METHODS AND MATERIALS FOR TREATING BRAIN INJURIES
20210032300 ยท 2021-02-04
Inventors
- Gong Chen (State College, PA)
- Lei Zhang (University Park, PA)
- Ziyuan Guo (State College, PA)
- Zifei Pei (University Park, PA, US)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
C07K14/4705
CHEMISTRY; METALLURGY
A01K2267/0318
HUMAN NECESSITIES
C12N2740/13043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K9/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
This document provides methods and materials for treating brain injuries. For example, methods and materials for using nucleic acid encoding a NeuroD1 polypeptide to convert reactive astrocytes within a brain (e.g., cerebral cortex) into functional neurons (e.g., neurons that can be functionally integrated into the brain of a living mammal (e.g., a human)) are provided.
Claims
1. A method for repairing glial scar tissue in a cerebral cortex of a living mammal's brain, wherein said method comprises administering a nucleic acid sequence encoding a neuronal differentiation 1 (NeuroD1) polypeptide to astrocytes within said cerebral cortex, wherein said NeuroD1 polypeptide is expressed by said astrocytes, wherein said astrocytes form functional neurons within said cerebral cortex, and wherein said glial scar tissue is reversed back to neural tissue.
2. The method of claim 1, wherein said cerebral cortex, after administration of said nucleic acid sequence encoding a NeuroD1 polypeptide, has decreased expression of a factor selected from the group consisting of glial fibrillary acidic protein (Gfap), lipocalin-2 (Lcn2), chondroitin sulfate proteoglycan (CSPG), and combinations thereof.
3. The method of claim 1, wherein said cerebral cortex, after administration of said nucleic acid sequence encoding a NeuroD1 polypeptide, has increased expression of a factor selected from the group consisting of annexin A2 (Anax2), thrombospondin 1 (Thbs1), glypican 6 (Gpc6), brain-derived neurotrophic factor (Bdnf), and combinations thereof.
4-6. (canceled)
7. A method for reducing neuroinflammation in a cerebral cortex of a living mammal's brain, wherein said method comprises administering a nucleic acid sequence encoding a neuronal differentiation 1 (NeuroD1) polypeptide to astrocytes within said cerebral cortex, wherein said NeuroD1 polypeptide is expressed by said astrocytes, wherein said astrocytes form functional neurons within said cerebral cortex, wherein said neuroinflammation is reduced, and wherein said cerebral cortex has decreased expression of a factor selected from the group consisting of tumor necrosis factor alpha (TNFa), interleukin 1 beta (IL-1b), and cluster of designation 68 (CD68), and combinations thereof, after said administering.
8-10. (canceled)
11. A method for transforming an A1 astrocyte in a cerebral cortex of a living mammal's brain, wherein said method comprises administering a nucleic acid sequence encoding a neuronal differentiation 1 (NeuroD1) polypeptide to astrocytes within said cerebral cortex, wherein said NeuroD1 polypeptide is expressed by said astrocytes, wherein said astrocytes form functional neurons within said cerebral cortex, and wherein said A1 astrocyte is transformed into a less harmful astrocyte.
12. The method of claim 11, wherein said cerebral cortex, after said administering of said nucleic acid sequence encoding a NeuroD1 polypeptide, has decreased expression of a factor selected from the group consisting of guanylate Binding Protein 2 (Gbp2) serpin family G member 1 (Serping1), and combinations thereof.
13. A method for reducing the amount of toxic M1 microglia in a cerebral cortex of a living mammal's brain, wherein said method comprises administering a nucleic acid sequence encoding a neuronal differentiation 1 (NeuroD1) polypeptide to astrocytes within said cerebral cortex, wherein said NeuroD1 polypeptide is expressed by said astrocytes, wherein said astrocytes form functional neurons within said cerebral cortex, and wherein the amount of toxic M1 microglia is reduced.
14. The method of claim 13, wherein said toxic M1 microglia, after said administering of said nucleic acid sequence encoding a NeuroD1 polypeptide, have a morphology of resting microglia.
15. The method of claim 1, wherein said mammal is a human.
16. The method of claim 1, wherein said astrocytes are reactive astrocytes.
17-18. (canceled)
19. The method of claim 13, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is administered to said astrocytes in the form of a viral vector.
20. The method of claim 19, wherein said viral vector is an adeno-associated viral vector.
21-26. (canceled)
27. The method of claim 1, wherein said nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to a promoter sequence, wherein said promoter sequence is a constitutive promoter sequence.
28. (canceled)
29. The method of claim 1, wherein said administration comprises a direct injection into said cerebral cortex of said living mammal's brain.
30. The method of claim 1, wherein said administration comprises an intracranial, intrathecal, intraperitoneal, intravenous, intranasal, intramuscular, or oral administration.
31. A composition for forming functional neurons in a cerebral cortex of a living mammal's brain, wherein said composition comprises a) a nucleic acid vector comprising an inverted nucleic acid sequence encoding a neuronal differentiation 1 (NeuroD1) polypeptide flanked by recombinase target sites, and b) a nucleic acid vector comprising a nucleic acid sequence encoding a recombinase.
32. The composition of claim 31, wherein said nucleic acid vector comprising a nucleic acid sequence encoding a NeuroD1 polypeptide is a viral vector.
33. The composition of claim 32, wherein said viral vector is an adeno-associated viral vector.
34. (canceled)
35. The composition of claim 31, wherein said inverted nucleic acid sequence encoding said NeuroD1 polypeptide is operably linked to a promoter sequence, wherein said promoter sequence is a constitutive promoter sequence.
36-39. (canceled)
40. The composition of claim 31, wherein said nucleic acid sequence encoding said recombinase is operably linked to a promoter sequence, wherein said promoter sequence is an astrocyte-specific promoter sequence.
41. (canceled)
42. The composition of claim 31, wherein said recombinase is a Cre recombinase, and wherein said recombinase target sites are LoxP sites.
43-51. (canceled)
52. The method of claim 13, wherein said astrocytes are reactive astrocytes.
Description
DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
DETAILED DESCRIPTION
[0031] This document provides methods and materials for generating functional neurons within a brain. For example, this document provides methods and materials for using nucleic acid encoding a NeuroD1 polypeptide to trigger glial cells (e.g., reactive astrocytes) within a brain into forming functional neurons within the brain of the living mammal (e.g., a human). Forming functional neurons as described herein can include converting reactive astrocytes within a brain into functional neurons. The term functional neuron as used herein refers to a neuron that is functionally integrated into a brain of a living mammal (e.g., a human). For example, a functional neuron can be a glutamatergic neuron and/or a GABAergic neuron. In some cases, materials and methods provided herein can be used to treat brain injury. For example, NeuroD1-mediated AtN conversion can be used to treat brain injury (e.g., following a brain injury) by converting reactive astrocytes into functional neurons, rebalancing neuron:glia ratios, repairing damaged brain tissue (e.g., repairing glial scar tissue by, for example, reversing glial scar tissue back to neural tissue), reducing neuroinflammation, restoring the blood-brain-barrier, transforming A1 astrocytes (e.g., transforming toxic A1 astrocytes into less harmful astrocytes), and/or reducing the amount of toxic M1 microglia.
[0032] Any appropriate mammal can be treated as described herein. Examples of mammals that can be treated as described herein can include, without limitation, humans, monkeys, dogs, cats, cows, horses, pigs, rats, and mice. For example, mammals can be treated as described herein to generate functional neurons in the brain of a living mammal. In some cases, a human having a brain injury can be treated as described herein to generate functional neurons in the human's injured brain. A mammal can be identified as having a brain injury using any appropriate diagnostic technique. For example, neurological examinations, neuroimaging, neuropsychological assessments, electrocardiograms (EKGs), cognition tests, language tests, behavioral tests, blood tests, and/or urine tests can be performed to identify a mammal (e.g. a human) as having a brain injury.
[0033] Any type of brain injury can be treated as described herein. In some cases, a brain injury treated as described herein can be an acquired brain injury (ABI). In some cases, a brain injury treated as described herein can be a traumatic brain injury (TBI). Examples of brain injuries that can be treated as described herein include, without limitation, concussions, contusions, coup-contrecoup injuries, diffuse axonal injuries, penetrations, blasts, infections, genetic mutations, and comas. In some cases, a brain injury treated as described herein can include the presence of reactive astrocytes. In some cases, a brain injury treated as described herein can include tissue loss. Examples of causes of brain injuries include, without limitation, trauma, stroke, tumor, infection, substance abuse, hypoxia, anoxia, aneurysm, neurological illness, toxins, embolisms, hematomas, brain hemorrhaging, genetic diseases, and comas.
[0034] A brain injury treated as described herein can be in any appropriate location within the brain. For example, a brain injury treated as described herein can be in the cerebral cortex (e.g., the motor cortex, sensory cortex, and association cortex), striatum, hippocampus, thalamus, hypothalamus, amygdla, cerebellum, or brain stem. In some cases, a brain injury treated as described herein can be in the motor cortex of a mammal (e.g., a human).
[0035] As described herein, a mammal (e.g., a mammal having a brain injury) can be treated by administering nucleic acid designed to express a NeuroD1 polypeptide (e.g., a composition containing nucleic acid designed to express a NeuroD1 polypeptide) to reactive astrocytes within the mammal's brain (e.g., cerebral cortex) in a manner that triggers the reactive astrocytes to form functional neurons. Examples of NeuroD1 polypeptides include, without limitation, those polypeptides having the amino acid sequence set forth in GenBank accession number NP 002491. In some cases, a NeuroD1 polypeptide can be as set forth in SEQ ID NO:1 (see, e.g.,
[0036] Any appropriate method can be used to deliver nucleic acid designed to express a NeuroD1 polypeptide to glial cells (e.g., reactive astrocytes) within the brain of a living mammal. For example, nucleic acid encoding a NeuroD1 polypeptide can be administered to a mammal using one or more vectors such as viral vectors. Vectors for administering nucleic acids (e.g., nucleic acid encoding a NeuroD1 polypeptide) to reactive astrocytes can be prepared using appropriate materials (e.g., packaging cell lines, helper viruses, and vector constructs). See, for example, Gene Therapy Protocols (Methods in Molecular Medicine), edited by Jeffrey R. Morgan, Humana Press, Totowa, N.J. (2002) and Viral Vectors for Gene Therapy: Methods and Protocols, edited by Curtis A. Machida, Humana Press, Totowa, N.J. (2003). In some cases, virus-based vectors can be used to express nucleic acid in dividing cells. In some cases, virus-based vectors can be used to express nucleic acid in non-dividing cells. In some cases, virus-based vectors can be used to express nucleic acid in both dividing cells and non-dividing cells. Virus-based nucleic acid delivery vectors for delivering nucleic acid designed to express a NeuroD1 polypeptide to reactive astrocytes within the brain of a living mammal can be derived from animal viruses, such as adenoviruses, adeno-associated viruses, retroviruses, lentiviruses, vaccinia viruses, herpes viruses, and papilloma viruses. In some cases, nucleic acid encoding a NeuroD1 polypeptide can be delivered to reactive astrocytes using adeno-associated virus vectors (e.g., an adeno-associated virus serotype 2 viral vector, an adeno-associated virus serotype 5 viral vector, or an adeno-associated virus serotype 9 viral vector), lentiviral vectors, retroviral vectors, adenoviral vectors, herpes simplex virus vectors, or poxvirus vector. For example, nucleic acid encoding a NeuroD1 polypeptide can be administered to a mammal using adeno-associated virus vectors to express NeuroD1 polypeptide in both dividing and non-dividing cells.
[0037] In addition to nucleic acid encoding a NeuroD1 polypeptide, a viral vector can contain one or more regulatory elements and/or one or more site-specific recombinase elements operably linked to the nucleic acid encoding a NeuroD1 polypeptide. As used herein, operably linked refers to positioning of a regulatory element in a vector relative to a nucleic acid in such a way as to permit or facilitate expression of the encoded polypeptide. Examples of regulatory elements can include, without limitation, promoter sequences, enhancer sequences, response elements, signal peptides, internal ribosome entry sequences, polyadenylation signals, terminators, or inducible elements that modulate expression (e.g., transcription or translation) of a nucleic acid. Examples of site-specific recombination elements can include, without limitation, recombinases (e.g., a Cre recombinase), recombination target sites (e.g., LoxP sites), or flip-excision (FLEx) switches that modulate site-specific recombination of a nucleic acid. The choice of element(s) that may be included in a viral vector depends on several factors, including, without limitation, inducibility, targeting, the level of expression desired, and the desired recombination site. For example, a promoter can be included in a viral vector to facilitate transcription of a nucleic acid encoding a NeuroD1 polypeptide. A promoter can be constitutive or inducible (e.g., in the presence of tetracycline), and can affect the expression of a nucleic acid encoding a polypeptide in a general or tissue-specific manner. Examples of cell-specific and/or tissue-specific promoters that can be used to drive expression of a NeuroD1 polypeptide in glial cells (e.g., reactive astrocytes) include, without limitation, NG2, GFAP, Olig2, CAG, EF1a, Aldh1L1, and CMV promoters. In some cases, a CAG promoter can be included in a viral vector to facilitate transcription of a nucleic acid encoding a NeuroD1 polypeptide. For example, loxP-type recombination sites can be included in a viral vector flanking a sequence (e.g., an inverted sequence) of nucleic acid encoding the NeuroD1 polypeptide. In some cases, a GFAP promoter can be included in a viral vector to facilitate transcription of a nucleic acid encoding a recombinase in astrocytes.
[0038] In some cases, the methods described herein can be carried out using both nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase (e.g., a Cre recombinase). In some cases, nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase can be located on the same viral vector. In such cases, the viral vector can be an adeno-associated viral vector (e.g., an adeno-associated virus serotype 9 viral vector). In some cases, nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase can be located on separate viral vectors, and each of the separate viral vectors can be administered to glial cells (e.g., reactive astrocytes). In such cases, each of the separate viral vectors can be an adeno-associated viral vector (e.g., an adeno-associated virus serotype 9 viral vector). For example, a first viral vector can contain an inverted sequence of a constitutive CAG promoter operably linked to nucleic acid encoding a NeuroD1 polypeptide where the inverted sequence is flanked by loxP sites, and a second viral vector can contain an astrocyte-specific GFAP promoter operably linked to a Cre recombinase. In this case, the GFAP promoter can drive transcription of Cre recombinase in astrocytes where Cre-mediated recombination leads to high expression of NeuroD1 driven by a strong, constitutive CAG promoter.
[0039] In some cases, nucleic acid encoding a NeuroD1 polypeptide (e.g., a composition containing nucleic acid designed to express a NeuroD1 polypeptide) can be administered to a mammal using non-viral vectors. Methods of using non-viral vectors for nucleic acid delivery are described elsewhere. See, for example, Gene Therapy Protocols (Methods in Molecular Medicine), edited by Jeffrey R. Morgan, Humana Press, Totowa, N.J. (2002). For example, nucleic acid encoding a NeuroD1 polypeptide can be administered to a mammal by direct injection of nucleic acid molecules (e.g., plasmids) containing nucleic acid encoding a NeuroD1 polypeptide and, or by administering nucleic acid molecules complexed with lipids, polymers, or nanospheres. In some cases, a genome editing technique such as CRISPR/Cas9-mediated gene editing (see, e.g., U.S. Pat. Nos. 8,697,359; 8,771,945; 8,871,445; 8,795,965; 9,738,908; 9,809,814; 9,803,194; 9,725,714; 9,410,198; and 9,260,752) or TALEN gene editing (see, e.g., U.S. Pat. Nos. 8,586,363; 8,450,471; 8,440,431; and 8,440,432) can be used to introduce exogenous nucleic acid encoding a NeuroD1 polypeptide into cells and/or to activate endogenous NeuroD1 gene expression within cells.
[0040] In some cases, delivery of nucleic acid designed to express a NeuroD1 polypeptide to glial cells (e.g., reactive astrocytes) within a brain of a living mammal can result in efficient NeuroD1 expression within the glial cells. For example, from about 10% to about 95% (e.g., from about 10% to about 90%, from about 10% to about 85%, from about 10% to about 80%, from about 10% to about 75%, from about 10% to about 60%, from about 10% to about 50%, from about 10% to about 35%, from about 20% to about 95%, from about 30% to about 95%, from about 40% to about 95%, from about 50% to about 95%, from about 60% to about 95%, from about 70% to about 95%, from about 80% to about 95%, from about 90% to about 95%, from about 20% to about 85%, from about 25% to about 75%, from about 30% to about 65%, or from about 40% to about 55%) of reactive astrocytes infected with a viral vector including nucleic acid sequence encoding a NeuroD1 polypeptide can express NeuroD1. For example, from about 90 to 95 percent (e.g., 92.82.8%) of reactive astrocytes infected with a viral vector including nucleic acid sequence encoding a NeuroD1 polypeptide can express NeuroD1.
[0041] Nucleic acid encoding a NeuroD1 polypeptide can be produced by techniques including, without limitation, molecular cloning, polymerase chain reaction (PCR), chemical nucleic acid synthesis techniques, and combinations of such techniques. For example, PCR or RT-PCR can be used with oligonucleotide primers designed to amplify nucleic acid (e.g., genomic DNA or RNA) encoding a NeuroD1 polypeptide.
[0042] In some cases, a NeuroD1 polypeptide (e.g., a composition containing a NeuroD1 polypeptide) can be administered in addition to or in place of nucleic acid designed to express a NeuroD1 polypeptide. For example, a NeuroD1 polypeptide can be administered to a mammal to trigger reactive astrocytes within the brain into forming functional neurons.
[0043] Nucleic acid designed to express a NeuroD1 polypeptide (or a NeuroD1 polypeptide) can be delivered to glial cells (e.g., reactive astrocytes) within a brain (e.g., within the cerebral cortex) via direct intracranial administration, intrathecal administration, intraperitoneal administration, intravenous administration, intranasal administration, intramuscular administration, or oral administration in nanoparticles and/or drug tablets, capsules, or pills. Nucleic acid designed to express a NeuroD1 polypeptide (or a NeuroD1 polypeptide) can be delivered to glial cells (e.g., reactive astrocytes) within a brain (e.g., within the cerebral cortex) via any appropriate method (e.g., injection).
[0044] As described herein, nucleic acid designed to express a NeuroD1 polypeptide (e.g., a composition containing nucleic acid designed to express a NeuroD1 polypeptide) can be administered to a mammal (e.g., a human) having a brain injury to treat the brain injury. For example, an adeno-associated viral vector (e.g., a serotype 9 adeno-associated viral vector) can be designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1, and that designed viral vector can be administered to a human having a brain injury to treat the brain injury. In some cases, NeuroD1-mediated AtN conversion can treat brain injury by converting glial cells (e.g., reactive astrocytes) into functional neurons, rebalancing neuron:glia ratios, repairing damaged brain tissue (e.g., reversing glial scar tissue back to neural tissue), reducing neuroinflammation, restoring the blood-brain-barrier, and/or reducing the amount of toxic M1 microglia. In some cases, NeuroD1-mediated AtN conversion can take from about 7 to about 14 days after administration of nucleic acid designed to express a NeuroD1 polypeptide. In some cases, NeuroD1-mediated effects (e.g., converting reactive astrocytes into functional neurons, rebalancing neuron:glia ratios, repairing damaged brain tissue (e.g., reversing glial scar tissue back to neural tissue), reducing neuroinflammation, restoring the blood-brain-barrier, transforming A1 astrocytes, and/or reducing the amount of toxic M1 microglia) can be observed about 3 days after delivering nucleic acid encoding a NeuroD1 polypeptide or after delivering a composition containing a NeuroD1 polypeptide. In some cases, NeuroD1-mediated effects can be observed in reactive astrocytes prior to the reactive astrocytes being converting into neurons.
[0045] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to convert glial cells (e.g., reactive astrocytes) into functional neurons. For example, from about 50% to about 95% (e.g., from about 50% to about 90%, from about 50% to about 85%, from about 50% to about 80%, from about 50% to about 75%, from about 50% to about 65%, from about 60% to about 95%, from about 70% to about 95%, from about 75% to about 95%, from about 80% to about 95%, from about 85% to about 95%, from about 90% to about 95%, from about 60% to about 90%, from about 65% to about 85%, or from about 70% to about 80%) of reactive astrocytes infected with a viral vector containing a nucleic acid sequence encoding a NeuroD1 polypeptide can undergo NeuroD1-mediated AtN conversion. In some cases, from about 85 to about 98 percent (e.g., 90.65.2%) of reactive astrocytes infected with a viral vector including a nucleic acid sequence encoding a NeuroD1 polypeptide can undergo NeuroD1-mediated AtN conversion. In some cases, from about 80 to about 98 percent (e.g., 89.24.7%) of reactive astrocytes infected with a viral vector including a nucleic acid sequence encoding a NeuroD1 polypeptide can undergo NeuroD1-mediated AtN conversion. For example, NeuroD1-mediated AtN conversion can form from about 200 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2 (e.g., from about 200 functional neurons/mm.sup.2 to about 775 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 750 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 725 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 700 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 650 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 600 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 550 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 500 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 450 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 400 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 350 functional neurons/mm.sup.2, from about 200 functional neurons/mm.sup.2 to about 300 functional neurons/mm.sup.2, from about 150 functional neurons/mm.sup.2 to about 400 functional neurons/mm.sup.2, from about 250 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 300 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 350 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 400 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 450 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 500 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 550 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 600 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 650 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 700 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 750 functional neurons/mm.sup.2 to about 800 functional neurons/mm.sup.2, from about 250 functional neurons/mm.sup.2 to about 750 functional neurons/mm.sup.2, from about 300 functional neurons/mm.sup.2 to about 725 functional neurons/mm.sup.2, from about 350 functional neurons/mm.sup.2 to about 700 functional neurons/mm.sup.2, from about 400 functional neurons/mm.sup.2 to about 650 functional neurons/mm.sup.2, from about 450 functional neurons/mm.sup.2 to about 600 functional neurons/mm.sup.2, or from about 500 functional neurons/mm.sup.2 to about 550 functional neurons/mm.sup.2). In some cases, NeuroD1-mediated AtN conversion can form from about 150 to about 300 (e.g., 219.719.3) functional neurons/mm.sup.2 after NeuroD1 infection. For example, NeuroD1-mediated AtN conversion can form functional neurons having increased expression of astrocytic genes that support neuronal functions (e.g., annexin A2 (Anax2), thrombospondin 1 (Thbs1), glypican 6 (Gpc6), and brain-derived neurotrophic factor (Bdnf) after NeuroD1 infection. In some cases, astrocytes are not depleted after NeuroD1-mediated AtN conversion. In some cases, astrocytes are repopulated (e.g., due to an intrinsic proliferation capability) following NeuroD1-mediated AtN conversion.
[0046] In some cases, methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 (or a polypeptide having the amino acid sequence set forth in SEQ ID NO:1) to a mammal (e.g., a human) having a brain injury) can be used to rebalance neuron:glia ratios. Neuron:astrocyte ratios drop following brain injury (see, e.g., Example 1). In some cases, NeuroD1-mediated AtN conversion after NeuroD1 infection can increase the neuron:glia ratio in the brain of a mammal. For example, NeuroD1-mediated AtN conversion can increase the neuron:glia ratio by decreasing the number of astrocyes. For example, NeuroD1-mediated AtN conversion can increase the neuron:glia ratio by increasing the number of neurons. For example, NeuroD1-mediated AtN conversion can increase the neuron:glia ratio by both decreasing the number of astrocytes and increasing the number of neurons.
[0047] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to repair damaged brain tissue (e.g., reversing glial scar tissue back to neural tissue). For example, NeuroD1-mediated AtN conversion can induce decreased expression of astrocytic genes unregulated in injury such as pan-reactive astrocyte genes (e.g., Gfap) and/or markers associated with glial scars (e.g., Lcn2 and CSPG) in the injured brain (e.g., relative to typical expression of the same astrocytic genes in non-injured brains). For example, NeuroD1-mediated AtN conversion can induce increased expression of astrocytic genes that support neuronal functions (e.g., Anax2, Thbs1, Gpc6, and Bdnf) in the injured brain (e.g., relative to typical expression of the same astrocytic genes in non-injured brains).
[0048] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to reduce neuroinflammation. For example, NeuroD1-mediated AtN conversion can induce decreased expression of cytokines (e.g., TNFa and IL-1b) and/or markers for macrophages and monocytes (e.g., CD68) in the injured brain (e.g., relative to typical expression of the same cytokines in non-injured brains).
[0049] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to restore the blood-brain-barrier. For example, NeuroD1-mediated AtN conversion can induce increased AQP4 expression (e.g., increased AQP4 signaling) in the injured brain along blood vessels (e.g., relative to typical expression of AQP4 along blood vessels in non-injured brains) in the brain of a mammal. For example, NeuroD1-mediated AtN conversion can induce increased AQP4 signaling between the injured brain and blood vessels in the brain of a mammal.
[0050] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to transform A1 astrocytes (e.g., transform toxic A1 astrocytes into less harmful astrocytes). For example, NeuroD1-mediated AtN conversion can induce decreased expression of genes characteristic of A1 astrocytes (e.g., toxic A1 type astrocyte-specific genes such as Gbp2 and Serping1) in the injured brain (e.g., relative to typical expression of the same genes characteristic of A1 astrocytes in non-injured brains). For example, NeuroD1-mediated AtN conversion can induce decreased expression of Gbp2 and/or Serping1 in the injured brain.
[0051] In some cases, the methods and materials provided herein (e.g., administering nucleic acid designed to express a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and/or administering a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 to a mammal (e.g., a human) having a brain injury) can be used to reduce microglia (e.g., to reduce the amount of toxic M1 microglia). For example, NeuroD1-mediated AtN conversion can form functional neurons having the morphology of resting microglia. For example, NeuroD1-mediated AtN conversion can reverse microglia morphology in the brain of a mammal (e.g., can reverse microglia morphology in the brain of a mammal back to the morphology of resting microglia).
[0052] In some cases, a polypeptide (or a nucleic acid encoding a polypeptide) containing the entire amino acid sequence set forth in SEQ ID NO:1, except that the amino acid sequence contains from one to ten (e.g., ten, one to nine, two to nine, one to eight, two to eight, one to seven, one to six, one to five, one to four, one to three, two, or one) amino acid additions, deletions, substitutions, or combinations thereof, can be used as described herein. For example, nucleic acid designed to express a polypeptide containing the entire amino acid sequence set forth in SEQ ID NO:1 with one to ten amino acid additions, deletions, substitutions, or combinations thereof can be designed and administered to a human having a brain injury to treat the brain injury.
[0053] Any appropriate amino acid residue set forth in SEQ ID NO:1 can be deleted, and any appropriate amino acid residue (e.g., any of the 20 conventional amino acid residues or any other type of amino acid such as ornithine or citrulline) can be added to or substituted within the sequence set forth in SEQ ID NO:1. The majority of naturally occurring amino acids are L-amino acids, and naturally occurring polypeptides are largely comprised of L-amino acids. D-amino acids are the enantiomers of L-amino acids. In some cases, a polypeptide provided herein can contain one or more D-amino acids. In some embodiments, a polypeptide can contain chemical structures such as -aminohexanoic acid; hydroxylated amino acids such as 3-hydroxyproline, 4-hydroxyproline, (5R)-5-hydroxy-L-lysine, allo-hydroxylysine, and 5-hydroxy-L-norvaline; or glycosylated amino acids such as amino acids containing monosaccharides (e.g., D-glucose, D-galactose, D-mannose, D-glucosamine, and D-galactosamine) or combinations of monosaccharides.
[0054] Amino acid substitutions can be made, in some cases, by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at particular sites, or (c) the bulk of the side chain. For example, naturally occurring residues can be divided into groups based on side-chain properties: (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, and threonine); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (asparagine, glutamine, histidine, lysine, and arginine); (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups can be considered conservative substitutions. Non-limiting examples of substitutions (e.g., one to ten amino acid substitutions) that can be used herein for SEQ ID NO:1 include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenyalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and/or leucine for valine. Further examples of conservative substitutions that can be made at any appropriate position within SEQ ID NO:1 are set forth in Table 1.
TABLE-US-00001 TABLE 1 Examples of conservative amino acid substitutions. Original Preferred Residue Exemplary substitutions substitutions Ala Val, Leu, Ile Val Arg Lys, Gln, Asn Lys Asn Gln, His, Lys, Arg Gln Asp Glu Glu Cys Ser Ser Gln Asn Asn Glu Asp Asp Gly Pro Pro His Asn, Gln, Lys, Arg Arg Ile Leu, Val, Met, Ala, Phe, Norleucine Leu Leu Norleucine, Ile, Val, Met, Ala, Phe Ile Lys Arg, Gln, Asn Arg Met Leu, Phe, Ile Leu Phe Leu, Val, Ile, Ala Leu Pro Gly Gly Ser Thr Thr Thr Ser Ser Trp Tyr Tyr Tyr Trp, Phe, Thr, Ser Phe Val Ile, Leu, Met, Phe, Ala, Norleucine Leu
[0055] In some embodiments, polypeptides can be designed to include the amino acid sequence set forth in SEQ ID NO:1 with the proviso that it includes one or more non-conservative substitutions. Non-conservative substitutions typically entail exchanging a member of one of the classes described above for a member of another class. Whether an amino acid change results in a functional polypeptide can be determined by assaying the specific activity of the polypeptide using, for example, the methods disclosed herein.
[0056] In some cases, a polypeptide having an amino acid sequence with at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99.0%) sequence identity to the amino acid sequence set forth in SEQ ID NO:1, provided that it includes at least one difference (e.g., at least one amino acid addition, deletion, or substitution) with respect to SEQ ID NO:1, can be used. For example, nucleic acid designed to express a polypeptide containing an amino acid sequence with between 90% and 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:1 can be administered to a human having a brain injury to treat the brain injury.
[0057] Percent sequence identity is calculated by determining the number of matched positions in aligned amino acid sequences, dividing the number of matched positions by the total number of aligned amino acids, and multiplying by 100. A matched position refers to a position in which identical amino acids occur at the same position in aligned amino acid sequences. Percent sequence identity also can be determined for any nucleic acid sequence.
[0058] The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number (e.g., SEQ ID NO:1) is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained online at fr.com/blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to 1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq c:\seq1.txt-j c:\seq2.txt-p blastn-o c:\output.txt-q1-r2. To compare two amino acid sequences, the options of Bl2seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq c:\seq1.txt-j c:\seq2.txt-p blastp-o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.
[0059] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO:1), followed by multiplying the resulting value by 100. For example, an amino acid sequence that has 340 matches when aligned with the sequence set forth in SEQ ID NO:1 is 95.5 percent identical to the sequence set forth in SEQ ID NO:1 (i.e., 340356100=95.5056). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 is rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 is rounded up to 75.2. It also is noted that the length value will always be an integer.
[0060] In certain instances, the brain (e.g., the cerebral cortex) within a mammal (e.g., a living mammal) can be monitored to evaluate the effectiveness of a treatment described herein. Any appropriate method can be used to determine whether or not a brain injury present within a mammal is treated. For example, imaging techniques and/or laboratory assays can be used to assess the number reactive astrocytes and/or the number of functional neurons present within a mammal's brain. In some cases, imaging techniques and/or laboratory assays can be used to assess whether or not any NeuroD1-mediated effects (e.g., converting glial cells (e.g., reactive astrocytes) into functional neurons, rebalancing neuron:glia ratios, repairing damaged brain tissue (e.g., reversing glial scar tissue back to neural tissue), reducing neuroinflammation, restoring the blood-brain-barrier, transforming A1 astrocytes, and/or reducing the amount of toxic M1 microglia) are observed. In some cases, imaging techniques and/or laboratory assays can be used to assess NeuroD1-mediated effects can be as described in Example 1.
[0061] Also provided herein are kits that include using nucleic acid encoding a NeuroD1 polypeptide described herein (e.g., anti-cancer agents that inhibit IL-6, IL-8, and EGF). In some cases, the kits can include nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase (e.g., a cre recombinase). For example, the kits can include nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase located on the same vector (e.g., a viral vector). For example, the kits can include nucleic acid encoding a NeuroD1 polypeptide and nucleic acid encoding a recombinase (e.g., a cre recombinase) located on separate viral vectors. The kits also can include instructions for performing any of the methods described herein. In some cases, the kits can include at least one dose of any of the compositions (e.g., a composition containing nucleic acid encoding a NeuroD1 polypeptide and, optionally, nucleic acid encoding a recombinase) described herein. In some embodiments, the kits can provide a means (e.g., a syringe) for administering any of the compositions described herein.
[0062] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1: Reversing Glial Scar Back to Neural Tissue Through NeuroD1-Mediated Astrocyte-to-Neuron Conversion
[0063] This Example investigates in vivo glia-to-neuron conversion. A severe stab injury model in the mouse motor cortex was employed to investigate the impact of cell conversion on the microenvironment of injured brains. Different from the result of killing reactive astrocytes, converting reactive astrocytes into neurons reversed glial scar back to neural tissue. Astrocytes were not depleted after neuronal conversion, but rather repopulated after conversion. Ectopic expression of NeuroD1 in reactive astrocytes transformed A1 type toxic astrocytes into less reactive astrocytes. Reactive microglia were also ameliorated, and neuroinflammation was reduced following NeuroD1-mediated astrocyte-to-neuron (AtN) conversion. Furthermore, blood-brain-barrier (BBB) was restored, and neuronal synaptic connections were re-established after AtN conversion. Thus, the results provided herein demonstrate that NeuroD1-mediated cell conversion can reverse glial scar back to neural tissue by rebalancing neuron:glia ratio after injury.
Methods and Materials
Mouse Model of Stab Injury and Virus Injection
[0064] Animal procedures were performed in accordance with the Animal Protection Guidelines of the US National Institutes of Health, and all experimental protocols were approved by the Pennsylvania State University's Institutional Animal Care and Use Committee (IACUC). Wild type (WT) C57BL/6J and FVB/N-Tg(GFAP::GFP) 14Mes/J transgenic mice were purchased from Jackson Laboratory. Mice were housed in a 12-hour light/dark cycle and supplied with sufficient food and water. Adult mice (20-30 grams) with both genders were recruited in the experiments at the age of 3-6 months old. Mouse motor cortex was injured with a blunt needle (0.95 mm outer diameter) as described elsewhere (see, e.g., Bardehle et al., 2013 Nat Neurosci 16:580-586; Bush et al., 1999 Neuron 23:297-308; and Guo et al., 2014 Cell Stem Cell 14:188-202) with modifications. Briefly, ketamine/xylazine (100 mg/kg ketamine; 12 mg/kg xylazine) was administrated by intra-peritoneal injection. Under anesthesia, mice were placed in a stereotaxic apparatus with the skull and bregma exposed by a midline incision. A hole of about 1.2 mm was drilled in the skull in motor cortex (coordination: +1.0 mm anterior-posterior (AP), 1.5 mm medial-lateral (ML) relative to Bergma). A blunt needle (0.95 mm) was placed into each site to the depth of 1.8 mm dorsal-ventral (DV) and stayed still for 3 minutes. At 4 or 10 days post stab injury (dps), mice were randomly subjected to either NeuroD1 or control virus-injection into the same site. The viral injection procedures were similar to those described elsewhere (see, e.g., Guo et al., 2014 Cell Stem Cell 14:188-202), with each injection site receiving 1.5 L AAV or retrovirus using a 5 L micro-syringe and a 34 Gauge needle (Hamilton). The viral injection rate was controlled at 0.15 L/minute, with the needle gradually moved up at a speed of 0.1 mm/minute. After injection, the needle was maintained in place for additional 3 minutes before being fully withdrawn. Post-surgery, mice were recovered on heating pad until free movement was observed. Mice were single housed and carefully monitored daily for at least one week.
AAV Vector Construction
[0065] The hGFAP promoter was obtained from pDRIVE-hGFAP plasmid (InvivoGen Inc.) and inserted into pAAV-MCS (Cell Biolab) between MluI and SacII to replace the CMV promoter. The Cre gene was obtained by PCR from Addgene plasmid #40591 (obtained from Dr. Albee Messing) and inserted into pAAV MCS between EcoRI and Sall sites to generate pAAV-hGFAP::Cre vector. To construct pAAV-FLEX-mCherry-P2A-mCherry and pAAV-FLEX-NeuroD1-P2A-mCherry vectors, the NeuroD1 or mCherry-coding cDNA was obtained by PCR using the retroviral constructs as described elsewhere (see, e.g., Guo et al., 2014 Cell Stem Cell 14:188-202). The NeuroD1 gene were fused with P2A-mCherry and subcloned into the pAAV-FLEX-GFP vector (Addgene plasmid #28304) between KpnI and XhoI sites. Plasmid constructs were verified by sequencing.
AAV Virus Production
[0066] Recombinant AAV stereotype 9 was produced in 293AAV cells (Cell Biolabs). Briefly, triple plasmids (pAAV expression vector, pAAV9-RC (Cell Biolab), and pHelper (Cell Biolab)) were transfected by polyethylenimine (PEI, linear, MW 25,000). Cells were scrapped and centrifuged at 72 hours post transfection. Cell pellets were frozen and thawed for four times by being placed in dry ice/ethanol and 37 C. water bath alternately. AAV lysate was purified by ultra-centrifugation at 54,000 rpm for 1 hour in discontinuous iodixanol gradients (Beckman SW55Ti rotor). The virus-containing layer was collected followed by concentration by Millipore Amicon Ultra Centrifugal Filters. Virus titers were initially determined by QuickTiter AAV Quantitation Kit (Cell Biolabs): 1.210{circumflex over ()}12 GC/mL for hGFAP::Cre, 1.410{circumflex over ()}12 GC/mL for FLEX-NeuroD1-P2AmCherry, 1.610{circumflex over ()}12 GC/mL for FLEX-mCherry-P2A-mCherry.
Retrovirus Production
[0067] The pCAG::GFP-IRES-GFP retroviral vector was obtained. Mouse NeuroD1 sequence was inserted into the above-mentioned vector to generate pCAG::NeuroD1-IRES-GFP vector (Guo et al., 2014 Cell Stem Cell 14:188-202). To package retroviral particles, target vector with vesicular stomatitis virus glycoprotein (VSV-G) vector were transfected by PEI in gpg helper-free human embryonic kidney (HEK) cells. The titer of retroviral particles was determined as about 10.sup.7 particles/mL.
Tissue Collection
[0068] Brain samples were collected as described elsewhere (see, e.g., Guo et al., 2014 Cell Stem Cell 14:188-202). Briefly, animals were injected with 2.5% Avertin for anesthesia. Transcardial perfusion with artificial cerebral spinal fluid (ACSF) was performed to systemically wash out the blood. Then, brains were dissected out, for immunohistochemistry use, brains were post-fixed in 4% paraformaldehyde (PFA) at 4 C. overnight. For RNA extraction use, brain tissues around the injury site (about 1.51.5 mm square) were dissected and flash-frozen at 80 C.
Immunohistochemistry
[0069] After fixation, brain tissues were sectioned at 40 m sections using Leica-1000 vibratome. Brain slices were washed 3 times with phosphate-buffered saline (PBS) followed by permeablization in 2% Triton X-100 in PBS for 1 hour. Then, brain sections were blocked in 5% normal donkey serum and 0.3% Triton X-100 in PBS for 1 hour. The primary antibodies were added into blocking buffer and incubated with brain sections for overnight at 4 C. Primary antibodies were rinsed off with PBS for 3 times followed by secondary antibody incubation for 2 hours at room temperature (RT). After being washed with PBS, brain sections were mounted onto a glass slide with an anti-fading mounting solution containing DAPI (Invitrogen). Images were acquired with confocal microscopes (Olympus FV1000 or Zeiss LSM800). To ensure antibody specificity, only secondary antibody was used for immunostaining as a side-by-side control, with no distinct signal detected.
BrdU Labeling
[0070] For labeling of proliferative astrocytes after brain injury, GFAP-GFP transgenic mice were used and intra-peritoneal injection of BrdU (BrdU labeling reagent, Invitrogen) was conducted daily from 1 dps to 4 or 10 dps at a dose of 0.1 mL/10 grams. For characterization of newly generated astrocytes after conversion, BrdU was administrated daily from 7 to 14 dpi. Fixed brain sections were subjected to a 30-minute treatment with 2 M HCl at 37 C. for DNA denaturation. After 5 washes with PBS, brain sections were permeablized in 2% Triton-PBS for 1 hour and incubated in blocking buffer (5% normal donkey serum and 0.3% triton in PBS) for additional 1 hour at room temperature. Primary antibodies were mixed in blocking solution and incubated with brain sections at 4 C. overnight.
Cresyl Violet Staining (Niss1 Staining)
[0071] A series of coronal sections were collected for analysis of tissue damage. The center of needle injury was collected and set as zero point; two sections anterior and posterior to the injury site at 200 m intervals also were selected. The brain sections were first placed in xylene for 5 minutes, followed by a gradual hydration series with alcohol (95%, 70%, and 0% in water) for 3 minutes each. The samples were transferred to cresyl violate buffer (0.121 mg/mL cresyl violet acetate in NaAc buffer, pH 3.5) for 8 minutes at 60 C. Upon completion, the stain was rinsed and dehydrated in a series with alcohol (0%, 70%, 95%, and 100%) for 30 seconds each. Finally, the samples were cleared in xylene for 1 hour and mounted in DPX Mountant (Sigma-Aldrich). Images were acquired using Olympus BX61 microscope.
RNA Extraction and Quantitative Real-Time PCR
[0072] The RNA extraction was performed using Macherey-Nagel NucleoSpin RNA kit. RNA concentration and purity were measured by NanoDrop. For cDNA synthesis, 500 ng RNAs were mixed with Quanta Biosciences qScript cDNA supermix and incubated at 25 C. for 5 minutes, 42 C. for 30 minutes, 85 C. for 5 minutes, and held at 4 C. Upon completion, the cDNAs were diluted 5-fold with RNase/DNase-free water. The primers for real-time qPCR were designed using Applied Biosystems Primer Express software and synthesized in IDT. For qRT-PCR each reaction, 6.25 L, SYBR Green Supermix (Quanta Biosciences PerfeCTa, ROX), 2 L cDNA, and 3.75 L water were mixed well and loaded in 96-well plate (Applied Biosystem Inc). Gapdh was used as an internal control. All comparisons were conducted to non-injured cortical tissue from healthy mice. Comparative Ct method was used for calculation of fold change.
BBB Permeability Test
[0073] Mice were anesthetized and perfused with ACSF as described above, followed by 15 mL of 0.5 mg/mL Sulfo-NHS-LC-Biotin in PBS. For immunohistochemistry, after primary antibody incubation, brain sections were incubated with FITC Streptavidin, 1:800 diluted in PBS+0.3% triton+2.5% normal goat or donkey serum at room temperature for 1 hour, followed by normal mounting procedures.
Electrophysiology
[0074] Brain slice recordings were performed as described elsewhere (see, e.g., Guo et al., 2014 Cell Stem Cell 14:188-202). Briefly, 1 month after NeuroD1-AAV injection, mice were anaesthetized with 2.5% avertin, and then perfused with NMDG-based cutting solution (in mM): 93 NMDG, 93 HCl, 2.5 KCl, 1.25 NaH.sub.2PO.sub.4, 30 NaHCO.sup.3, 20 HEPES, 15 glucose, 12 N-Acetyl-L-cysteine, 5 sodium ascorbate, 2 Thiourea, 3 sodium pyruvate, 7 MgSO.sub.4, 0.5 CaCl.sub.2, pH 7.3-7.4, 300 mOsmo, bubbled with 95% O.sub.2/5% CO.sub.2. Coronal sections of 300 m thickness were cut around AAV-injected cortical areas with a vibratome (VT1200S, Leica, Germany) at room temperature. Slices were collected and incubated at 33.01.0 C. in oxygenated NMDG cutting solution for 10-15 minutes. Then, slices were transferred to holding solutions with continuous 95% O.sub.2/5% CO.sub.2 bubbling (in mM): 92 NaCl, 2.5 KCl, 1.25 NaH.sub.2PO.sub.4, 30 NaHCO.sub.3, 20 HEPES, 15 glucose, 12 NAcetyl-L-cysteine, 5 sodium ascorbate, 2 Thiourea, 3 sodium pyruvate, 2 MgSO.sub.4, and 2 CaCl.sub.2. Brain sections were recovered in the holding solution at least for 0.5 hours at room temperature. For patch clamp recording, a single slice was transferred to the recording chamber continuously perfused with standard ACSF (in mM: 124 NaCl, 2.5 KCl, 1.25 NaH.sub.2PO.sub.4, 26 NaHCO.sub.3, 10 Glucose, 1.3 MgSO.sub.4, and 2.5 CaCl.sub.2) saturated by 95% O.sub.2/5% CO.sub.2 at 33.01.0 C. To record action potentials and ionic currents, whole-cell recordings were performed with pipette solution containing (in mM): 135 K-Gluconate, 10 KCl, 5 Na-phosphocreatine, 10 HEPES, 2 EGTA, 4 MgATP, and 0.3 Nae GTP, pH 7.3 adjusted with KOH, 280-290 mOsm. Depolarizing currents were injected to elicit action potentials under current-clamp model. To record spontaneous excitatory postsynaptic currents (sEPSCs) and spontaneous inhibitory postsynaptic currents (sIPSCs), pipette solution contained (in mM): 120 Cs-Methanesulfonate, 10 KCl, 10 Na-phosphocreatine, 10 HEPES, 5 QX-314, 1 EGTA, 4 MgATP, and 0.3 Na.sub.2GTP, pH 7.3 adjusted with KOH, 280-290 mOsm. The cell membrane potentials were held at 70 mV (the reversal potential of ionotropic glutamate receptors) for sEPSC recording, and 0 mV (the reversal potential of GABAA receptors) for sIPSC recording, respectively. Data were collected with a MultiClamp 700A amplifier and analyzed with pCLAMP10 software (Molecular Devices).
Data Analysis and Statistics
[0075] Prism 6 graphpad software was used for statistical analysis and bar graphs. For comparison of two data sets, Student's t-test was conducted. For comparison of three data sets, one-way or two-way analysis of variance (ANOVA) was performed, followed by post-hoc tests. Statistical significance was set as p<0.05. Data were presented as meanSEM.
Antibodies and Primers
[0076] The antibodies used in this study are set forth in Table 2, and the primers used in this study are set forth in Table 3.
TABLE-US-00002 TABLE 2 Primary antibodies used in the study Primary antibody Species Company Catalog# Dilution AQP4 Rabbit Santa Cruz Sc-20812 1:600 BrdU Rat Accurate Chemical YSRTMCA 1:600 2060GA CD68 Mouse Abcam Ab31630 1:600 Connexin43 Rabbit Abcam Ab11730 1:800 CSPG Mouse Sigma C8035 1:600 GFP Chicken Abcam Ab13970 1:1000 GFAP Rabbit Millipore AB5804 1:1000 GFAP Chicken Millipore AB5541 1:1000 Iba1 Rabbit Wako 019-19741 1:800 Iba1 Goat Abcam Ab5076 1:400 iNOS Mouse Millipore MABN533 1:400 LCN2 Gt R&D AF1857 1:600 LY6C Rat Abcam AB15627 1:800 MAP2 Chicken Abcam AB5392 1:400 MBP Chicken Millipore AB9348 1:400 NeuN Rabbit Millipore ABN78 1:1000 NeuroD1 Mouse Abcam AB60704 1:600 NG2 Mouse Millipore MAB5384 1:400 RFP Rat Antibodies-online.com ABIN334653 1:1000 S100b Mouse Abcam Ab66028 1:800 SMI32 Mouse Biolegend 801701 1:1000 SMI312 Mouse Biolegend SMI312R 1:1000 SV2 Mouse DSHB SV2 1:1000 vGlut1 Rabbit Synaptic system 1:1000 GAD67 Mouse Millipore MAB5406 1:1000
TABLE-US-00003 TABLE3 Primersusedinthestudy SeqID SeqID Primer Forwardsequence No Reversesequence No m-Gapdh GGAGCGAGACCCCACTAACA 2 ACATACTCAGCACCGGCCTC 3 m-NeuroD1 AAAGCCCCCTAACTGACTGCA 4 TCAAACTCGGCGGATGGTT 5 m-Gfap TTCAGCCACACCTTTCCAGC 6 CCTTAGAGGAGGCCTGGGAG 7 m-Lcn2 AACTTGATCCCTGCCCCATCT 8 TTTCTGGACCGCATTGCCT 9 m-Gbp2 GGGGTCACTGTCTGACCACT 10 GGGAAACCTGGGATGAGATT 11 m-Serpingl ACAGCCCCCTCTGAATTCTT 12 GGATGCTCTCCAAGTTGCTC 13 m-Anax2 CAGGACATTGCCTTCGCCTAT 14 TAGGCCCAAAATCACCGTCTC 15 m-Thbsl CGTGAGCGATGAGAAGGACA 16 CGATCTGTGCTTGGTTGTGC 17 m-Gpc6 CGGCCAGACACTTTCATCAGA 18 TGGATTCATCGCTTGTGTCTTG 19 m-S100a10 CCTCTGGCTGTGGACAAAAT 20 CTGCTCACAAGAAGCAGTGG 21 m-Tm4sf1 GCCCAAGCATATTGTGGAGT 22 AGGGTAGGATGTGGCACAAG 23 m-Il1b TTGAAGTTGACGGACCCCAA 24 TGTTGATGTGCTGCTGCGA 25 m-Il6 TTCCATCCAGTTGCCTTCTTG 26 CATTTCCACGATTTCCCAGAG 27 m-Tnf CACAAACCACCAAGTGGAGGA 28 ACAAGGTACAACCCATCGGCT 29
Results
High Efficiency of NeuroD1-Mediated Astrocyte-to-Neuron Conversion in a Severe Stab Injury Model
[0077] Reactive glial cells can be directly converted into functional neurons inside mouse brains by a single transcription factor NeuroD1 (Guo et al., 2014 Cell Stem Cell 14:188-202). To determine if glial scar aids axon regeneration, and if converting astrocytes into functional neurons results in any detrimental effects, a severe stab injury model was established in adult mice (3-6 months old, both gender included) and investigated the impact of NeuroD1-mediated AtN conversion on the microenvironment of the injury areas. Specifically, a blunt needle (outer diameter 0.95 mm) was used to make a severe stab injury in the mouse motor cortex, which induced a significant tissue loss together with reactive astrogliosis in the injury sites (
[0078] To convert glial cells into neurons, retroviruses expressing NeuroD1 were employed in dividing reactive glial cells as described elsewhere (see, e.g., Guo et al., 2014 Cell Stem Cell 14:188-202). Efficient (90.65.2%) ectopic expression of NeuroD1-GFP in glial cells converted them into NeuN.sup.+ neurons, whereas none of the GFP-infected cells were co-labeled by NeuN in the control group (
Astrocytes not Depleted after Conversion
[0079] To determine whether the high efficiency of AtN conversion resulted in depletion of astrocytes after neuronal conversion, GFAP staining was performed, and an overall reduction of GFAP signal in the NeuroD1 group compared to the control group was observed (
Neuron:Astrocyte Ratio Rebalanced after Conversion
[0080] Brain functions rely upon a delicate balance between neurons and glial cells. After neural injury, neurons die but glial cells proliferate, leading to an altered neuron:glia ratio in the injury areas. This was clearly reflected in the severe stab injury model, where the number of healthy neurons (NeuN.sup.+ cells) significantly decreased after injury but the number of astrocytes significantly increased (GFAP.sup.+/s100b.sup.+) (
A1 Reactive Astrocytes Transformed During Conversion
[0081] To determine if astrocytes persisted after NeuroD1-mediated conversion, and to evaluate whether they differ from the reactive astrocytes in the control group, RT-PCR analysis of a variety of genes related to A1 astrocytes and neuroinflammation at 3 dpi, an early stage before neuronal conversion, was performed. Compared to non-injury (NI) group, stab injury caused an upregulation of the pan-reactive astrocyte genes such as Gfap by 37-fold (
[0082] NeuroD1-positive astrocytes also exhibited a significant decrease in the expression level of Lcn2 compared to the reactive astrocytes in control group (
Astrocyte-Microglia Interaction During Neuronal Conversion
[0083] Next, the impact of AtN conversion on microglia was investigated. Compared to the resting microglia in non-injured brains (
Astrocyte-Blood Vessel Interaction During In Vivo Cell Conversion
[0084] A function of astrocytes in the brain is to interact with blood vessels and contribute to blood-brain-barrier (BBB) in order to prevent bacterial and viral infection and reduce chemical toxicity (Obermeier et al., 2013 Nat Med 19:1584-1596). In healthy brain, BBB is tightened by astrocytic endfeet wrapping around the blood vessels (
Functional Recovery after NeuroD1-Mediated Neuronal Conversion
[0085] With a substantial change in the glial environment after NeuroD1-mediated AtN conversion, neuronal properties such as dendritic morphology, synaptic density, and electrophysiological function in the injury areas were investigated. Stab injury resulted in severe dendritic damage as shown by dendritic marker SMI32 (
[0086] It was next investigated whether the NeuroD1-converted neurons were physiologically functional. Cortical brain slices were prepared, and patch-clamp recordings were performed on the NeuroD1-mCherry converted neurons (
[0087] Significant tissue loss after severe stab injury during a variety of immunostaining analysis, but a remarkable tissue repair in the NeuroD1-treatment group (
OTHER EMBODIMENTS
[0088] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.