USE OF PASTEURIZED AKKERMANSIA FOR TREATING METABOLIC DISORDERS
20210015876 · 2021-01-21
Inventors
- Patrice CANI (Bruxelles, BE)
- Amandine Everard (Wavre, BE)
- Hubert Plovier (Rumes, BE)
- Céline DRUART (Quaregon, BE)
- Willem De Vos (Ede, NL)
- Clara Belzer (Wageningen, NL)
US classification
- 1/1
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61K8/99
HUMAN NECESSITIES
A23V2200/328
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A23V2002/00
HUMAN NECESSITIES
A23V2200/328
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A23L33/30
HUMAN NECESSITIES
International classification
A23L33/105
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
A61K8/99
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present invention relates to pasteurized Akkermansia muciniphila or fragments thereof for treating a metabolic disorder in a subject in need thereof. The present invention also relates to a composition, a pharmaceutical composition and a medicament comprising pasteurized Akkermansia muciniphila or fragments thereof for treating a metabolic disorder. The present invention also relates to the use of pasteurized Akkermansia muciniphila or fragments thereof for promoting weight loss in a subject in need thereof.
Claims
1. A method for treating a metabolic disorder in a subject in need thereof, comprising administering to the subject Akkermansia muciniphila or fragments thereof, wherein the Akkermansia muciniphila is pasteurized.
2. The method of claim 1, wherein said metabolic disorder is obesity.
3. The method of claim 1, wherein said metabolic disorder is selected from the group consisting of: metabolic syndrome; insulin-deficiency or insulin-resistance related disorders; diabetes mellitus including type 2 diabetes; glucose intolerance; abnormal lipid metabolism; atherosclerosis; hypertension; pre-eclampsia; cardiac pathology; stroke; non-alcoholic fatty liver disease; hyperglycemia; hepatic steatosis; liver diseases including fibrosis associated with obesity and abnormal liver functions, more particularly changes in bile production and immunity; dyslipidemia; dysfunction of the immune system associated with overweight and obesity; inflammatory, immune and barrier function diseases including inflammatory bowel disease, more particularly Crohn's disease and ulcerative colitis, and irritable bowel syndrome; cardiovascular diseases; high cholesterol; elevated triglycerides; asthma; sleep apnea; osteoarthritis; neuro-degeneration; gallbladder disease; syndrome X; atherogenic dyslipidemia; and cancer.
4. A method for a) increasing energy expenditure of a subject, optionally without impacting the food intake of said subject; or b) increasing satiety in a subject, comprising administering Akkermansia muciniphila or fragments thereof to the subject, wherein the Akkermansia muciniphila is pasteurized.
5. (canceled)
6. The method of claim 1, wherein the Akkermansia muciniphila is orally administered.
7. The method of claim 1, wherein the Akkermansia muciniphila is administered to the subject in an amount from about 1.10.sup.4 to about 1.10.sup.12 cells, about 1.10.sup.5 to about 1.10.sup.11 cells, or from about 1.10.sup.6 to about 1.10.sup.10 cells.
8. The method of claim 1, wherein the Akkermansia muciniphila is administered at least three times a week.
9. The method of claim 1, wherein the Akkermansia muciniphila is co-administered with another probiotic strain and/or another bacteria and/or microorganisms with beneficial effects and/or with one or more prebiotics.
10. The method of claim 1, wherein the Akkermansia muciniphila or fragments thereof is administered as a composition according to any one of claims 1 to 9 in association with an excipient.
11. The method of claim 10, wherein said composition is a nutritional composition.
12. The method of claim 10, wherein said composition is orally administered.
13. The method of claim 1, wherein the Akkermansia muciniphila is administered as a pharmaceutical composition in association with a pharmaceutically acceptable vehicle.
14. (canceled)
15. A method for weight loss in a subject in need thereof, comprising administering Akkermansia muciniphila or fragments thereof to the subject, wherein the Akkermansia muciniphila is pasteurized.
16. The method of claim 15, wherein the Akkermansia muciniphila is administered as a cosmetic composition, and wherein the Akkermansia muciniphila is pasteurized.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
EXAMPLES
[0191] The present invention is further illustrated by the following examples.
[0192] We previously showed that daily administration of Akkermansia muciniphila to mice fed a high-fat diet can impede the development of obesity (WO 2014/076246).
[0193] With the perspective of transferring these results to clinical settings, we decided to assess whether A. muciniphila would retain its effects when cultured on a non-mucus-based medium suited for human trials. Moreover, our previous results indicated that autoclaving A. muciniphila abolished its effect on diet-induced obesity. We therefore sought to investigate the consequences of another inactivation method (i.e. pasteurization) on A. muciniphila-mediated effects.
Materials and Methods
Mice
[0194] First experiment: a set of 10-week-old C57BL/6J mice (50 mice, n=10/group) (Charles River, L'Arbresle, France) were housed in a controlled environment (12 h daylight cycle, lights off at 6 m) in groups of two mice per cage, with free access to food and water. Mice were fed a control diet (ND) (AIN93Mi, Research diet, New Brunswick, N.J., USA) or a high-fat diet (HFD) (60% fat and 20% carbohydrates (kcal/100 g) D12492i, Research diet, New Brunswick, N.J., USA).
[0195] Mice were treated daily with an oral administration of Akkermansia muciniphila grown on a mucin-based medium (HFD Akk M) or a non-mucus-based medium (HFD Akk G) by oral gavage at the dose of 2.10.sup.8 cfu/0.15 mL suspended in sterile anaerobic phosphate buffer saline (PBS). Additionally, one group of mice was treated daily with an oral administration of Akkermansia muciniphila grown on a non-mucus-based medium and inactivated by pasteurization (HFD Akk P). Control groups were treated with an oral gavage of an equivalent volume of sterile anaerobic PBS (CT ND and CT HFD) containing a similar end concentration of glycerol (2.5% vol/vol). Treatment was continued for 4 weeks.
[0196] For the HFD Akk M group, A. muciniphila MucT (ATTC BAA-835) was grown anaerobically in a mucin-based basal medium as previously described (Derrien et al., 2004. Int. J. Syst. Evol. Microbiol. 54:1469-1476). Cultures were then washed and suspended in anaerobic PBS, including 25% (v/v) glycerol, to an end concentration of 1.10.sup.10 cfu/mL.
[0197] For the HFD Akk G group, A. muciniphila MucT (ATTC BAA-835) was grown anaerobically in non-mucus-based medium. Cultures were then washed and suspended in anaerobic PBS, including 25% (v/v) glycerol, to an end concentration of 1.10.sup.10 cfu/mL.
[0198] For the HFD Akk P group, A. muciniphila MucT (ATTC BAA-835) was grown anaerobically in non-mucus-based medium Cultures were then washed and suspended in anaerobic PBS, including 25% (v/v) glycerol, to an end concentration of 1.10.sup.10 cfu/mL. Vials were then pasteurized by exposure to a temperature of 70 C. for 30 minutes in a water bath.
[0199] Body weight, food and water intake were recorded once a week. Body composition was assessed by using 7.5 MHz time domain-nuclear magnetic resonance (TD-NMR) (LF50 minispec, Bruker, Rheinstetten, Germany).
[0200] Second experiment: a set of 10-week-old C57BL/6J mice (40 mice, n=10/group) (Charles River, L'Arbresle, France) were housed in a controlled environment (12 h daylight cycle, lights off at 6 m) in groups of two mice per cage, with free access to food and water. Mice were fed a control diet (ND) (AIN93Mi; Research diet, New Brunswick, N.J., USA) or a high-fat diet (HFD) (60% fat and 20% carbohydrates (kcal/100 g), Research diet D12492i, New Brunswick, N.J., USA). Mice were treated daily with an oral administration of Akkermansia muciniphila grown on a non-mucus-based medium and either live or pasteurized (HFD Akk G and HFD Akk P) by oral gavage at the dose of 2.10.sup.8 cfu/0.15 mL suspended in sterile anaerobic phosphate buffer saline. Control groups were treated with an oral gavage of an equivalent volume of sterile anaerobic phosphate buffer saline (CT ND and CT HFD). Treatment was continued for 5 weeks.
[0201] For the HFD Akk G group, A. muciniphila MucT (ATTC BAA-835) was grown anaerobically in non-mucus-based medium. Cultures were then washed and suspended in anaerobic PBS, including 25% (v/v) glycerol, to an end concentration of 1.10.sup.10 cfu/mL.
[0202] For the HFD Akk P group, A. muciniphila MucT (ATTC BAA-835) was grown anaerobically in non-mucus-based medium. Cultures were then washed and suspended in anaerobic PBS, including 25% (v/v) glycerol, to an end concentration of 1.10.sup.10 cfu/mL. Vials were then pasteurized by exposure to a temperature of 70 C. for 30 minutes in a water bath.
[0203] Body weight, food and water intake were recorded once a week. Body composition was assessed by using 7.5 MHz time domain-nuclear magnetic resonance (TD-NMR) (LF50 minispec, Bruker, Rheinstetten, Germany).
[0204] Fresh urinary samples were collected during the final week of treatment and directly stored at 80 C. before analysis. Fecal energy content was measured on fecal samples harvested after a 24 h period during the final week of treatment by the use of a bomb calorimeter (Mouse Clinical Institute, 67404 Illkirch, France).
[0205] Third experiment: a set of 10-week-old C57BL/6J mice (40 mice, n=10/group) (Charles River, L'Arbresle, France) were housed in a controlled environment (12 h daylight cycle, lights off at 6 m) in groups of two mice per cage, with free access to food and water. Mice were fed a control diet (CT ND) (AIN93Mi; Research diet, New Brunswick, N.J., USA) or a high-fat diet (CT HFD) (60% fat and 20% carbohydrates (kcal/100 g), Research diet D12492i, New Brunswick, N.J., USA). Mice were treated daily with an oral administration of Akkermansia muciniphila grown on a non-mucus-based medium and either live or pasteurized (HFD Akk G and HFD Akk P) by oral gavage at the dose of 2.10.sup.8 CFU/0.15 mL suspended in sterile anaerobic phosphate buffer saline. Control groups were treated with an oral gavage of an equivalent volume of sterile anaerobic phosphate buffer saline (CT ND and CT HFD). Treatment was continued for 5 weeks.
[0206] All mouse experiments were approved by and performed in accordance with the guidelines of the local ethics committee. Housing conditions were specified by the Belgian Law of May 29, 2013, regarding the protection of laboratory animals (agreement number LA1230314).
Oral Glucose Tolerance Test
[0207] 6 h-fasted mice were treated with an oral gavage glucose load (2 g glucose per kg body weight). Blood glucose levels were measured before oral glucose load and 15, 30, 60, 90 and 120 minutes after oral glucose load. Blood glucose was determined with a glucose meter (Accu Check, Aviva, Roche) on blood samples collected from the tip of the tail vein.
Insulin Resistance Index
[0208] Plasma insulin concentration was determined in 5 L of plasma using an ELISA kit (Mercodia) according to the manufacturer's instructions. Insulin resistance index was determined by multiplying the area under the curve of both blood glucose (30 to 120 minutes) and plasma insulin (30 and 15 minutes) obtained following the oral glucose tolerance test.
Western-Blot
[0209] To analyze the insulin signaling pathway in the third experiment, mice were allocated in either a saline-injected subgroup or an insulin-injected subgroup so that both subgroups were matched in terms of body weight and fat mass. They then received 1 mU/g insulin (Actrapid; Novo Nordisk A/S, Denmark) under anaesthesia (isoflurane, Forene, Abbott, Queenborough, Kent, England), or an equal volume of saline solution into the portal vein. Three minutes after injection, mice were killed and liver was rapidly harvested.
[0210] For detection of proteins of the insulin pathway, tissues were homogenized in ERK buffer (Triton X-100 0.1%, HEPES 50 mM, NaCl 5 M, Glycerol 10%, MgCl.sub.2 1.5 mM and DTT 1 mM) supplemented with a cocktail of protease inhibitors and phosphatase inhibitors. Equal amounts of proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated overnight at 4 C. with antibodies diluted in Tris-buffered saline Tween-20 containing 1% non-fat dry milk:p-IRb (1:1,000; sc-25103, Santa Cruz, Calif., USA), p-AktThr308 (1:1.000; #2965L, Cell Signaling, Danvers, Mass., USA) and p-AktSer473 (1:1.000; #4060L, Cell Signaling). Quantification of phosphoproteins was performed on 5 animals with insulin injection and 5 animals with saline injection per group. The loading control was -actin (1:10000; ab6276).
Tissue Sampling
[0211] The animals have been anesthetized with isoflurane (Forene, Abbott, Queenborough, Kent, England) and blood was sampled from the portal and cava veins. Mice were then killed by cervical dislocation before proceeding to tissue sampling. Adipose depots (epididymal, subcutaneous and mesenteric) were precisely dissected and weighed; the addition of the weights of all three adipose tissue depots corresponds to the adiposity index. The intestinal segments (ileum, cecum and colon), cecal content and adipose tissue depots were immersed in liquid nitrogen, and stored at 80 C., for further analysis.
Histological Analyses
[0212] Adipose tissues were fixed in 4% paraformaldehyde for 24 hours at room temperature. Then the samples were immersed in ethanol 100% for 24 hours prior to processing for paraffin embedding. Tissue samples, paraffin sections of 5 m, were stained with hacmatoxylin and eosin. Images were obtained using the SCN400 slide scanner (Lcica Biosystcms, Wetzlar, Germany). 5 high-magnification fields were selected at random for each mouse and adipocyte diameter was determined using ImageJ (Version 1.50a, National Institutes of Health, Bethesda, Md., USA).
RNA Preparation and Real-Time qPCR Analysis
[0213] Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA was performed by running 1 L of each sample on an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 g total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCRs were performed with the Biorad CFX real-time PCR system and software (Biorad, Hercules, United States) using Mesa Fast qPCR (Eurogentec, Seraing, Belgium) for detection according to the manufacturer's instructions. RPL19 was chosen as the housekeeping gene. All samples were run in duplicate in a single 96-well reaction plate, and data were analyzed according to the 2.sup.CT method. The identity and purity of the amplified product was checked through analysis of the melting curve carried out at the end of amplification. Primer sequences for the targeted mouse genes are presented in Table 1 below.
TABLE-US-00001 TABLE1 Primersequencesforthetargetedmousegenes. Primers Sequence RPL-19 Forward GAAGGTCAAAGGGAATGTGTTCA (SEQIDNO:1) Reverse CCTTGTCTGCCTTCAGCTTGT (SEQIDNO:2) Ocln Forward ATGTCCGGCCGATGCTCTC (SEQIDNO:3) Reverse TTTGGCTGCTCTTGGGTCTGTAT (SEQIDNO:4) Cldn3 Forward TCATCGGCAGCAGCATCATCAC (SEQIDNO:5) Reverse ACGATGGTGATCTTGGCCTTGG (SEQIDNO:6) Lyz1 Forward GCCAAGGTCTACAATCGTTGTGAGTTG (SEQIDNO:7) Reverse CAGTCAGCCAGCTTGACACCACG (SEQIDNO:8)
Measurement of Plasma Triglycerides
[0214] Plasma samples were assayed for triglycerides by measuring the glycerol resulting from hydrolysis of triglycerides, using a commercial kit (DiaSys, Condom, France).
Measurement of Plasma Leptin
[0215] Plasma samples were assayed for leptin through the use of a multiplex immunoassay kit (Merck Millipore, Brussels, Belgium) and measured using Luminex technology (Bioplex, Bio-Rad, Belgium) following the manufacturer's instructions.
Measurement of Plasma Cholesterol (Fast Protein Liquid Chromatography, FLPC)
[0216] Quantification of plasma lipoproteins was performed using fast protein liquid chromatography (FPLC, AKTA purifier 10, GE Healthcare, Chicago, Ill., USA). 50 L of individual plasma was injected and lipoproteins were separated on Superose 6 10/300 GL column (GE Healthcare, Chicago, Ill., USA) with NaCl 0.15 M at pH 7.4 as mobile phase at a 1 mL/min flow rate. The effluent was collected into fractions of 0.3 mL then cholesterol and TG content in each fraction were determined as described above. Quantification of cholesterol in lipoprotein classes (VLDL, LDL, and HDL) was performed by measuring the percentage peak area and by multiplying each percentage to the total amount of cholesterol. Plasma total cholesterol was measured with commercial kits (CHOD-PAP; BIOLABO SA, Maizy, France).
Measurement of Fecal Energy
[0217] Fecal energy content was measured on fecal samples harvested after a 24 h-period during the final week of treatment by the use of a bomb calorimeter (Mouse Clinical Institute, Illkirch, France).
Urinary Metabolomics Analyses
[0218] Mouse urine samples were prepared and measured on a spectrometer (Bruker) operating at 600.22 MHz 1H frequency according to previously published protocol (Dona A C, 2014); the .sup.1H NMR spectra were then processed and analyzed as described previously (Dumas et al., 2006. Proc. Natl. Acad. Sci. USA. 103(33):12511-6).
Quantification of Plasma Lipopolysaccharide
[0219] Portal vein blood LPS concentration was measured using an Endosafe-Multi-Cartridge System (Charles River Laboratories) based on the Limulus amacbocyte lysate (LAL) kinetic chromogenic methodology that measures color intensity directly related to the endotoxin concentration in a sample. Plasmas were diluted 1/10 with endotoxin-free buffer to minimize interferences in the reaction (inhibition or enhancement) and heated 15 minutes at 70 C. Each sample was diluted 1/100, 1/150, 1/200 or 1/400 with endotoxin-free LAL reagent water (Charles River Laboratories) and treated in duplicate, and two spikes for each sample were included in the determination. All samples have been validated for the recovery and the coefficient variation. The lower limit of detection was 0.005 EU/mL.
Determination of the Pasteurization Temperature and Time Range
[0220] Vials containing live bacteria were immersed in a water bath set to 50, 60, 70, 80 or 90 C. for 15 seconds (0.25 minutes), 2 minutes, 5 minutes, 15 minutes and 30 minutes. Inactivation of A. muciniphila was assessed by plating 50 L of undiluted vial content on Brain-Heart Infusion (BHI)-Agar medium supplemented with 5% mucus and looking for the presence of colony-forming units (cfu) after 7 days of incubation at 37 C. in an anaerobic container. Content of an autoclaved vial was used as a negative control, and content from a vial non immersed in a water bath was used as a positive control. This experiment was performed at two different times.
Mucus-Based Medium
[0221] A. muciniphila was grown in mucus-based medium, washed and concentrated as described previously (Everard et al., 2013. Proc. Natl. Acad. Sci. USA. 110:9066-9071). In addition to an untreated batch of cells, one part was subject to a mild heat treatment by a 30-minute incubation at 70 C.
Non-Mucus-Based Medium
[0222] A. muciniphila was grown in a non-mucus-based medium consisting of basal anaerobic medium as described previously (Derrien et al., 2004. Int. J. Syst. Evol. Microbiol. 54:1469-1476) containing 16 g/L soy-based pepton, 25 mM glucose and 25 mM N-acetyl-glucosamine and 4 g/L L-threonine. The cells were washed and concentrated as described previously (Everard et al., 2013. Proc. Natl. Acad. Sci. USA. 110:9066-9071). In addition to an untreated batch of cells, one part was subject to a mild heat treatment by a 30-minute incubation at 70 C.
Safety Assessment of Oral Administration of Live and Pasteurized A. muciniphila in Overweight or Obese Volunteers
[0223] Results presented are interim safety reports from twenty overweight and obese patients (Body mass index >25 kg/m.sup.2) presenting a metabolic syndrome following the NCEP ATP III definition (any three of the five following criteria: fasting glycaemia >110 mg/dL, blood pressure 130/85 mm Hg or antihypertensive treatment, fasting triglyceridemia 150 mg/dL, HDL cholesterol <40 mg/dL for males, 50 mg/dL for females, and/or waist circumference >102 cm for males, 88 cm for females). Patients were voluntarily recruited from the Cliniques Universitaires Saint Luc, Brussels, Belgium between December 2015 and May 2016. Subjects were assigned to any of the treatment arms following a randomized block design. The exclusion criteria were: presence of acute or chronic progressive or chronic unstabilized diseases, alcohol consumption (>2 glasses/day), previous bariatric surgery, any surgery in the 3 months prior to the study or planned in the next 6 months, pregnancy or pregnancy planned in the next 6 months, regular physical activity (>30 minutes of sports 3 times a week), consumption of dietary supplements (omega-3 fatty acids, probiotics, prebiotics, plant stanols/sterols) in the month prior the study, inflammatory bowel disease or irritable bowel syndrome, diabetic gastrointestinal autonomic neuropathy (such as gastroparesis or reduced gastrointestinal motility), consumption of more than 30 g of dietary fibers per day, consumption of vegetarian or unusual diet, lactose intolerance or milk protein allergy, gluten intolerance, current treatment with medications influencing parameters of interest (glucose-lowering drugs such as metformin, DPP-4 inhibitors, GLP-1 receptor agonists, acarbose, sulfonylueras, glinides, thiazolidinediones, SGLT2 inhibitors, insulin, lactulose, consumption of antibiotics in the 2 months prior the study, glucocorticoids, immunosuppressive agents, statins, fibrates, orlistat, cholestyramine, or ezetimibe), and baseline glycated hemoglobin (HbA1c) >7.5%. The Commission d'Ethique Biomdicale Hospitalo-facultaire from the Universit catholique de Louvain (Brussels, Belgium) provided ethical approval for this study and written informed consent was obtained from each participant. The trial was registered at clinicaltrials.gov as NCT02637115.
[0224] Subjects were assigned to receive either a daily dose of placebo (an equivalent volume of sterile PBS containing glycerol), 10.sup.10 CFU live A. muciniphila (Akk S-10.sup.10), 10.sup.9 CFU live A. muciniphila (Akk S-10.sup.9), or 10.sup.10 CFU pasteurized A. muciniphila (Akk P-10.sup.10) (placebo and bacteria were produced at a food-grade level according to good manufacturing practices) for 3 months. Blood samples were collected at the beginning of the treatment and a portion was directly sent to the hospital laboratory to measure relevant clinical parameters. Different tubes were used based on the clinical parameter: EDTA-coated tubes for white blood cell count, Sodium fluoride-coated tubes for fasting glycemia, citrate-coated tubes for clotting assays, and lithium-heparin-coated tubes for urea and enzymatic activities. After 2 weeks of treatment, patients came back to the hospital for a safety visit, where blood samples were collected to allow comparison of clinical parameters to baseline values.
[0225] The patients and the physicians were blinded to the treatment. For
Statistical Analysis
[0226] Data are expressed as meansSEM. Differences between two groups were assessed using the unpaired two-tailed Student's t-test. Data sets involving more than two groups were assessed by ANOVA followed by Tukey post-hoc tests. Data with different superscript letters are significantly different with P<0.05, according to the post-hoc ANOVA statistical analysis. Data were analyzed using GraphPad Prism version 5.00 for windows (GraphPad Software, San Diego, Calif., USA). Results were considered statistically significant when P<0.05.
[0227] A two-way ANOVA analysis with a Bonferonni post-test on repeated measurements was performed for the evolution of glycemia during the OGTT, for the reparation cholesterol in specific lipoproteins and for western-blot analyses.
[0228] Human data are expressed as the meanSD. Differences between groups were assessed using Kruskal-Wallis test. Differences between values observed at baseline and at the time of the safety visit were assessed using a Wilcoxon matched-pairs signed rank test. Data were analyzed using GraphPad Prism version 7.00 for Windows (GraphPad Software, San Diego, Calif., USA). The results were considered statistically significant when p<0.05.
Results
In Vitro Experiments
[0229] In order to optimize the pasteurization protocol, we first incubated vials containing A. muciniphila in water baths set to a range of temperature for different times. Pasteurization was considered effective when no bacteria could be observed after plating the treated vial contents on a rich medium (Table 2).
TABLE-US-00002 TABLE 2 Combinations of temperatures and exposure times tested for pasteurization. Live corresponds to plates where cfu were obtained in high numbers. Borderlinecorresponds to plates where between 1 and 3 cfu were observed. Inactivated corresponds to plates where no cfu could be observed. Temperature ( C.) 50 60 70 80 90 Exposure 0.25 Live Live Live Live Live (minutes) 2 Live Live Live Inactivated Inactivated 5 Live Live Borderline Inactivated Inactivated 15 Live Borderline Borderline Inactivated Inactivated 30 Borderline Inactivated Inactivated Inactivated Inactivated
For the further experiments, we have selected a pasteurization of 30 minutes at 70 C. In addition to the viability, the effect of pasteurization has been tested on the activity of two A. muciniphila fucosidases and 2 sulfatases (encoded by the genes Amuc_0010, Amuch_0146 and Amuc_0121 and Amuc_1074; van Passel et al., 2011. PLoS One. 6(3):e16876). These enzymes are relevant for the degradation of mucin. For this purpose, their genes were overexpressed in Escherichia coli as described with a C-terminal His-tag (Tailford et al., 2015. Nat. Commun. 6:7624) and the purified proteins were used for the analysis. The enzyme activities were determined before and after 30 minutes at 70 C. and this treatment completely resulted in an over 20-fold inactivation of the enzymatic activities.
In Vivo Experiments
[0230] In a first set of experiments, mice fed a high-fat diet were treated daily with an oral gavage of live A. muciniphila grown either on a mucus-based or a non-mucus-based medium. Another group of mice was treated with an oral gavage of A. muciniphila grown on a non-mucus-based medium and inactivated by pasteurization (30 minutes at 70 C.). Mice fed standard chow were used as a control group. Treatment was carried on for 4 weeks.
[0231] We observed that live A. muciniphila treatment reduced high-fat diet induced body weight and fat mass gain, regardless of the growth medium used (
[0232] We next confirmed our previous results in terms of glucose tolerance. Indeed, a high-fat diet leads to increased glycaemia following an oral glucose tolerance test (OGTT), resulting in a significantly higher area under the curve (AUC) measured between 30 minutes before and 120 minutes after glucose administration (
[0233] When taking into account insulinemia of the mice, the insulin resistance index of mice fed a high-fat diet was significantly higher than for control mice (
[0234] We previously found that treatment with A. muciniphila could impact gut barrier function through modulation of antimicrobial peptides production and regulation of mucus layer thickness. To further increase our understanding of the cross-talk between A. muciniphila and the intestinal barrier, we measured the expression of two markers of intestinal tight junction proteins, namely Ocln and Cldn3, encoding the proteins Occludin and Claudin 3; as well as Lyz1 encoding the antimicrobial peptide Lysozyme 1. In the jejunum, treatment of HFD-fed mice with live or pasteurized A. muciniphila increased the expression of Ocln, while pasteurized A. muciniphila specifically increased Lyz1 expression (
[0235] In a second and third set of experiments, we treated high-fat diet mice with A. muciniphila grown on the non-mucus-based medium, either live or pasteurized, to confirm the effects obtained above. Mice fed standard chow were used as a control group, and treatment was carried on for five weeks. Treatment with A. muciniphila grown on non-mucus-based medium lead to a 10 to 15% decrease of body weight gain, fat mass gain and adiposity index in mice fed a high-fat diet, although without reaching statistical significance (
[0236] We also obtained similar results in terms of glucose tolerance and insulin sensitivity. Indeed, while untreated mice fed a high-fat diet exhibited a higher AUC during the course of the OGTT (
[0237] In the third set of experiments, while untreated mice fed a high-fat diet exhibited a higher AUC during the course of the OGTT, treatment with live or pasteurized A. muciniphila significantly decreased the AUC, showing an improvement of glucose tolerance (
[0238] We then measured the mean adipocyte diameter in the subcutaneous adipose depot, as it is known to be increased in obesity and to contribute to the development of inflammation and insulin resistance (Rosen and Spiegelman, 2014. Cell. 156:20-44). In accordance with the literature, we observed that a high-fat diet leads to an increased diameter. Treatment with live A. muciniphila grown on a non-mucus-based did not affect the high-fat diet-induced-increased diameter. However, administration of pasteurized A. muciniphila restored the diameter to similar levels as in control mice (
[0239] The next parameter analyzed concerned the dyslipidemia induced by high-fat diet feeding. We assessed the effects of A. muciniphila on hypertriglyceridemia and hypercholesterolemia, which is associated with atherosclerosis and cardiovascular disease. Although no difference could be observed between control and untreated high-fat diet-fed mice, we observed that treatment with pasteurized A. muciniphila leads to a significant reduction (between 15 and 20%) of plasma triglyceride levels (
[0240] To further explain how live and pasteurized A. muciniphila reduce body weight and fat mass gain without affecting food intake on a high-fat diet, we measured fecal caloric content and found that it was significantly increased in mice treated with pasteurized A. muciniphila but not with live A. muciniphila (
[0241] We next assessed whether treatment with A. muciniphila could reduce the HFD-induced shift in the host urinary metabolome (
[0242] Altogether, these data suggest that the effects of A. muciniphila on host metabolism arc mostly similar regardless of the growth medium used. More surprisingly, they also show that pasteurization potentiates the effects of A. muciniphila. This is of utmost interest as pasteurization could decrease biosafety issues associated with the use of a live bacterium while increasing the efficacy of A. muciniphila in the treatment of obesity and associated disorders.
Safely Assessment of Oral Administration of Live and Pasteurized A. muciniphila in Overweight or Obese Volunteers
[0243] We evaluated the safety and tolerability of A. muciniphila oral administration in overweight and obese volunteers treated with different doses of live A. muciniphila (Akk S-10.sup.10 and Akk S-10.sup.9) or pasteurized A. muciniphila (Akk P-10.sup.10) as part of an ongoing clinical study testing the efficacy of this bacterium against the metabolic syndrome. Anthropomorphic characteristics of the patients at the beginning of the intervention are reported in Table 3.
TABLE-US-00003 TABLE 3 Descriptive characteristics at the beginning of treatment for all subjects included in the clinical study (n = 5) Placebo Akk S - 10.sup.10 Akk S - 10.sup.9 Akk P - 10.sup.10 Sex (M/W) 1/4 3/2 2/3 2/3 Age (Years) 53.00 10.98 50.40 4.72 50.60 6.69 52.40 7.99 Body weight (Kg) 102.60 13.53 111.10 19.52 103.80 17.03 122.50 12.67 Body mass index 35.84 5.98 38.48 5.37 36.30 3.12 40.71 5.71 (Kg/m.sup.2) Waist 116.60 13.03 119.50 12.35 115.60 7.20 124.90 8.10 circumference (cm) Fasting glycaemia 100.50 10.52 96.13 2.24 108.30 12.91 106.30 11.80 (mg/dl)
[0244] We analyzed several clinical parameters investigated in probiotics safety assessments (Jones et al., 2012. Food. Chem. Toxicol. 50:2216-2223; Burton et al., 2011. Food Chem. Toxicol. 49(9):2356-64; Wind et al., 2010. Br. J. Nutr. 104(12):1806-16) before and two weeks after starting the treatment. No significant changes on markers related to inflammation and hematology, kidney, liver and muscle function were observed with any formulation of A. muciniphila (
TABLE-US-00004 TABLE 4 Descriptive characteristics at the beginning of treatment for all subjects included in the clinical study (n = 5) Placebo Akk S-10.sup.10 Akk S-10.sup.9 Akk P-10.sup.9 Baseline Safety Baseline Safety Baseline Safety Baseline Safety Inflammation & Hematology C-reactive 3.60 4.40 6.60 6.40 6.60 6.40 11.40 15.20 protein 1.67 2.07 5.18 6.07 5.18 6.07 14.33 17.38 (mg dl.sup.1) White blood 6.43 7.07 7.91 8.36 7.91 8.36 6.89 8.20 cells (10.sup.3 L.sup.1) 1.49 1.68 4.08 4.17 4.08 4.17 2.44 1.61 Prothrombin 11.38 11.14 10.92 11.12 10.92 11.12 11.28 11.20 time (sec) 0.55 0.44 0.73 0.80 0.73 0.80 0.56 0.56 Liver enzymes Alanine 24.00 23.20 27.40 24.40 27.40 24.40 29.20 27.80 Aminostrans- 14.82 15.71 27.32 13.85 27.32 13.85 13.72 12.05 ferase activity (IU l.sup.1) Aspartate 17.00 16.60 19.33 17.67 19.33 17.67 23.00 19.80 Aminotrans- 6.33 6.35 9.48 5.05 9.48 5.05 9.14 7.98 ferase activity (IU l.sup.1) -Glutamyl- 22.40 23.60 40.40 33.40 40.40 33.40 45.20 42.80 transferase 15.76 18.05 38.44 24.42 38.44 24.42 28.90 24.94 activity (IU l.sup.1) Kidney function Urea (mg dl.sup.1) 35.20 30.00 28.60 30.40 28.60 30.40 31.40 43.40 10.26 7.25 9.42 4.98 9.42 4.98 2.88 18.96 Creatinine 0.73 0.71 0.78 0.80 0.78 0.80 0.83 0.89 (mg dl.sup.1) 0.11 0.10 0.09 0.15 0.09 0.15 0.18 0.21 Glomerular 92.20 95.20 88.60 88.60 88.60 88.60 83.80 78.00 filtration rate 22.52 17.11 10.06 20.19 10.06 20.19 14.17 15.41 (mL min.sup.1 1.73 m.sup.2) Muscle enzymes Creatinine 78.80 79.40 92.40 94.80 92.40 94.80 162.40 135.50 Kinase activity 25.37 28.06 40.32 38.11 40.32 38.11 122.30 87.53 (IU l.sup.1) Lactate 176.60 167.20 172.60 176.20 172.60 176.20 180.60 171.40 Dehydrogenase 19.86 22.86 20.74 33.22 20.74 33.22 17.70 34.44 activity (IU l.sup.1)
[0245] Moreover, the frequency of recorded adverse effects was similar in all groups (Table 5).
TABLE-US-00005 TABLE 5 Proportion of patients experiencing self-reported adverse effects (n = 5) Placebo Akk S - 10.sup.10 Akk S - 10.sup.9 Akk P - 10.sup.9 Nausea 1/5 0 2/5 1/5 Flatulence 0 1/5 3/5 1/5 Bloating 1/5 1/5 0 0 Cramps 1/5 1/5 0 1/5 Borborygmi 0 3/5 3/5 0 Gastric reflux 1/5 0 1/5 0
[0246] Borborygmi were reported by some patients treated with live A. muciniphila, but the difference with other groups was not significant.
[0247] While the number of subjects is limited, these first human data suggest that both live and pasteurized A. muciniphila are well tolerated in obese/overweight volunteers and appear safe for oral administration.
[0248] Furthermore, promising trends were observed in terms of fat mass, glycemia and inflammation markers at the end of the treatment period for patients treated with the high dose of live and/or pasteurized A. muciniphila.