 33.0 8.27 0.56 Tuscan 29.25 3.17 0.002 29.5 4.07 0.04 Average piece weight of category medium size mushrooms in Flush 1 and flush 2 expressed in grams. General t-test analysis: the difference with LA3782 is significant with p-value < α = 0.05

[0240] The average piece weight of mushrooms in flush 1 and flush 2 expressed in grams. In a general t-test analysis, the differences with LA3782 were significant at a p a ≤0.05 threshold.

[0241] F. Cap Color

[0242] The mushroom color was measured using a Minolta Chroma Meter CR-200 (mfd. Japan). Sample sizes of thirty medium sized mushrooms at commercial maturity (with closed veils) were harvested from the tests and measured to obtain values for the L*a*b parameters. The Chroma Meter readings were randomly taken at the tops of the mushroom caps. In the L*a*b system, “L” is a brightness variable with 0 representing complete darkness and 100 representing complete whiteness and “b” value represents blueness (−300)/yellowness (+299). In other words, the darker a mushroom cap color, the lower the L value, and the more yellow a mushroom cap color, the higher b value.

TABLE-US-00010 TABLE XI Chromameter value L, a, b of LA3782, Heirloom and Tuscan strains L Value sd a value sd b value sd LA3782 71.49 2.9 7.12 1.02 23.28 1.28 Heirloom/BR06 63.33 2.89 9.18 0.62 23.86 1.1 Tuscan/B14528 65.71 3.34 8.57 0.87 25.1 0.93

[0243] Finally, it will be understood that any variations evident fall within the scope of the claimed invention and thus, the specific selection of characteristics, techniques, and sources of homokaryons and heterokaryons can be determined without departing from the spirit of the present invention herein disclosed and described. Further, it will be understood that the scope of the invention is not necessarily limited to methods that produce mushroom strains and cultures that have all of the characteristics set forth herein, but rather to those strains, lines, and cultures that are produced, descended or otherwise derived from cultures having at least one parent that is derived from line N-s34 or strain LA3782. Accordingly, the scope of the invention shall include all modifications and variations that may fall within the scope of the attached claims.