COMBINATORIAL GENE CONSTRUCT AND NON-VIRAL DELIVERY FOR ANTI-OBESITY
20200247864 ยท 2020-08-06
Inventors
- You Han BAE (Salt Lake City, UT, US)
- Hongsuk Park (Salt Lake City, UT, US)
- Sungpil Cho (Salt Lake City, UT, US)
Cpc classification
C07K14/78
CHEMISTRY; METALLURGY
C12N9/6454
CHEMISTRY; METALLURGY
C07K14/5759
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
International classification
Abstract
The invention provides a plasmid comprising two or more anti-obesity genes. Also provided by the invention are compositions and host cells comprising the plasmid and methods of increasing the metabolic activity in a mammal. The invention provides a plasmid comprising two or more of (a) a nucleic acid sequence encoding islet amyloid polypeptide (IAPP), (b) a nucleic acid sequence encoding leptin (LEP), and (c) a nucleic acid sequence encoding fibronectin type III domain containing 5 (FNDC5).
Claims
1. A plasmid comprising two or more of: a) a nucleic acid sequence encoding islet amyloid polypeptide (IAPP); b) a nucleic acid sequence encoding leptin (LEP); and c) a nucleic acid sequence encoding fibronectin type III domain containing 5 (FNDC5).
2. The plasmid of claim 1, which comprises a nucleic acid sequence encoding IAPP and a nucleic acid sequence encoding LEP.
3. The plasmid of claim 1, which comprises a nucleic acid sequence encoding IAPP and a nucleic acid sequence encoding FNDC5.
4. The plasmid of claim 1, which comprises a nucleic acid sequence encoding LEP and a nucleic acid sequence encoding FNDC5.
5. The plasmid of claim 1, which comprises a nucleic acid sequence encoding LEP, a nucleic acid sequence encoding FNDC5, and a nucleic acid sequence encoding IAPP.
6. The plasmid of claim 1, which comprises a nucleic acid sequence encoding a self-cleaving porcine teschovirus-1 2A (P2A) peptide and a nucleic acid sequence encoding a furin peptide.
7. The plasmid of claim 1, which is conjugated to a non-viral carrier.
8. The plasmid of claim 7, wherein the non-viral carrier is polyethylenimine, linear polyethylenimine (1PEI), reducible polyethyleneimine, poly(l lysine), poly[(2 dimethylamino)ethyl methacrylate], poly(amino ester)s, chitosan, polyamidoamine dendrimer, poly[a-(4-aminobutyl)-L-glycolic acid], or a PEG grafted polycation.
9. The plasmid of claim 1, which comprises the nucleic acid sequence of SEQ ID NO: 10 or SEQ ID NO: 11.
10. A composition comprising the plasmid of claim 1 and a pharmaceutically acceptable carrier.
11. A host cell comprising the composition of claim 10.
12. The host cell of claim 11, which is a mammalian cell.
13. The host cell of claim 12, which is a mouse cell.
14. The host cell of claim 12, which is a human cell.
15. A method for increasing metabolic activity in an animal, which method comprises administering to the animal the composition of claim 10, whereby the two or more nucleic acids sequences are expressed in the animal and metabolic activity is increased.
16. The method of claim 15, wherein increasing the metabolic activity in the animal comprises: (a) reducing blood glucose levels, (b) reducing blood insulin levels, (c) reducing blood lipid concentrations, (d) reducing whole body adiposity, (e) increasing fat metabolism, (f) increasing energy metabolism, (g) reducing body weight, (h) increasing satiety, (i) reducing food intake, (j) increasing browning of white adipocytes, or (k) any combination of (a)-(j).
17. The method of claim 15, wherein the composition is administered to the animal orally or by intraperitoneal injection.
18. The method of claim 15, wherein the animal is a mammal.
19. The method of claim 18, wherein the mammal is a mouse.
20. The method of claim 18, wherein the mammal is a human.
21. The method of claim 15, wherein expression of the two or more nucleic acid sequences in the animal synergistically increases the metabolic activity in the animal as compared to expression of each nucleic acid sequence alone.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
DETAILED DESCRIPTION OF THE INVENTION
[0022] 1. Definitions
[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0024] For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0025] As used herein, the term adipocytes refers to cells primarily comprised of adipose tissue, specializing in storing energy as fat. There are two types of adipose tissue, white adipose tissue (WAT) (or white fat) and brown adipose tissue (BAT) (also known as beige adipocytes, brown in white (BRITE) cells, and brown fat).
[0026] Complement or complementary as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.
[0027] Identical or identity as used herein in the context of two or more nucleic acids or polypeptide sequences means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.
[0028] Inhibit as used herein refers to the ability to substantially antagonize, prohibit, prevent, restrain, slow, disrupt, alter, eliminate, stop, or reverse the progression or severity of the activity of a particular agent, disease, or biological process.
[0029] Nucleic acid or oligonucleotide or polynucleotide as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.
[0030] Nucleic acids can be single stranded or double stranded, or can contain portions of both double stranded and single stranded sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.
[0031] Operably linked as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter can be positioned 5 (upstream) or 3 (downstream) of a gene under its control. The distance between the promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance can be accommodated without loss of promoter function.
[0032] A peptide, protein, or polypeptide as used herein can mean a linked sequence of amino acids and can be natural, synthetic, or a modification or combination of natural and synthetic.
[0033] Stringent hybridization conditions as used herein means conditions under which a first nucleic acid sequence (e.g., probe) will hybridize to a second nucleic acid sequence (e.g., target), such as in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions can be selected to be about 5 10 C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm can be the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions can be those in which the salt concentration is less than about 1.0 M sodium ion, such as about 0.01-1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., about 10-50 nucleotides) and at least about 60 C. for long probes (e.g., greater than about 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least 2 to 10 times background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5SSC, and 1% SDS, incubating at 42 C., or, 5SSC, 1% SDS, incubating at 65 C., with wash in 0.2SSC, and 0.1% SDS at 65 C.
[0034] Subject as used herein can mean a mammal that wants to or is in need of being immunized with the herein described vaccines. The mammal can be a dog, human, chimpanzee, cat, horse, cow, mouse, or rat.
[0035] As used herein, the terms treatment, treating, and the like refer to obtaining a desired pharmacologic and/or physiologic effect. Preferably, the effect is therapeutic, i.e., the effect partially or completely cures a disease and/or adverse symptom attributable to the disease. To this end, the inventive method comprises administering a therapeutically effective amount of a composition. A therapeutically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. The therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the composition to elicit a desired response in the individual. Alternatively, the pharmacologic and/or physiologic effect may be prophylactic, i.e., the effect completely or partially prevents a disease or symptom thereof. In this respect, the inventive method comprises administering a prophylactically effective amount of a composition. A prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result (e.g., prevention of disease onset).
[0036] Variant used herein with respect to a nucleic acid means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequences substantially identical thereto.
[0037] Variant with respect to a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity. Variant can also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid, i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art (see, e.g., Kyte et al., J. Mol. Biol., 157: 105-132 (1982)). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of 2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity (see, e.g., U.S. Pat. No. 4,554,101). Substitution of amino acids having similar hydrophilicity values can result in peptides retaining biological activity, for example immunogenicity, as is understood in the art. Substitutions can be performed with amino acids having hydrophilicity values within 2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties.
[0038] A variant may be a nucleic acid sequence that is substantially identical over the full length of the full gene sequence or a fragment thereof. The nucleic acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the gene sequence or a fragment thereof. A variant may be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof. The amino acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino acid sequence or a fragment thereof.
[0039] Vector as used herein means a nucleic acid sequence containing an origin of replication. A vector can be a viral vector, bacteriophage, bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC). A vector can be a DNA or RNA vector. A vector can be a self-replicating extrachromosomal vector, and preferably, is a DNA plasmid. The vector can contain or include one or more heterologous nucleic acid sequences.
[0040] The terms thermogenic program, thermogenesis, browning, and brown fat development, as used herein, refer to the biological conversion of white adipocytes into beige or brown adipocytes in response to various stimuli, such as, exercise and caloric restriction (Mattson, Ageing Res. Rev. 9(1): 69 (2010)). The genes PRDM16 (PR domain containing 16), PPAR (peroxisome proliferator-activated receptor ), and PGC-1 (peroxisome proliferator-activated receptor coactivator 1) have been shown to be key genes in the regulation of inducible brown fat (Lo et. al., Biosci Reports, 33(5): e00065 (2013)). [0041] 2. Obesity and Associated Pathways
[0042] The World Health Organization (WHO) defines obesity as the accumulation of excessive fat that may be detrimental to an individual's health. Although obesity is preventable, more than 1.9 billion adults aged 18 and over were obese (see World Health Organization, Fact sheet 311, January 2015). In general, obesity is caused by consuming a greater number of calories than the number of calories expended, resulting in an energy imbalance. This imbalance is often multifactorial, involving various environmental and genetic factors. There have been a number of genetic pathways associated with obesity, including, for example, glycolysis, thermogenesis, insulin signaling, and leptin signaling. Monogenic and polygenic forms of obesity have been identified. In addition, obesity is known to be caused by environmental factors that interact with genetic predisposition. Examples of obesity-associated genes include SH2B1, KCTD15, MTCH2, NEGR1, LEP, IAPP, and FNDC5 (Choquet et al., Curr. Genomics, 12(3):169-179 (2011). The invention described herein provides a plasmid comprising two or more genes (e.g., 2, 3, 4, 5 or more genes) involved in biological pathways associated with obesity. [0043] 3. Genes Associated with Obesity
[0044] a. Islet Amyloid Polypeptide (IAPP)
[0045] In one embodiment, the plasmid can comprise a nucleic acid sequence encoding islet amyloid polypeptide (IAPP). IAPP, also referred to in the art as amylin, pramlintide, diabetes-associated peptide, and insulinoma amyloid peptide, is a peptide hormone that is synthesized in the brain and pancreas (See Mietlicki-Baase, Physiol. Behav., Epub ahead of print (2016)). IAPP is known to play a role in energy balance and glycemic regulation, and has been shown to act as a satiation signal. In particular, IAPP has been shown to elicit a thermogenic program and increase energy expenditure in animal models (see, e.g., Wielinga et al., Physiol. Behav., 101(1): 45-52 (2010) and Contreras et al., Ann. Med., 47: 150-168 (2015)). The U.S. Food and Drug Administration (FDA) has approved use of an IAPP analog for the treatment of diabetes mellitus, due to the role of IAPP in improving glucose levels by suppressing gastric emptying and glucagon secretion in animal models and humans (see, e.g., Thompson et al., Diabetes, 46: 632-36 (1997), Young et al., Nutrition, 14: 524-27 (1998), and Mietlicki-Baase, Physiol. Behav., Epub ahead of print (2016)). In addition, IAPP inhibits food intake, which contributes to weight loss (see Rushing et al., Endocrinology, 141: 850-53 (2000) and Kong et al., Diabetologia, 40: 82-88 (1997)).
[0046] The IAPP polypeptide contains 37 amino acid residues, and is derived from the proteolytic processing of an 89 amino acid precursor. Genes encoding IAPP are found in a variety of mammalian species, such as humans, felines, and rodents, and several IAPP amino acid sequences have been deposited in the GenBank database (see, e.g. GenBank Accession NOs: X56030.1, X13859.1, 557804.1, 557802.1, NM_012586.2, NM_000415.2, NM_001003233.2, and NM_010491.2). The nucleic acid sequence encoding IAPP can comprise any IAPP-encoding nucleic acid sequence known in the art, such as those described above. In one embodiment, the nucleic acid sequence encoding IAPP comprises SEQ ID NO: 1, which encodes the amino acid sequence of SEQ ID NO: 2. In another embodiment, the nucleic acid sequence encodes an IAPP protein comprising the amino acid sequence of SEQ ID NO: 3.
[0047] Alternatively, the nucleic acid sequence encoding IAPP comprises a nucleic acid sequence that is desirably at least about 70% identical (e.g., at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 79% identical) to SEQ ID NO: 1, preferably at least about 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89% identical) to SEQ ID NO: 1, and more preferably at least about 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 1.
[0048] Nucleic acid or amino acid sequence identity, as described herein, can be determined by comparing a nucleic acid or amino acid sequence of interest to a reference nucleic acid or amino acid sequence. The percent identity is the number of nucleotides or amino acid residues that are the same (i.e., that are identical) as between the sequence of interest and the reference sequence divided by the length of the longest sequence (i.e., the length of either the sequence of interest or the reference sequence, whichever is longer). A number of mathematical algorithms for obtaining the optimal alignment and calculating identity between two or more sequences are known and incorporated into a number of available software programs. Examples of such programs include CLUSTAL-W, T-Coffee, and ALIGN (for alignment of nucleic acid and amino acid sequences), BLAST programs (e.g., BLAST 2.1, BL2SEQ, and later versions thereof) and FASTA programs (e.g., FASTA3x, FAS, and SSEARCH) (for sequence alignment and sequence similarity searches). Sequence alignment algorithms also are disclosed in, for example, Altschul et al., J. Molecular Biol., 215(3): 403-410 (1990), Beigert et al., Proc. Natl. Acad. Sci. USA, 106(10): 3770-3775 (2009), Durbin et al., eds., Biological Sequence Analysis: Probalistic Models of Proteins and Nucleic Acids, Cambridge University Press, Cambridge, UK (2009), Soding, Bioinformatics, 21(7): 951-960 (2005), Altschul et al., Nucleic Acids Res., 25(17): 3389-3402 (1997), and Gusfield, Algorithms on Strings, Trees and Sequences, Cambridge University Press, Cambridge UK (1997)).
[0049] In another embodiment, the nucleic acid sequence can encode a fragment of IAPP. The nucleic acid sequence can encode an IAPP fragment of any suitable size, so long as the IAPP fragment retains the biological activity of the full-length IAPP polypeptide (e.g., inducing a thermogenic response, increasing energy expenditure, improving glycemic control, reducing food intake, and slowing of gastric emptying in a mammal). For example the nucleic acid sequence can be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO: 1. In another embodiment, the nucleic acid sequence can encode a variant (as defined above) of the IAPP gene.
[0050] b. Leptin (LEP)
[0051] In another embodiment, the plasmid can comprise a nucleic acid sequence encoding leptin (LEP). LEP, also referred to in the art as obesity factor, metreleptin, and obese protein, is a hormone produced by white adipocytes (see Trayhurn et al., Proc. Nutr. Soc. 60(3): 329-39 (2001)). LEP is known to play a role in regulation of body weight, regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, wound healing, and the development of diabetes mellitus II. In particular, LEP functions as part of a signaling pathway that can inhibit food intake and regulate energy expenditure to maintain constancy of the adipose mass (see GeneCards Human Gene Database, Weizmann Institute of Science, ID NO: GC07P128241).
[0052] The LEP peptide consists of 167 amino acid residues. Genes encoding LEP are found in a variety of mammalian species, such as humans, felines, and rodents, and several LEP amino acid sequences have been deposited in the GenBank database (see, e.g., GenBank Accession NOs: NM_000230.2, NM_001003070.1, NM_173928.2, NM_013076.3, AB041360.1, NM_008493.3, NM_213840.1, and NM_001290901.1). The nucleic acid sequence encoding LEP can comprise any LEP-encoding nucleic acid sequence known in the art, such as those described above. In one embodiment, the nucleic acid sequence encoding LEP comprises SEQ ID NO: 4, which encodes the amino acid sequence of SEQ ID NO: 5. In another embodiment, the nucleic acid sequence encodes a LEP protein comprising the amino acid sequence of SEQ ID NO: 6.
[0053] Alternatively, the nucleic acid sequence encoding LEP comprises a nucleic acid sequence that is desirably at least about 70% identical (e.g., at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 79% identical) to SEQ ID NO: 4, preferably at least about 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89% identical) to SEQ ID NO: 4, and more preferably at least about 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 4, as determined using any suitable method described herein or known in the art.
[0054] In another embodiment, the nucleic acid sequence can encode a fragment of LEP. The nucleic acid sequence can encode an LEP fragment of any suitable size, so long as the LEP fragment retains the biological activity of the full-length LEP polypeptide (e.g., regulation of body weight, regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, and wound healing. For example the nucleic acid sequence can be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO: 4. In another embodiment, the nucleic acid sequence can encode a variant (as defined above) of the leptin gene.
[0055] c. FNDC5
[0056] In another embodiment, the plasmid can comprise a nucleic acid sequence encoding fibronectin type III containing 5 (FNDC5). FNDC5, also referred to in the art as irisin, fibronectin type III repeat-containing domain, and FRCP2, is produced by muscle cells during and after exercise in humans and animal models. FNDC5 is subsequently cleaved, generating the peptide hormone irisin (see, e.g., Bostrom et al., Nature, 481(7382): 463-468 (2012) and GeneCards ID NO: GC01M032830). It is thought that FNDC5 plays a role in the browning of white adipocytes in animal models and humans, a process which contributes to weight loss (see, e.g., Pyrzak et al., Adv. Exp. Med. Biol., 866: 25-34 (2015), Wu et al., J. Biol. Chem. 5,289(49): 34129-40 (2014), and Daskalopoulou et al., Eur. J. Endocrinol. 171(3): 343-52 (2014).
[0057] The FNDC5 peptide contains of 212 amino acid residues. Genes encoding FNDC5 are found in a variety of mammalian species, such as humans, felines, and rodents, and several FNDC amino acid sequences have been deposited in the GenBank database (see, e.g. GenBank Accession NOs: NM_001270981.1, NM_027402.3, NM_153756.2, NM_001171940.1, NM_001171941.2, and NM_001105421.1). The nucleic acid sequence encoding FNDC5 can comprise any FNDC5-encoding nucleic acid sequence known in the art, such as those described above. In one embodiment, the nucleic acid sequence encoding FNDC5 comprises SEQ ID NO: 7, which encodes the amino acid sequence of SEQ ID NO: 8. In another embodiment, the nucleic acid sequence encodes an FNDC5 protein comprising the amino acid sequence of SEQ ID NO: 9.
[0058] Alternatively, the nucleic acid sequence encoding FNDC5 comprises a nucleic acid sequence that is desirably at least about 70% identical (e.g., at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 79% identical) to SEQ ID NO: 7, preferably at least about 80% identical (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, or at least 89% identical) to SEQ ID NO: 7, and more preferably at least about 90% identical (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO: 7, as determined using any suitable method described herein or known in the art.
[0059] In another embodiment, the nucleic acid sequence can encode a fragment of FNDC5. The nucleic acid sequence can encode an FNDC5 fragment of any suitable size, so long as the FNDC5 fragment retains the biological activity of the full-length FNDC5 polypeptide (e.g., browning of white adipocytes). For example the nucleic acid sequence can be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55% at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of SEQ ID NO: 7. In another embodiment, the nucleic acid sequence can encode a variant (as defined above) of the FNDC5 gene. [0060] 4. Plasmid
[0061] The two or more nucleic acid sequences encoding IAPP, LEP, and/or FNDC5 desirably are incorporated into a vector. In one embodiment, the invention provides a plasmid comprising two or more nucleic acid sequences encoding IAPP, LEP, and/or FNDC5. The plasmid described herein can be, or be based on, any suitable plasmid known in the art, a variety of which are available from commercial sources. Examples of suitable plasmids include, but are not limited to pcDNA3 (INVITROGEN), pcDNA 3.1(+) (INVITROGEN), pcDNA3.1() (INVITROGEN), psPAX2, pMD2.G, pX330, pX458, PX459, and PX335.
[0062] The plasmid can comprise two or more of the above-described nucleic acid sequences in any combination. For example, the plasmid can comprise (1) a nucleic acid sequence encoding IAPP and a nucleic acid sequence encoding LEP, (2) a nucleic acid sequence encoding IAPP and a nucleic acid sequence encoding FNDC5, or (3) a nucleic acid sequence encoding LEP and a nucleic acid sequence encoding FNDC5. In another embodiment, the plasmid can comprise three nucleic acid sequences, i.e., a nucleic acid sequence encoding IAPP, a nucleic acid sequence encoding LEP, and a nucleic acid sequence encoding FNDC5. An exemplary plasmid encoding IAPP and LEP comprises the nucleic acid sequence of SEQ ID NO: 10). An exemplary plasmid encoding IAPP and FNDC5 comprises the nucleic acid sequence of SEQ ID NO: 11.
[0063] In addition to the two or more nucleic acid sequences encoding IAPP, LEP, and/or FNDC5, the plasmid preferably comprises expression control sequences, such as promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the coding sequences in a host cell. Exemplary expression control sequences are known in the art and described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).
[0064] A large number of promoters, including constitutive, inducible, and repressible promoters, from a variety of different sources are well known in the art. Representative sources of promoters include for example, virus, mammal, insect, plant, yeast, and bacteria, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available, for example, from depositories such as the ATCC as well as other commercial or individual sources. Non-limiting examples of promoters include a promoter from simian virus 40 (SV40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, an Epstein Barr virus (EBV) promoter, or a Rous sarcoma virus (RSV) promoter. The promoter also can be a mammalian promoter, such as, for example, an actin promoter, a myosin promoter, a hemoglobin promoter, a muscle creatine promoter, or a metallothionein promoter.
[0065] Multiple nucleic acid sequences can be operably linked to the same or different promoters. In one embodiment of the invention, each of the two or more nucleic acid sequences is operably linked to a separate promoter. While it is preferred that each promoter is different, one or ordinary skill in the art will appreciate the advantages of using one particularly efficient promoter to control expression of all of the two or more nucleic acid sequences present in the plasmid. Thus, each of the two or more nucleic acid sequences can be operably linked to the same promoter. In another embodiment, each of the two or more nucleic acid sequences are operably linked to a different promoter. The selection of an appropriate promoter for a given nucleic acid sequence will depend upon a number of factors, including promoter strength, and can be performed using routine methods known in the art.
[0066] The plasmid also can comprise a polyadenylation signal, which can be located downstream of the two more nucleic acid sequences. The polyadenylation signal can be any suitable polyadenylation signal, including, for example, a SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone (bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or human -globin polyadenylation signal. The SV40 polyadenylation signal can be a polyadenylation signal from a pCEP4 vector (Invitrogen, San Diego, Calif.).
[0067] The plasmid also can comprise an enhancer. The term enhancer as used herein, refers to a DNA sequence that increases transcription of, for example, a nucleic acid sequence to which it is operably linked. Enhancers can be located many kilobases away from the coding region of the nucleic acid sequence and can mediate the binding of regulatory factors, patterns of DNA methylation, or changes in DNA structure. The enhancer can be isolated or derived from any suitable mammalian gene, such as, for example actin, myosin, hemoglobin, muscle creatine, or virus, such as, for example, CMV, HA, RSV or EBV. Enhancers are further described in, for example, U.S. Pat. Nos. 5,593,972 and 5,962,428, and International Patent Application Publication WO 94/016737.
[0068] The plasmid can comprise additional elements to optimize expression and production of multiple proteins from a single vector. In one embodiment, the plasmid can comprise a nucleic acid sequence encoding a self-processing peptide, also referred to as a self-cleaving peptide, which allows multiple proteins to be encoded as a polyprotein, which dissociates into component proteins upon translation (see, e.g., Radcliffe et al., Gene Therapy, 11: 1673-1674 (2004)). In one embodiment, the plasmid comprises a nucleic acid sequence encoding a 2A peptide. 2A peptides, first discovered in picornaviruses, are short (about 20 amino acids) and enable a single transcript mRNA encoding multiple genes to express their corresponding peptides simultaneously in similar molar concentrations. Cleavage occurs between the glycine and proline residues found on the C-terminus of the peptide, which typically results in the upstream cistron having a few additional residues added to the end and the downstream cistron beginning with a proline (Kim et al., PLoS One, 6(4): e18556.doi: 10.1371/journal .pone. 0018556 (2011)). Several 2A peptides are known in the art, any of which can be used in the plasmid described herein. In one embodiment, the plasmid comprises a nucleic acid sequence encoding a porcine teschovirus-1 2A (P2A), which has been shown to exhibit the highest cleavage efficiency in mammalian cells among the 2A family.
[0069] In another embodiment, the plasmid comprises a nucleic acid sequence encoding a furin peptide linker gene. The furin peptide is used in the art as a linker to prevent possible adverse effects derived from the residual 2A peptide in 2A-based-gene constructs (18 from the provisional). Furin is an enzyme which belongs to the subtilisin-like proprotein convertase family, which includes proprotein convertases that process latent precursor proteins into their biologically active products. Furin is a calcium-dependent serine endoprotease highly expressed in the Golgi apparatus, where it functions to cleave other proteins into their mature/active forms. Furin cleaves proteins just downstream of a basic amino acid target sequence (canonically, Arg-X-(Arg/Lys)-Arg) (see, e.g., Lin et al., Blood Cells, 40(1):122-31 (2008), Kuninger, BMC Biochemistry, 9: 9 (2008), Thomas, Nature Reviews Molecular Cell Biology, 3(10): 753-66 (2002), and Shiryaev et al., The Journal of Biological Chemistry, 282(29): 20847-53 (2007)). [0070] 6. Non-Viral Carriers
[0071] It will be appreciated that DNA vectors, such as plasmids, are often immunogenic in vivo, and can be degraded by nucleases in serum, limiting their use as effective gene delivery systems in vivo. Accordingly, the plasmid described herein can be conjugated to a carrier to reduce potential toxicity and immunogenicity in vivo. Ideally, the carrier is a non-viral carrier, as several limitations have been associated with viral vector delivery of plasmids, including immunogenicity, broad tropism, difficulty of vector production, limited DNA packaging capacity, and carcinogenesis (Yin et al., Nature Reviews Genetics, 15: 541-555 (2014)).
[0072] The plasmid can be conjugated to any suitable non-viral carrier that can efficiently deliver plasmids to cells in vitro and/or in vivo, several of which are known in the art. In one embodiment, the non-viral carrier can be a polymeric cation. Examples of suitable polymeric cations include, but are not limited to, branched polyethylenimine (PEI), linear polyethylenimine OPED, reducible polyethyleneimine, poly(l lysine), poly[(2 dimethylamino)ethyl methacrylate], poly( amino ester)s, chitosan, polyamidoamine dendrimer, poly[a-(4-aminobutyl)-L-glycolic acid], and PEG grafted polycations such as PEI-g-PEG. In another embodiment, the non-viral carrier can be a small molecule cation. Examples of suitable small molecule cations include, but are not limited to, DOTMA: N[1-(2,3-dioleyloxy) propyl]-N,N,N-trimethylammonium chloride, DOTAP: 1,2-dioleyl-3-trimethylamonium-propane, DMRIE: N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy-1-propananium bromide), DOTIM: 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride, DOGS: dioctadecylamidoglycylspermine, DC-Chol: [N-(N,N-dimethylaminoethane)-carbamoyl]cholesterol, BGTC: bis-guanidium-tren-cholesterol, DOPE: 1,2-dioleyl-sn-glycerol-3-phosphoethanolamine, and calcium phosphate.
[0073] The plasmid can be conjugated to the non-viral carrier using any suitable method known in the art, such as those described in, e.g., Luten et al., J. Controlled Release, 126(2): 97-110 (2008); Kawakami et al., J. Pharm. Sci., 97(2): 726-745 (2008); Katsuri et al., Biomaterials, 26(32): 6375-6385 (2005). [0074] 7. Compositions
[0075] The invention provides a composition comprising the above-described plasmid and a pharmaceutically acceptable carrier. The composition desirably is a physiologically acceptable (e.g., pharmaceutically acceptable) composition, which comprises a carrier, preferably a physiologically (e.g., pharmaceutically) acceptable carrier. Any suitable carrier can be used within the context of the invention, and such carriers are well known in the art. The choice of carrier will be determined, in part, by the particular use of the composition (e.g., administration to an animal) and the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of the composition of the present invention. The previously described formulations and methods are merely exemplary and are in no way limiting. However, oral and injectable formulations are preferred. The pharmaceutical composition optionally can be sterile.
[0076] Formulations suitable for oral administration can comprise (a) liquid solutions, such as an effective amount of the active ingredient (i.e., a plasmid encoding IAPP, LEP, and/or FNDC5) dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as solids or granules; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible excipients. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients as are known in the art.
[0077] Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The formulations can be presented in unit-dose or multi- dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. [0078] 8. Cells
[0079] The invention also provides a host cell comprising the above-described composition. The cell may be in vitro or in vivo, depending on the application. Preferred in vitro cells are those that can be easily and reliably grown, have reasonably fast growth rates, have well characterized expression systems, and can be transformed or transfected easily. The host cell can be a prokaryotic cell or a eukaryotic cell. Examples of suitable prokaryotic cells include, but are not limited to, cells from the genera Bacillus (such as Bacillus subtilis and Bacillus brevis), Escherichia (such as E. coli), Pseudomonas, Streptomyces, Salmonella, and Erwinia. Preferably, the plasmid is introduced into a eukaryotic cell. Suitable eukaryotic cells are known in the art and include, for example, yeast cells, insect cells, and mammalian cells. In one embodiment, the host cell is a mammalian cell. A number of suitable mammalian host cells are known in the art and many are available from the American Type Tissue Collection (ATCC, Manassas, Va.). Examples of suitable mammalian cells include, but are not limited to Chinese hamster ovary cells (CHO) (ATCC No. CCL61), human embryonic kidney 293 cells (HEK-293) (ATCC No. CRL1573), 3T3 cells (ATCC No. CRL92), and COS-1 cells (ATCC No. CRL1650), and COS-7 cells (ATCC No. CRL1651). Further exemplary mammalian host cells include primate cell lines, rodent cell lines, and human cell lines, including transformed cell lines. Normal diploid cells, cells derived from in vitro culture of primary tissue, as well as primary explants are also suitable. Other suitable mammalian cell lines are known in the art and are readily available from depositories such as the ATCC as well as other commercial or individual sources.
[0080] Most preferably, the mammalian cell is a human cell. Examples of suitable human cells include, but are not limited to, human embryonic kidney 293 cells (HEK-293) (ATCC CRL-1573), HeLa cells (ATCC CCL-2), Jurkat cells (ATCC TIB-152), MCF-7 cells (ATCC HTB-22), NIH-3T3 cells (ATCC CRL-1658), and HT-29 cells (SIGMA ALDRICH 91072201).
[0081] Other suitable human cell lines are known in the art and are readily available from depositories such as the ATCC as well as other commercial or individual sources. Methods for selecting suitable mammalian host cells and methods for transformation, culture amplification, screening, and purification of cells are known in the art. [0082] 9. Method for Increasing Metabolic Activity
[0083] The invention further provides a method for increasing metabolic activity in an animal. The method comprises administering to an animal in need thereof the above-described composition, whereby the two or more nucleic acids sequences are expressed in the animal and metabolic activity is increased.
[0084] The terms metabolic activity and metabolism, as used herein, refer to a set of chemical transformations that are necessary for maintaining life in any organism. Metabolic activity involves the transformation of energy and matter in the body. Examples of factors affected by metabolic activity include, but are not limited to blood glucose levels, blood insulin levels, blood lipid concentrations, whole body adiposity, fat metabolism, energy metabolism, body weight, satiety, food intake, and browning of white adipocytes.
[0085] The terms increase, enhance, or improve, as used herein with respect to metabolic activity, refer to the ability to substantially induce, augment, raise, promote, stimulate, speed up, allow, or encourage metabolic activity in an animal. The plasmid of the invention, and the composition comprising same, preferably increases metabolic activity in an animal by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 100% (or a range defined by any two of the foregoing values), as compared to an animal that has not received the composition.
[0086] Metabolic activity can be measured by assessing a variety of parameters, including, for example, blood glucose levels, blood insulin levels, blood lipid concentrations, whole body adiposity, fat metabolism, energy metabolism, body weight, satiety, food intake, and browning of white adipocytes. Thus, in some embodiments, increasing the metabolic activity in the mammal can comprise one or any combination of the following: (a) reducing blood glucose levels in the mammal, (b) reducing blood insulin levels in the mammal, (c) reducing blood lipid concentrations in the mammal, (d) reducing whole body adiposity in the mammal, (d) increasing fat metabolism in the mammal, (e) increasing energy metabolism in the mammal, (f) reducing body weight in the mammal, (g) increasing satiety in the mammal, (h) reducing food intake in the mammal, and/or (i) increasing browning of white adipocytes. It will be appreciated, however, that any aspect of metabolic activity can be increased as a result of the inventive method. Specific methodology for measuring changes in metabolic activity include, but are not limited to (a) measuring calculating body composition via nuclear magnetic resonance, (b) blood chemistry analysis via insulin ELISA kits, free fatty acid test kits, and triglyceride assay kits, (c) measuring glucose levels in blood via glucose test strips, (d) metabolic chamber assays comparing the weight of adipose tissue, (e) tracking food consumption, (f) measuring weight by scale, (g) measuring body fat with a caliper, (h) bioelectric impedance analysis, (i) measuring body circumference, and (j) hydrostatic weighing.
[0087] As used herein, the term blood glucose levels refers to the level of glucose in the bloodstream of a subject. Normal human blood glucose levels range between about 70 to 115 mg/dL after fasting overnight. The term blood insulin levels refers the level of insulin in the blood. Normal human insulin levels typically are less than 17 mcU/mL. The term blood lipid concentrations refers to the level of lipids in the blood, including but not limited to high density lipoprotein (HDL), low density lipoprotein (LDL), and triglycerides. Normal human levels of HDL are typically less than 130 mg/dL. Normal human levels of LDL are typically greater than 35 mg/dL. Normal human levels of triglycerides are typically less than 150 mg/dL. As used herein, the term reducing whole body adiposity means lowering the level of accumulation of lipids in the body. The term increasing fat metabolism means raising the level of oxidation, decomposition, and/or synthesis of fats in tissues. The term increasing energy metabolism means increasing the rate or efficiency of the process of generating energy (ATP) from nutrients. The term reducing body weight means lowering the total weight of an animal as measured in ounces, pounds, grams, or kilograms. The term increasing satiety means raising the feeling or condition of being full. The term reducing food intake refers to lowering the amount of food an animal consumes. As used herein, the term increasing browning of white adipocytes means raising the level of a process where white adipocytes takes on characteristics of brown adipocytes, notably taking on a brown-fat-like gene expression program (e.g., expression of UCP1, Cidea (cell death-inducing DFFA-like effector a) and Dio2 (diodinase 2)), and the presence of multilocular lipid droplets and multiple mitochondria.
[0088] Any route of administration can be used to deliver the composition to the mammal. Indeed, although more than one route can be used to administer the composition, a particular route can provide a more immediate and more effective reaction than another route. Preferably, the composition is administered orally or via intraperitoneal injection. The composition also can be applied or instilled into body cavities, absorbed through the skin (e.g., via a transdermal patch), inhaled, ingested, topically applied to tissue, or administered parenterally via, for instance, intravenous, peritoneal, or intraarterial administration.
[0089] The composition can be administered in or on a device that allows controlled or sustained release, such as a sponge, biocompatible meshwork, mechanical reservoir, or mechanical implant. Implants (see, e.g., U.S. Pat. No. 5,443,505) and devices (see, e.g., U.S. Pat. No. 4,863,457), such as an implantable device, e.g., a mechanical reservoir or an implant or a device comprised of a polymeric composition, are particularly useful for administration of the composition. The composition can be administered in the form of sustained-release formulations (see, e.g., U.S. Pat. No. 5,378,475) comprising, for example, gel foam, hyaluronic acid, gelatin, chondroitin sulfate, a polyphosphoester, such as bis-2-hydroxyethyl-terephthalate BHET), and/or a polylactic-glycolic acid.
[0090] The composition can be administered to any suitable mammal in need thereof. Examples of suitable mammals include, but are not limited to humans, non-human primates, and rodents (e.g. mice or rats). In a preferred embodiment, the composition is administered to an obese mammal. In general, obesity is characterized as an excess of adipose tissue. A mammal, particularly a human, is considered obese or overweight when the mammal's weight is greater than what is considered healthy for a given height. In humans, obesity typically is determined by measuring body mass index (BMI). BMI is calculated as the weight in kilograms of an individual divided by the square of the individual's height in meters. According to the U.S. Centers for Disease Control and Prevention (CDC), a BMI between 25.0 and 29.9 falls within the overweight range, and a BMI higher than 30.0 falls within the obese range. Obesity often gives rise to obesity-related conditions including, but not limited to, non-alcoholic fatty liver disease, type II diabetes, sleep apnea, high blood pressure, heart disease, stroke, cancer, gallbladder disease infertility, irregular periods, erectile dysfunction, and osteoarthritis.
[0091] The method described herein can be used to increase the metabolic activity of any suitable mammal in need thereof. Preferably, the mammal is a human. Obesity in humans can be measured using routine method known in the art, such as, for example, measuring BMI, measuring waist circumference, skinfold thickness measurements, bioelectrical impedance, densitometry (underwater weighing), air-displacement plethysmography, dual energy x-ray absorptiometry (DXA), densitometry, hydrometry, computerized tomography, magnetic resonance imaging, and the like. In some embodiments, the mammal is a human having a BMI between 25.0 and 29.9 (i.e., overweight according to the aforementioned CDC guidelines). In some embodiments, the mammal is a human having a BMI of 30.0 or higher (i.e., obese according to the aforementioned CDC guidelines). In other embodiments, the mammal is a human male having a waist circumference greater than 40 inches or a human female having a waist circumference greater than 35 inches.
[0092] In another embodiment, the mammal can be non-human animal model of obesity. Examples of animal models of obesity include, but are not limited to, diet induced obesity (DIO), in which the animal is fed a diet of approximately 60% fat (kcal), lethal yellow mutant mouse, ob/ob mouse, db/db mouse, New Zealand obese mouse, Tsumara Suzuki Obese Diabetes mouse, M16 mouse, kuo kondo mouse, Zucker fatty rat, Wistar fatty rat, and Otsuka long evans tokushima fatty (Kanasaki et al., Journal of Biomedicine and Biotechnology, 2011: 197636 (2011)). In some embodiments, the animal is fed a high fat diet.
[0093] In one embodiment, the effect induced by expression of the two or more genes is synergistic as compared to the effect of expression of each gene alone. As used herein, the term synergistic means that the effect achieved with the plasmid comprising two or more nucleic acid sequences described herein is greater than the sum of the effects that result from a plasmid comprising each of the two or more nucleic acid sequences individually. Advantageously, such synergy between the two or more nucleic acid sequences allows for the use of smaller doses of the plasmid. In some embodiments, the combination of IAPP and LEP has a synergistic effect. In some embodiments, the combination of IAPP and FNDC5 has a synergistic effect. In some embodiments, the combination of IAPP, FNDC5, and LEP has a synergistic effect.
[0094] The composition described herein may be administered alone or in combination with other conventional anti-obesity therapies. Other anti-obesity therapies include, but are not limited to, exercise programs, lowering caloric intake, behavioral modification, weight-loss surgery, prescription weight-loss medications, prescription behavioral modification medications, and commercially-available weight loss programs.
[0095] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.
EXAMPLE 1
[0096] This example describes the construction of a plasmid comprising a nucleic acid sequence encoding islet amyloid polypeptide (IAPP) and either a nucleic acid sequence encoding leptin (LEP) or a nucleic acid sequence encoding fibronectin type III domain containing 5 (FNDC5).
[0097] Three plasmids referred to as pcDNA3-IAPP, pcDNA3-LEP, and pcDNA3-FP2A-IAPP-LEP were constructed with mouse-originated IAPP and LEP genes. For the bicistronic plasmid pcDNA3-FP2A-IAPP-LEP, the IAPP and LEP genes and nucleic acid sequences encoding furin and P2A (FP2A) were assembled by IN-FUSION reaction (Huh, h. et al., Biologicals, 35: 165-171). A schematic of the bicistronic pcDNA3-FP2A-IAPP-LEP plasmid is depicted in
TABLE-US-00001 TABLE1 TargetORF (Final plasmid) Forwardprimer Reverseprimer IAPP GTACCGAGCTCGGAT AGGCCCGGGGTTTTCTTCAA (pcDNA3- CCAGACATGATGTGC CATCTCCTGCTTGCTTTAACA FP2A-IAPP- ATCTCCAAACTGCCA GAGAGAAGTTCGTGGCTCCG LEP) G GATCCCCTTTTTGCGCGAAC (SEQIDNO:12) GAGTAAGAAATCCAAGGATT CCCT (SEQIDNO:13) LEP GAAGAAAACCCCGGG GGATATCTGCAGAATTCTTA (pcDNA3- CCTATGTGCTGGAGA GCATTCAGGGCTAACATCCA FP2A-IAPP- CCCCTGTGTC ACTGT LEP) (SEQIDNO:14) (SEQIDNO:15) LEP GTACCGAGCTCGGAT CATGCTCGAGCGGCCGCTTA (pcDNA3-LEP) CCAGAAATGTGCTGG GCATTCAGGGCTAACATCCA AGACCCCTGTGTC ACTGT (SEQIDNO:16) (SEQIDNO:17)
[0098] Additionally, short pieces of P2A, furin, restriction enzyme sites, and a translation initiation site (Kozak sequence) were added to the primer sequences. PCR amplification was performed with the primers and mouse-originated IAPP and LEP cDNA using CLONEAMP HiFi Premix (Clontech, Mountain View, Calif.). After pcDNA3 was digested by BamHI and EcoRI, the PCR amplicons were ligated into the linearized pcDNA3 by IN-FUSION HD Enzyme Premix (Clontech Mountain View, Calif.). The reaction mixture was then transformed into STELLAR Competent Cells (Clontech, Mountain View, Calif.), followed by ampicillin-containing LB agar plate colony identification. For pcDNA3-LEP construction, the procedure was similar to pcDNA3-FP2A-IAPP-LEP preparation using IN-FUSION reaction. Following pcDNA3 digestion by BamHI and NotI, the PCR product containing the LEP open reading frame (ORF) was sub-cloned into pcDNA3. pcDNA3-IAPP was produced by simple double enzyme digestion of the IAPP gene with EcoRl and NotI from an IAPP ORF-associated cDNA plasmid, followed by the insertion of the gene into linearized pcDNA3. The gene sequence of pcDNA3-FP2A-IAPP-LEP was confirmed by Sanger DNA sequencing for authenticity as SEQ ID NO: 10.
[0099] Plasmids referred to as pcDNA3-FNDC5 and pcDNA3-FP2A-IAPP-FNDC5 were prepared using mouse-originated IAPP and FNDC5 ORFs. To construct the bicistronic plasmid pcDNA3-FP2A-IAPP-FNDC5, the FNDC5 gene was obtained from pCR-blunt-TOPO-FNDC5 by double enzyme cut with BamHI and NotI, and ligated into pcDNA3, producing pcDNA3-FNDC5 (i.e., mono-cistronic pcDNA3-FNDC5). A schematic of the bicistronic plasmid is depicted in
TABLE-US-00002 TABLE2 Forward AGGGAGACCCAAGCTTAGAAA primer TGATGTGCATCTCCAAACTGCCAG (SEQIDNO:18) Reverse CGTTACTAGTGGATCCAGGCCCGGGGTTTTCTTCAACATC primer TCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCTCCGGAT CCCCTTTTTGCGCGAACGAGTAAGAAATCCAAGGATTCCC T(SEQIDNO:19)
[0100] PCR was performed with the primers and IAPP cDNA plasmid, followed by the ligation of the PCR amplicon with linearized pcDNA3-FNDC5 using IN-FUSION reaction to complete pcDNA3-FP2A-IAPP-FNDC5 preparation (Zhu, B. et al., Biotechniques, 43: 354-359 (2007)). The plasmid pcDNA3-IAPP was generated as discussed above.
[0101] The gene sequence of pcDNA3-FP2A-IAPP-FNDC was confirmed by Sanger DNA sequencing for authenticity as SEQ ID NO: 11. Verification of plasmid construction was confirmed by a DNA sequencing assay.
[0102] pcDNA3-IAPP, pcDNA3-FNDC5, and pcDNA3-FP2A-IAPP-FNDC5 exhibited a correctly sized DNA product, and pcDNA3-FP2A-IAPP-FNDC5 exhibited a single transcript (
[0103] The results of this example confirm the construction of plasmids encoding IAPP and LEP or IAPP and FNDC5 in accordance with the invention.
EXAMPLE 2
[0104] This example describes expression of the genes IAPP, LEP, and FNDC5 from plasmids generated in accordance with the invention.
[0105] The presence and size of the insert of each of the plasmids described above was confirmed by restriction enzyme digestion and agarose gel electrophoresis, as shown in
[0106] Expression of the IAPP, LEP, and FNDC5 genes from each of the plasmids described in Example 1 was evaluated in HEK293T cells. Specifically, each plasmid was transduced by XFECT Transfection Reagent (Clontech, Mountain View, Calif.) into HEK293T cells (ATCC, Manassas, Va., USA) according to the manufacturer's protocol. HEK293T cells were cultured in DMEM (ATCC, Manassas, Va., USA), supplemented with 10% fetal bovine serum in 5% CO.sub.2 humidified atmosphere at 37 C. Briefly, HEK293T cells were cultured in a six-well plate at an initial density of 510.sup.5 per well for one day. 5 g of pDNA complexed with 1.5 l of XFECT was then added to the cells, followed by an additional two-day incubation. Cells were then harvested and centrifuged to obtain a cell pellet. Total RNA was extracted from the pellet using RNeasy Mini Kit (Qiagen, Valencia, Calif., USA). The first strand cDNA was synthesized from the RNA sample using M-MuLV Enzyme Mix and M-MuLV Reaction Mix (New England Biolabs). Subsequently, reverse transcriptase-polymerase chain reaction (RT-PCR) was completed with ONETAQ RT-PCR Kit (New England Biolabs) and pcDNA3-complementary T7 and SP6 primers (obtained from the University of Utah Core Facility). Each RT-PCR product was analyzed by agarose gel electrophoresis.
[0107] To examine linear polyethylenimine (IPEI) as a non-viral gene delivery carrier, 1PEI-pDNA polyplex nanoparticles were formed in HEPES buffer (20 mM) at N:P ratio of 5. The procedure with respect to the 1PEI-pDNA polyplex addition for IAPP and LEP identification was the same as described above for XFECT-pDNA complex transfection. In particular, the media from the no treatment cell group were used as a blank for EIA and ELISA. Following complexing pDNA with 1PEI to generate a compacted polyplex, the polyplex presented as a nano-sized (approximately 100 nm) and positively charged complex (Table 3 and Table 4).
TABLE-US-00003 TABLE 3 Particle size Polydispersity Zeta potential pDNA (nm) Index (PDI) (mV) pcDNA3 94.6 0.9 0.135 0.017 28.5 1.0 pcDNA3-IAPP 107.1 1.6 0.179 0.031 27.7 1.6 pcDNA3-LEP 99.9 1.7 0.165 0.013 29.2 1.4 pcDNA3-FP2A- 103.6 1.4 0.146 0.026 28.2 1.3 IAPP-LEP
TABLE-US-00004 TABLE 4 Plasmid Particle size Polydispersity Surface charge (with lPEI) (nm) Index (PDI) (mV) pcDNA3 95.9 0.8 0.156 0.027 26.2 1.1 pcDNA3-IAPP 104.2 2.5 0.189 0.014 28.6 0.6 pcDNA3-FNDC5 91.6 1.9 0.171 0.022 27.2 0.8 pcDNA3-FP2A- 92.2 1.5 0.165 0.020 25.8 1.9 IAPP-FNDC5
[0108] To evaluate protein expression from each of the plasmids, each plasmid was initially complexed with the in vitro gene carrier, XFECT, and transfected into HEK293T cells initially. The concentrations of IAPP, LEP, and FNDC secreted into the culture medium were then measured. All of the plasmids expressed and secreted the proteins encoded therein (
TABLE-US-00005 TABLE 5 pcDNA3-FP2A-IAPP-LEP IAPP LEP Concentration (ng/mL) 3.53 0.99 13.68 1.58 Molecular weight (kDa) ~4 ~16 Molar concentration (nM) ~0.88 ~0.86 Molar concentration ratio 1 ~0.98
TABLE-US-00006 TABLE 6 pcDNA3-FP2A-IAPP-FNDC5 IAPP Irisin Concentration (ng/mL) 4.10 1.66 12.71 2.32 Molecular weight (kDa) ~4 ~13 Molar concentration (nM) ~1.03 ~0.98 Molar concentration ratio 1 ~0.95
[0109] To confirm that 1PEI could be advanced as a gene carrier for in vivo studies, protein expression from plasmids complexed with 1PEI was compared were compared to expression from the XFECT-pDNA complexes. 1PEI-pDNA polyplexes were transfected into HEK293T cells in the same manner as the commercial gene vehicle. Similar to the results from XFECT gene carrier, the genes delivered by 1PEI were expressed as their secreted form of peptides. In particular, pcDNA3-FP2A-IAPP-LEP expressed both IAPP and LEP peptides in similar molar concentrations (
TABLE-US-00007 TABLE 7 pcDNA3-FP2A-IAPP-LEP IAPP LEP Concentration (ng/mL) 3.92 0.90 15.07 0.36 Molecular weight (kDa) ~4 ~16 Molar concentration (nM) ~0.98 ~0.94 Molar concentration ratio 1 ~0.96
TABLE-US-00008 TABLE 8 pcDNA3-FP2A-IAPP-FNDC5 IAPP Irisin Concentration (ng/mL) 4.20 2.31 13.25 3.26 Molecular weight (kDa) ~4 ~13 Molar concentration (nM) ~1.05 ~1.02 Molar concentration ratio 1 ~0.97
[0110] The results of this example confirm that the plasmids pcDNA3-FP2A-IAPP-LEP and pcDNA3-FP2A-IAPP-FNDC5 express the proteins encoded therein in vitro and that the 1PEI-pDNA polypeptides were suitable for further in vivo applications.
EXAMPLE 3
[0111] This example describes in vivo gene delivery of the pcDNA-FP2A-IAPP-LEP plasmid and resulting changes in body weight and food consumption.
[0112] To determine the most suitable frequency and dose of 1PEI-pDNA polyplexes, the polyplexes were first administered intraperitoneally (i.p.) to lean mice. The 1PEI-pDNA polyplex containing the IAPP gene (IPEI complexed with pcDNA3-IAPP or with pcDNA3-FP2A-IAPP-LEP) and the polyplex containing the LEP gene (IPEI complexed with pcDNA3-LEP or with pcDNA3-FP2A-IAPP-LEP) displayed much higher concentrations in serum of treated mice as compared to untreated mice on day 1 and day 3 post-administrations. However, after one week, protein levels prominently declined. Moreover, weight loss was observed in treated mice, and reached a plateau or began to slightly reverse after one week. Thus, weekly polyplex administrations were chosen for further studies using diet induced obese (DIO) mice. Circulating hormone concentration and weight loss were not found to be significantly different between the 45 g and 60 g doses of plasmid DNA. Therefore, 45 g of pDNA with 1PEI was determined as an optimal dose for subsequent experiments in DIO mice to avoid any potential hepatotoxicity (Kim et al., PLoS One 6: e18556 (2011)) and Zhu et al., Biotechniques, 43: 354-359 (2007)).
[0113] DIO mice were then treated twice (on days 0 and 8) with 1PEI-pcDNA3, pcDNA3-IAPP, pcDNA3-LEP, and bicistronic pcDNA3-FP2A-IAPP-LEP (45 g per plasmid). After treatment, no mice died and there were no modifications in behavior, appearance, or mobility, indicating the safety of the polyplexes. During the treatment, the bicistronic plasmid polyplex exhibited the greatest inhibition of both weight gain and food intake (
[0114] Rothman's synergy index (S) was calculated to determine whether the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex exhibited a synergistic effect on body weight loss in DIO mice. In this index, exactly additive results indicate that there is no synergistic effect of the combination of two therapeutic agents (here, IAPP and LEP). Rothman's synergy index was calculated as follows: [0115] Control odds=the average change in body weight of 1PEI-pcDNA3-treated DIO mice group (%)[(100the average change in body weight of 1PEI-pcDNA3-treated DIO mice group (%))] [0116] Treatment odds=the average change in body weight of 1PEI-pcDNA3-IAPP, -pcDNA3-LEP, or pcDNA3-FP2A-IAPP-LEP-treated DIO mice group (%)[(100the average change in body weight of 1PEI-pcDNA3-IAPP, -pcDNA3-LEP, or -pcDNA3-FP2A-IAPP-LEP-treated DIO mice group (%))] [0117] Odds Ratio=Treatment oddsControl odds [0118] S=(ORIL1)[(ORI+ORL)2] where ORIL indicates the OR of 1PEI-pcDNA3-FP2A-IAPP-LEP-administered DIO mice group, OR means the OR of 1PEI-pcDNA3-IAPP-injected DIO mice group, and ORL is the OR of 1PEI-pcDNA3-LEP-treated DIO mice group
[0119] During the time period of from 1-7 days following the first administration, 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex treatment appeared to produce more than an additive and less than a multiplicative interaction. Furthermore, during the period of from 9-15 days following the second administration, exactly multiplicative synergism was observed (
[0120] The results of this example confirm that in vivo delivery of the pcDNA-FP2A-IAPP-LEP plasmid conjugated to a non-viral carrier exerts a synergistic effect on body weight loss in DIO mice.
EXAMPLE 4
[0121] This example describes the effects of in vivo delivery of 1PEI-pcDNA3-FP2A-IAPP-LEP on circulated hormones and obesity-related metabolic variables in the blood of treated mice.
[0122] To identify physiological changes in DIO mice following the administrations of 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex as described in Example 3, IAPP and LEP protein levels in serum samples were detected using an IAPP EIA kit and a LEP ELISA kit (Phoenix Pharmaceuticals), respectively (
[0123] For blood glucose measurements, about five microliters of blood drawn from the tail vein of 6-hour fasted DIO mice was placed onto a glucose test strip (American Diabetes Wholesale) and glucose levels were measured using a blood glucose meter (Bayer Contour). Before polyplex treatments, the initial blood glucose level of all mice was between 170-220 mg/dL. Treatment with the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex led to significant decreases in blood glucose levels as compared to no treatment, 1PEI-pcDNA3, and 1PEI-pcDNA3-LEP polyplex treatment groups (
[0124] The levels of serum insulin, free fatty acids, and triglycerides were measured by Mouse Insulin ELISA Kit (Crystal Chem), FFA test kit (Roche), and TG assay solutions (Wako Diagnostics, Richmond, Va., USA), respectively. Two weekly injections of the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex resulted in a significant decrease of circulating levels of insulin (
[0125] The results of this example demonstrate that treatment with the 1PEI- pcDNA3-FP2A-IAPP-LEP polyplex decreases the levels of glucose, insulin, and lipid concentrations in mouse blood.
EXAMPLE 5
[0126] This example describes changes in adiposity in DIO mice after treatment with the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex.
[0127] Two representative white adipose tissues (WATs) were prepared, i.e., visceral epididymal white adipose tissue (EpiWAT) and subcutaneous inguinal white adipose tissue (IngWAT), from DIO mice on day 15 after euthanasia. The weight percentage of each adipose type was quantified by the weight of each WAT divided by total body weight100.
[0128] To elucidate the effects of the 1PEI-pcDNA3-FP2A-IAPP-LEPpolyplex treatment on changes in adiposity of DIO mice, mouse size and weight (%) of EpiWAT and IngWAT were analyzed on day 15. Both WATs appeared significantly smaller and lighter in the mice treated with either 1PEI-pcDNA3-IAPP or the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex as compared to other groups (
[0129] The results of this example describe the changes in adiposity in DIO mice after treatment with the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex.
EXAMPLE 6
[0130] This example describes the effects of in vivo delivery of 1PEI-pcDNA3-FP2A-IAPP-LEP on indirect calorimetry in mice.
[0131] The ability of bicistronic plasmid polyplex administrations to increase energy expenditure in DIO mice was evaluated. Following injection of 1PEI-pcDNA3 (control), 1PEI-pcDNA3-IAPP, 1PEI-pcDNA3-LEP, and the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex into DIO mice, oxygen consumption (VO.sub.2), carbon dioxide production (VCO.sub.2), respiratory exchange ratio (RER; VCO.sub.2/VO.sub.2), and heat generation were measured by an indirect calorimetry system (Columbus Instruments) for three days. All the DIO mice in each chamber had free access to high-fat diet (HFD) and water during the assay.
[0132] Metabolic changes induced by the bicistronic plasmid polyplex during the first three days, i.e., the time period in which an active weight loss occurred, were investigated (
[0133] The results of this example demonstrates that in vivo delivery of the 1PEI-pcDNA3-FP2A-IAPP-LEP polyplex increased oxygen consumption (VO.sub.2), carbon dioxide production (VCO.sub.2), RER (VCO.sub.2/VO.sub.2), and heat generation in mice.
EXAMPLE 7
[0134] This example describes in vivo gene delivery of the pcDNA-FP2A-IAPP-FNDC5 plasmid and its effects on browning efficacy in mice.
[0135] DIO mice were intraperitoneally injected twice (on days 0 and 8) with the polyplexes 1PEI-pcDNA3-IAPP,1PEI-pcDNA3-FNDC5, or 1PEI-pcDNA-FP2A-IAPP-FNDC5 body weights were measured daily.
[0136] A significant reduction of food consumption occurred in DIO mice treated with 1PEI-pcDNA3-IAPP and 1PEI-pcDNA3-FP2A-IAPP-FNDC5 (
[0137] DIO mice treated with 1PEI-pcDNA3-FNDC5 appeared hyperphagic, suggesting that body weight reduction by 1PEI-pcDNA3-FNDC5 and 1PEI-pcDNA3-FP2A-IAPP-FNDC5 may primarily result from browning-related energy metabolism rather than reduced food intake.
[0138] In order to better understand the mechanism underlying decreased body weight in DIO mice treated with the FNDC5 gene, a metabolic chamber assay was conducted to measure the energy expenditure, oxygen consumption (a marker of metabolic rate), and physical mobility of the animals treated with pDNAs containing the FNDC5 gene (i.e., 1PEI-pcDNA3-FNDC5 and l-PEI-pcDNA3-FP2A-IAPP-FNDC5). To this end, after the administration of polyplexes, changes related to energy metabolism were detected during the first three days after administration, when active body weight reduction was prominent (
[0139] Treatment with 1PEI-pcDNA3-IAPP polyplex produced a significant increase in oxygen consumption and a small increase in heat production and movement. In addition, the respiratory exchange ratio (RER) was significantly decreased after the therapeutic gene polyplex treatments, indicating that the polyplexes altered energy source selection between carbohydrate and fatty acids. However, the RER did not differ between single and dual browning gene polyplexes, suggesting that the combinatorial gene polyplex's preference for carbohydrate and fatty acid usage as fuel source was similar to the single-gene polyplexes.
[0140] The above data indicate that the 1PEI-pcDNA3-FP2A-IAPP-FNDC5 polyplex was the most effective in elevating energy metabolism via heat generation and physical mobility as compared to the other tested plasmids. Consistent with increased energy metabolism, 1PEI-pcDNA3-FP2A-IAPP-FNDC5-treated DIO mice exhibited significant increased expression of three major browning gene markers: Ppargc1a, Prdm16, and Pparg, at three days after administration (
[0141] The levels of both IAPP and irisin in blood serum from DIO mice was measured (
[0142] The results of this example demonstrate that treatment with the 1PEI-pcDNA3-FP2A-IAPP-FNDC5 polyplex increases energy metabolism and browning in DIO mice.
EXAMPLE 8
[0143] This example describes the effect of 1PEI-pcDNA3-FP2A-IAPP-FNDC5 on local adipose tissues in vivo.
[0144] To determine the changes in total fat and dry lean mass, mice treated with plasmid DNA polyplexes as described in Example 7 were inserted into a rodent nuclear magnetic resonance machine (Bruker) at the following time points: pre-treatment, post-first treatment (7 days), and post-second treatment (15 days). Total adiposity was quantified as described in Example 5. Changes in the percentage of adiposity and dry lean mass were determined by calculating the difference at 7 days (post-first treatment) and at 15 days (post-second treatment) from pre-injection, respectively.
[0145] 1PEI-pcDNA3-FP2A-IAPP-FNDC5-treated mice exhibited a significant decrease in adiposity as measured by rodent NMR assay (
[0146] The changes in EpiWAT and IngWAT in treated mice were evaluated. Total RNA from IngWAT was extracted using the Trizol-based method, and reverse transcribed with High-Capacity RNA-to- cDNA Kit purchased from Invitrogen (Carlsbad, Calif., USA). Ppargc1a (Mm01208835_m1), Prdm16 (Mm00712556_m1), and Pparg (Mm01184322_m1) were measured using Single Tube TAQMAN Gene Expression Assays. Eukaryotic 18S rRNA was used as endogenous control. Quantitative measures were obtained by the DDCT. The volume (
[0147] The results of this example suggest that the delivery of 1PEI-pcDNA3-FP2A-IAPP-FNDC5 can elicit a browning effect, leading to the decline in fat mass.
EXAMPLE 9
[0148] This example describes the effects of 1PEI-pcDNA3-FP2A-IAPP-FNDC5 on metabolic variables in blood.
[0149] The levels of serum insulin, free fatty acids, and triglycerides in DIO mice treated with the plasmid-polyplexes as described in Example 7 were measured using a Mouse Insulin ELISA Kit (Crystal Chem), an FFA test kit (Roche), and TG assay solutions (Wako Diagnostics, Richmond, Va., USA), respectively. For blood glucose measurements, about five microliters of blood drawn from the tail vein of 6 hour-fasted DIO mice was placed onto a glucose test strip (American Diabetes Wholesale) and glucose levels were measured using a blood glucose meter (Bayer Contour). Before polyplex treatments, the initial blood glucose level of all mice was between 170-220 mg/dL.
[0150] Administration of 1PEI-pcDNA3-FP2A-IAPP-FNDC5 resulted in a significant decrease in circulating levels of triglyceride (TG), free fatty acid (FFA), insulin, and glucose (
[0151] The results of this example demonstrate that in vivo delivery of the 1PEI-pcDNA3-FP2A-IAPP-FNDC5 polyplex decreased serum levels of glucose, insulin, free fatty acids, and triglycerides.
[0152] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0153] The use of the terms a and an and the and at least one and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term at least one followed by a list of one or more items (for example, at least one of A and B) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0154] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.