METHODS AND COMPOSITIONS RELATING THE TREATMENT OF TUMORS

20190336577 ยท 2019-11-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Described herein are methods and compositions relating to the treatment of a tumor (e.g., schwannoma) by increasing expression of Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D. In some embodiment, the increased expression is provided by means of a vector or construct comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a Schwann-lineage cell-specific promoter. In some embodiments, the vector is a viral vector.

Claims

1. A method of treating a schwannoma in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a Schwann cell-specific promoter.

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. A method of treating a tumor or neoplasm in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a cell-type specific promoter, neoplasm cell-specific promoter, and/or tumor cell-specific promoter.

8. The method of claim 1, wherein the ASC and/or gasdermin D is a human, mouse, or rat ASC and/or gasdermin D.

9. The method of claim 1, wherein the Schwann cell-specific promoter is a P0, a peripheral myelin protein 22 (PMP22), or a MBP promoter.

10. The method of claim 1, wherein the promoter is a human or murine promoter.

11. The method of claim 1, wherein the subject in need of treatment for a schwannoma, tumor, or neoplasm is a subject having or diagnosed as having a condition selected from the group consisting of: neurofibromatosis 1 (NF1); neurofibromatosis 2 (NF2); schwannomatosis; meningioma; nerve sheath tumor; schwannoma; vestibular schwannoma; sporadic schwannoma; neurofibrosarcoma; neurofibroma; neurofibromatosis (NF); malignant peripheral nerve sheath tumor; and a combination thereof

12. The method of claim 1, wherein the viral vector is a recombinant adeno-associated virus (rAAV).

13. The method of claim 12, wherein the rAAV is of serotype AAV1 or AAV9.

14. (canceled)

15. The method of claim 1, wherein the vector further comprises a polyadenylation signal.

16. (canceled)

17. The method of claim 15, wherein the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.

18. The method of claim 1, wherein the vector further comprises a first AAV inverted terminal repeat (ITR) located upstream of the Schwann cell specific promoter and a second AAV ITR located downstream of the polyadenylation signal.

19. The method of claim 18, wherein the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.

20. The method of claim 1, wherein the vector is a polynucleotide.

21. The method of claim 1, wherein the vector is a single-stranded or double-stranded AAV.

22. The method of claim 1, wherein the vector is a self-complementary AAV (scAAV).

23. The method of claim 1, wherein the vector is a virus particle.

24. The method of claim 1, wherein the vector is administered directly to the tumor or neoplasm or directly to a nerve affected by a schwannoma.

25. (canceled)

26. (canceled)

27. The method of claim 1, wherein administering is intranervously, intracranially, intratumorally, intramuscularly, intravenously, intradermally, or subcutaneously, or a combination thereof.

28. The method of claim 1, wherein the subject is also treated by surgical removal or reduction of the schwannoma, tumor, or neoplasm.

29. (canceled)

30. A viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D gene and a Schwann cell-specific promoter.

31.-46. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG. 1A depicts quantitative RT-PCR analysis demonstrating ASC expression profile in Human HEI-193 schwannoma cell lines, three Schwannoma primary cultures from different patients and two different human Schwann cells cultures. Quantitative PCR data are normalized to 18S gene and presented as the fold increase. More than 10-fold increase was observed in ASC expression in Schwann cells over schwannoma cells. FIG. 1B depicts a methylation assay on ASC performed by methylation specific PCR analysis of bisulfite-modified gDNA. HEI193 and the three primary Schwannomas ASC was fully methylated while the human Schwann cells showed fully unmethylated pattern. (M: Primers for Methylated ASC, U; Primers for Unmethylated ASC).

[0018] FIGS. 2A-2B depict bisulfite sequencing analysis of 19 CpG sites in TMS1 CpG island. Bisulfite converted DNA extracted from cultured human Schwann cells or HEI-193 schwannoma cell line was amplified with primer set indicated by arrows in the human TMS1 genome (FIG. 2A). FIG. 2A discloses SEQ ID NO: 22. The amplification product was sub-cloned and sequenced. Each row represents an individual sub-clone (FIG. 2B). Open circles, unmethylated CpG sites; closed circles, methylated CpGs.

[0019] FIG. 3 depicts ATP-based cell viability (upper three graphs) and Lactate dehydrogenase (LDH) release cytotoxicity (lower three graphs) measured at 24 h after transient transfection of human HEI193 schwannoma, mouse Schwannoma 1 (08031-9) and mouse schwannoma 2 (NF2S1) by pAAV-CBA-hASC, pAAV-CBA-mASC, pAAV-CBA-GFP or nontransfected cells. Graphs show the meanSEM of triplicate wells and are representative of three independent experiments.

[0020] FIG. 4A depicts western blotting of HEI193 cell lysates 24 h after transfection with pAAV-CBA-hASC, pAAV-CBA-GFP or non transfected showed that ASC over-expression was associated with over expression and cleavage of caspase 9, cleavage of caspase 3 and over expression of BID. FIG. 4B depicts graphs of transfected HEI193 assayed for endogenous caspases, demonstrating an increased activity for caspase 3/7 and caspase 9. Data were presented as meansSEM (n=3). *P<0.05 (t-test).

[0021] FIG. 5A demonstrates that pan caspase inhibitor (ZVAD-FMK) and caspase 3 inhibitor (ZDEVD-FMK (DEVD is disclosed as SEQ ID NO: 13)) inhibited the LDH release cytotoxicity in the HEI193 cells which were transfected with pAAV-CBA-hASC. FIG. 5B depicts images of in vitro apoptosis staining of the same cells after transfection with pAAV-CBA-ASC, demonstrating obvious brown stained apoptotic bodies. However, no apoptosis was shown in presence of pan-caspase inhibitor, caspase3 inhibitor, cells transfected with pAAV-CBA-GFP or non transfected cells. Data were presented as meansSEM (n=3). *P<0.05 (t-test).

[0022] FIG. 6A depicts representative bioluminescence images showing growth of schwannoma in sciatic nerve and growth delay of tumors that have been treated with AAV-P0-ASC. Images were taken at week 8 post implantation. FIG. 6B depicts graphs of monitoring of schwannoma volumes in vivo by bioluminescence imaging. Thirty thousand HEI-193FC cells were implanted into the distal sciatic nerve of nude mice and tumor volume was monitored at weekly intervals by in vivo bioluminescence imaging. At the third week after implantation when tumors were established, they were injected with either AAV1-P0-ASC vs. AAV1-P0-null vector (lower left graph) or AAV1-P0-ASC vs. PBS (lower right graph). Data points are shown as mean valuesSEM (n=8 per group for each experiment). Significant difference between AAV-P0-ASC and AAV-P0-null or PBS was observed by ANOVA with repeated measures.

[0023] FIG. 7A depicts microscopic evaluation of AAV1-P0-ASC- and AAV1-P0-Null-injected HEI-193FC schwannomas. Tumors injected with AAV-P0-ASC showed increased rate of intra-tumoral apoptosis (brown stained). Imunohistochemical staining for the proliferation marker expression (ki67) was lower in tumor injected with AAV-P0-ASC when compared to the expression level in the tumors injected with AAV-P0-null. Hematoxylin and eosin (H&E) staining showed abundant, mitotically active hematoxylin-positive tumor cells (darkly staining cells) 8weeks after AAV1-P0-null vector injections into an experimental schwannoma but scant numbers of tumor cells after AAV1-P0-ASC injection. FIG. 7B depicts quantification of apoptotic bodies and Ki67-positive cells showed higher apoptosis rate and less proliferation in the tumors injected with AAV-P0-ASC in comparison to tumors injected with AAV-P0-null. Data were presented as meansSEM (n=3). *P<0.05 (t-test).

[0024] FIG. 8 depicts the effects of AAV1-P0-ASC nerve injection on pain behavior and motor function of implanted sciatic nerve HEI-193FC schwannomas after injection with AAV1-P0-ASC vector or AAV1-P0-null vector at three weeks post implantation. Pain (von Frey method and plantar test) and motor control (rotarod) were evaluated at 3-day intervals for 30 days. AAV1-P0-ASC-mediated tumor growth reduction is correlated with a return of the von Frey threshold and Hargreaves withdrawal latency values to normal baseline. Significant difference between the ASC and null injected groups was observed in reduction of pain behavior as showed by von frey and plantar tests. Results are represented as the meanSEM of n=8 mice per group (*P<0.05, t test).

[0025] FIG. 9 depicts a graph demonstrating that ANOVA indicated a significant effect of AAV-P0-ASC compared to PBS without an interaction by time (following virus/PBS injection). There was no significant effect of AAV-P0-ICE compared with PBS. Abscissatime following tumor implantation. Ordinatebioluminescence signal (measure of tumor burden).

[0026] FIG. 10 depicts a graph demonstrating that ANOVA indicated a significant effect of AAV-P0-ASC compared to AAV-P0-null without an interaction by time (following virus injection). There was no significant effect of AAV-P0-ICE compared with AAV-P0-null. Abscissatime following tumor implantation. Ordinatebioluminescence signal (measure of tumor burden).

[0027] FIG. 11 depicts the level of expression driven by the indicated promoters in a variety of cell types.

[0028] FIG. 12 demonstrates that delivery of gasdmerin D-expressing constructs kills both HEI-193 (human) and 08031-9 (mouse) schwannoma cells.

[0029] FIG. 13 demonstrates expression Of ASC upon injection of AAV1-rP0-hASC into Schwannoma mouse model.

[0030] FIG. 14 depicts a graph of the effect of viral gasdermin-d delivery on growth of intra-sciatic human HEI-193 Schwannoma tumors.

[0031] FIGS. 15A-15G demonstrate that ASC expression is decreased in schwannomas and this correlates to promoter methylation. FIG. 15A depicts representative immunohistochemical staining of human schwannoma specimens and healthy peripheral nerve. There is strong staining for ASC in the healthy nerve (upper panels), while in schwannomas ASC immunoreactivity is either absent (NF2 #1, 2, 3) or substantially less than that in healthy nerve (NF2 # 4, 5, 6). FIG. 15B depicts a graph of quantification of ASC immunostaining demonstrates greater numbers of ASC-positive cellular profiles in the normal nerve compared with schwannoma samples. FIG. 15C depicts a graph of quantitative RT-PCR analysis of ASC expression profile in human schwannomas shows that ASC expression is downregulated in schwannomas with methylated ASC. FIG. 15D depicts a graph of quantitative RT-PCR analysis demonstrates that ASC expression in human Schwann cells, human HEI-193 schwannoma cell line, and human primary schwannoma cells is downregulated in cells with methylated ASC. FIG. 15E demonstrates ASC methylation as determined by methylation specific PCR analysis of bisulfite-modified gDNA which showing complete ASC methylation in the samples with absent ASC staining (NF2 #1, 2, 3), and partial unmethylated pattern in schwannomas with depressed but present ASC protein expression (NF2 # 4, 5, 6). Healthy human nerve shows completely unmethylated ASC. FIG. 15F depicts a methylation assay of ASC in cell lines (HEI-193 and three primary schwannomas lines) which demonstrates that ASC is fully methylated in cultured schwannoma cells but completely unmethylated human Schwann cells. FIG. 15G depicts a correlation chart showing that the downregulated schwannoma ASC protein expression levels are directly related to degree of methylation. (Quantitative PCR data are normalized to 18S gene and presented as fold increase, M: primers for methylated ASC, U; primers for unmethylated ASC.)

[0032] FIGS. 16A-16E demonstrate that ASC overexpression increases cell death in schwannoma cells. FIGS. 16A and 16B depict in vitro apoptotic body staining of HEI-193 (FIG. 16A) and 08031-9 (FIG. 16B) cells after transfection with pAAV-CBA-hASC plasmid shows obvious, brown-stained apoptotic bodies (arrows). Apoptosis was abolished in presence of a pan-caspase inhibitor or caspase-3 inhibitor compared with cells transfected with pAAV-CBA-GFP or exposed only to lipofectamine. Counting of apoptotic bodies revealed a significant increase in apoptosis after overexpression of ASC in transfected cells. FIG. 16C depicts Western blotting of HEI-193 cell lysates 24 h after transfection with pAAV-CBA-hASC plasmid, pAAV-CBA-GFP plasmid, or lipofectamine only treated cells showed that ASC overexpression was associated with cleavage of caspase-9, caspase-3 and increased BID (black arrows point to bands corresponding to the cleaved, active forms of caspases 9 and 3). FIG. 16D demonstrates that quantification of Western blot results demonstrated significant increases in cleaved (active) caspases-9 and -3, and in BID in ASC overexpressing cells compared with control-treated cells. FIG. 16E depicts a colorimetric assay which demonstrated significantly increased caspase-3/7 and caspase-9 activity in ASC over-expressing HEI-193 human schwannoma cells compared with controls. Data are presented as meansSEM (n=3). *p<0.05 (t-test). FIGS. 16A and 16B disclose SEQ ID NO: 13 as DEVD.

[0033] FIGS. 17A-17C demonstrate that AAV1-rP0-hASC in vivo therapy of schwannoma increases markers of apoptosis and reduces markers of cell proliferation. FIG. 17A depicts immunohistochemical staining for the proliferation marker Ki67 was lower in tumors injected with AAV1-rP0-hASC (i) when compared to the expression level in the tumors injected with AAV-rP0-null (ii). Tumors injected with AAV1-rP0-hASC showed an increased rate of intra-tumoral apoptosis (brown stained, iii) while few scant apoptotic bodies were observed in AAV-rP0-null injected tumors (iv). AAV1-rP0-hASC injected tumors showed elevated expression of caspase-3 (v) and caspase-9 (vii) in comparison to AAV1-rP0-null injected tumors (vi, viii). FIG. 17B depicts quantification of Ki67-positive cells and apoptotic bodies and Ki67-positive cells, demonstrating less proliferation and greater apoptosis in the tumors injected with AAV1-rP0-hASC in comparison to tumors injected with AAV1-rP0-null. FIG. 17C depicts western blotting which revealed ASC expression in sciatic nerves of mice injected with AAV1-rP0-hASC (proteins extracted one week post virus injection). Data are presented as meansSEM (n=3). *p<0.05 (t-test).

[0034] FIG. 18 demonstrates that demethylation of the ASC CpG island restores expression in ASC-negative HEI-193 cell line. The cultured cells were treated with (5azadeoxycytindine 0.5, 1 or 2.5 uM) or not treated (0) for 3 days. The samples were analyzed for ASC expression by RT-PCR and normalized to -actin.

[0035] FIG. 19 depicts a graph demonstrating fully humanized vector (AAV1-hP0-hASC) inhibits schwannoma growth and that there is no difference in efficacy compared with rat P0 containing vector (AAV1-rP0-hASC).

[0036] FIG. 20A depicts a graph of the Minimum Effective Dose of fully humanized product: AAV1-hP0-hASC. FIG. 20B depicts the supporting histological data.

[0037] FIGS. 21A-21B demonstrate that in vitro transduction of mouse plexiform neurofibroma (NF-1 tumor) cells with ASC and gasdermin-d (GASD), but not caspase-1 (ICE), leads to cell death. FIG. 21A depicts transfection of mouse plexiform neurofibroma cell line with AAV plasmids encoding GFP driven by CBA promoter. Transfection was performed by lipofection and pictures were captured 24 hours post transfection. These results indicate moderate to low transduction. In FIG. 21B, LDH release was measured 24 hours after transfection with different AAV plasmids encoding mASC, mGASD-d-N, mICE (caspase-1), and GFP, as well as lipofectamine treated cells. m refers to mouse, the species from which the transgene was derived.

[0038] FIGS. 22A-22B demonstrate that in vitro transduction of S462.Ty cells (human malignant peripheral nerve sheath tumor (MPNST) derived and NF1 deficient) cells with ASC and gasdermin-d (GASD), but not caspase-1 (ICE), leads to cell death. FIG. 22A depicts transfection of the cells with AAV plasmids encoding GFP driven by CBA promoter. Transfection was performed by lipofection and pictures were captured 24 hours post transfection. These results indicate moderate to low transduction. In FIG. 22B, LDH release was measured 24 hours after transfection with different AAV plasmids encoding mASC, mGASD-d-N, mICE (caspase-1), and GFP, as well as lipofectamine treated cells. m refers to mouse, the species from which the transgene was derived.

[0039] FIGS. 23A-23B demonstrate that in vitro transduction of STS-26T (human sporadic MPNST derived and NF1 proficient) cells with ASC and gasdermin-d (GASD), but not caspase-1 (ICE), leads to cell death. FIG. 23A depicts transfection of the cells with AAV plasmids encoding GFP driven by CBA promoter. Transfection was performed by lipofection and pictures were captured 24 hours post transfection. These results indicate moderate to low transduction. In FIG. 23B, LDH release was measured 24 hours after transfection with different AAV plasmids encoding mASC, mGASD-d-N, mICE (caspase-1), and GFP, as well as lipofectamine treated cells. m refers to mouse, the species from which the transgene was derived.

[0040] FIGS. 24A and 24B depict data of ASC promoter methylation (FIG. 24A; methylation specific-PCR) and ASC mRNA expression (FIG. 24B; real time Q-PCR) in Human Malignant Peripheral Nerve Sheath Tumor (MPNST) cell lines and controls. FIG. 24A demonstrates that ASC promoter is completely methylated in S462.TY cells (Human MPNST, NF1 deficient) and that ASC promoter is completely unmethylated in STS-26T cells (Human sporadic MPNST, NF1 proficient). Positive control for ASC promoter methylation (HEI-193 cell line). Positive control for unmethylated ASC promoter (human schwann cellsSch). FIG. 24B demonstrates that ASC mRNA is suppressed in cells with methylated ASC-promoter (HEI-193 and S462.TY).

DETAILED DESCRIPTION

[0041] As described herein, the inventors have discovered that ectopic expression of Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D in tumor cells (e.g., schwannomas) induces cell death of the tumor cells, but not of healthy cells. Moreover, the effectiveness of this approach is surprisingly superior to prior art methods such as, e.g., ectopic expression of caspases (see, e.g, FIG. 10). Without wishing to be bound by theory, it is contemplated herein that the superior results obtained with ASC and gasdermin D may be due to 1) as demonstrated herein, ASC has a broader function in cells as it activates multiple caspases, including those that do not belong to the inflammasome, such as caspases-3, and 2) as demonstrated herein, both ASC and Gasdermin D have a role as tumor suppressors, which is not reported for caspase-1.

[0042] Accordingly, in one aspect of any of the embodiments, provided herein is a method of inducing cell death of a target cell, the method comprising contacting the target cell with a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D. In one aspect of any of the embodiments, provided herein is a method of treating a neoplasm and/or tumor in a subject in need thereof, the method comprising administering a vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a cell-type specific promoter or a neoplasm/tumor cell-specific promoter. In one aspect of any of the embodiments, provided herein is a method of treating a neoplasm and/or tumor in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a cell-type specific promoter or a neoplasm/tumor cell-specific promoter.

[0043] As used herein, Apoptosis-associated Speck-like protein containing a CARD or ASC or PYCARD refers to a protein comprising a N-terminal PYD domain and a C-terminal CARD domain which are both protein-protein interaction domains. ASC mediates the formation of the inflammasome and is an activator of pro-apoptotic pathways. Sequences for ASC are known for a number of species, e.g., human ASC (NCBI Gene ID No: 29108) mRNA (SEQ ID NO: 1; NCBI Ref Seq: NM_013258.4 and SEQ ID NO: 2; NCBI Ref Seq: NM_145182.2) and polypeptide (SEQ ID NO: 3; NCBI Ref Seq: NP_037390.2 and SEQ ID NO: 4; NCBI Ref Seq: NP_660183.1) as well as mouse ASC (NCBI Gene ID No: 66824) and rat ASC (NCBI Gene ID No: 282817). In some embodiments of any of the aspects, ASC can be human ASC, mouse ASC or rat ASC.

[0044] As used herein, gasdermin D refers to a polypeptide which is cleaved by activated caspases (e.g., after Asp275 of human gasdermin D and Asp276 of mouse gasdermin D). The resulting amino-terminal fragment then mediates, e.g., pyroptosis and cytokine release. Sequences for gasdermin D are known for a number of species, e.g., human gasdermin D (NCBI Gene ID No: 79792) mRNA (SEQ ID NO: 5; NCBI Ref Seq: NM_001166237.1 and SEQ ID NO: 6; NCBI Ref Seq: NM_024736.6) and polypeptide (SEQ ID NO: 7; NCBI Ref Seq: NP_079012.3) as well as mouse gasdermin D (NCBI Gene ID No: 69146) and rat gasdermin D (NCBI Gene ID No: 315084). In some embodiments of any of the aspects, gasdermin D can be human gasdermin D, mouse gasdermin D or rat gasdermin D.

[0045] In some embodiments of any of the aspects, gasdermin D can be the active N-terminal fragment of gasdermin D. For example, in some embodiments of any of the aspects a gasdermin D polypeptide does not comprise the C-terminal domain removed by caspase activity and/or a nucleic acid does not encode the C-terminal gasdermin D domain removed by caspase activity. Accordingly, in some embodiments of any of the aspects, a gasdermin D polypeptide can comprise a sequence corresponding to amino acids 1-275 of SEQ ID NO: 7. In some embodiments of any of the aspects, a gasdermin D polypeptide does not comprise a sequence corresponding to amino acids 276-484 of SEQ ID NO: 7. In some embodiments of any of the aspects, a nucleic acid as described herein encodes a gasdermin D polypeptide comprising a sequence corresponding to amino acids 1-275 of SEQ ID NO: 7. In some embodiments of any of the aspects, a nucleic acid as described herein does not encode a sequence corresponding to amino acids 276-484 of SEQ ID NO: 7.

[0046] In some embodiments of any of the aspects, a nucleic acid encoding ASC and/or gasdermin D can be delivered, provided, and/or administered by delivering, providing, and/or administering a viral vector comprising a nucleic acid encoding ASC and/or gasdermin D. In one aspect of any of the embodiments, provided herein is a vector comprising a nucleic acid encoding ASC and/or gasdermin D. In one aspect of any of the embodiments, provided herein is a viral vector comprising a nucleic acid encoding ASC and/or gasdermin D. In some embodiments of any of the aspects, the nucleic acid encodes both ASC and gasdermin D. In some embodiments of any of the aspects, the nucleic acid encodes ASC. In some embodiments of any of the aspects, the nucleic acid encodes gasdermin D.

[0047] In some embodiments of any of the aspects, the vector does not comprise a nucleic acid encoding a caspase.

[0048] In some embodiments of any of the aspects, the nucleic acid encoding ASC and/or gasdermin D is operably linked to a constitutive promoter. In some embodiments of any of the aspects, the nucleic acid encoding ASC and/or gasdermin D is operably linked to a cell-type specific promoter. In some embodiments of any of the aspects, the nucleic acid encoding ASC and/or gasdermin D is operably linked to a Schwann cell-specific promoter.

[0049] A nucleic acid molecule, such as DNA, is said to be capable of expressing a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are operably linked to nucleotide sequences which encode the polypeptide. An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene expression as peptides in recoverable amounts. The precise nature of the regulatory regions needed for gene expression may vary from organism to organism, as is well known in the analogous art.

[0050] In some embodiments of any of the aspects, the promoter can be upstream of the nucleic acid encoding ASC and/or gasdermin D.

[0051] A neoplasm, cancer and/or tumor cell-specific promoter is a promoter which is at least 1.5 more transcriptionally active in a neoplasm, cancer and/or tumor cell as compared to a healthy cell of the same type. In some embodiments of any of the aspects, a neoplasm, cancer and/or tumor cell-specific promoter is a promoter which is at least 1.5 e.g., 2, 5, 10 or more transcriptionally active in a neoplasm, cancer and/or tumor cell as compared to a healthy cell of the same type. Neoplasm, cancer and/or tumor cell-specific promoters are known for various types of cancers and tumors and one suitable for use in a given type of neoplasm, cancer or tumor is readily identified by one of skill in the art.

[0052] A cell type-specific promoter is a promoter which is at least 1.5 more transcriptionally active in a first cell type (either healthy or cancerous) as compared to other cell types. In some embodiments of any of the aspects, a cell type-specific promoter is a promoter which is at least 1.5 e.g., 2, 5, 10 or more transcriptionally active in a first cell type (either healthy or cancerous) as compared to other cell types. Cell type-specific promoters are known for various types of cells and one suitable for use in a given type of neoplasm, cancer or tumor is readily identified by one of skill in the art. In some embodiments of any of the aspects, the cell types-specific promoter is specific to Schwann cells and/or Schwann-lineage cells.

[0053] In some embodiments of any of the aspects, the vector can be a polynucleotide.

[0054] In some embodiments of any of the aspects, the viral vector can be a recombinant adeno-associated virus (rAAV). In some embodiments of any of the aspects, the rAAV can be of serotype AAV1 or AAV9. In some embodiments of any of the aspects, the vector can be a single-stranded or double-stranded AAV. In some embodiments of any of the aspects, the vector can be is a self-complementary AAV (scAAV). In some embodiments of any of the aspects, the vector can be a virus particle.

[0055] In some embodiments of any of the aspects, a vector can further comprise a polyadenylation signal. In some embodiments of any of the aspects, the polyadenylation signal can be downstream of the nucleic acid encoding ASC and/or gasdermin D. In some embodiments of any of the aspects, the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.

[0056] In some embodiments of any of the aspects, the vector can further comprise a first AAV inverted terminal repeat (ITR) located upstream of the promoter and a second AAV ITR located downstream of the polyadenylation signal. In some embodiments of any of the aspects, the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.

[0057] In some embodiments of any of the aspects, the neoplasm and/or tumor to be treated is a schwannoma and the promoter is a schwann-cell specific promoter. Non-limiting examples of schwann-cell specific promoters are known in the art and can include a P0 promoter (e.g., human P0 (NCBI Gene ID: 4359), mouse P0 (NCBI Gene ID: 17528), or rat P0 (NCBI Gene ID: 24564)) , a peripheral myelin protein 22 promoter (PMP22) (e.g., human PMP22 (NCBI Gene ID: 5376), mouse PMP22 (NCBI Gene ID: 18858), or rat PMP22 (NCBI Gene ID: 24660)), or a MBP promoter (e.g., human MBP (NCBI Gene ID: 155), mouse MBP (NCBI Gene ID: 17196), or rat MBP (NCBI Gene ID: 24547)) promoter.

[0058] In various embodiments, the Schwann cell specific promoter can be a human, mouse, or rat promoter (e.g., human P0 promoter, human PMP22 promoter, human MBP promoter, mouse P0 promoter, mouse PMP22 promoter, mouse MBP promoter, rat P0 promoter, and rat PMP22 promoter, and rat MBP promoter or hybrids thereof). A non-limiting exemplary sequence of a rat P0 promoter is set forth in SEQ ID NO.: 8. A non-limiting exemplary sequence of a mouse P0 promoter is set forth in SEQ ID NO.: 9. A non-limiting exemplary sequence of a human P0 promoter is set forth in SEQ ID NO.: 10.

[0059] A non-limiting exemplary sequence of a human PMP22 promoter is set forth in SEQ ID NO.: 11. A non-limiting exemplary sequence of a human MBP promoter is set forth in SEQ ID NO.: 12.

[0060] In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a nucleic acid encoding ASC. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering vector comprising a nucleic acid encoding ASC. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering viral vector comprising a nucleic acid encoding ASC. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a nucleic acid encoding gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering viral vector comprising a nucleic acid encoding gasdermin D.

[0061] In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a nucleic acid encoding ASC and gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering viral vector comprising a nucleic acid encoding ASC and gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a single nucleic acid encoding both ASC and gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a single viral vector comprising a nucleic acid encoding both ASC and gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a first nucleic acid encoding ASC and a second nucleic acid encoding gasdermin D. In some embodiments of any of the aspects, the methods described herein relate to delivering, providing, and/or administering a first viral vector comprising a nucleic acid encoding ASC and a second viral vector comprising a nucleic acid encoding gasdermin D.

[0062] Various embodiments of the present invention provide a pharmaceutical composition. The pharmaceutical composition can comprise a vector comprising a nucleic acid encoding ASC and/or gasdermin D, or a cell transfected with the vector, or supernatant conditioned with the transfected cell, or an extracellular vesicle isolated from the transfected cell. Any of the foregoing compositions can be administered to a subject in need of treatment as described herein.

[0063] In some embodiments of any of the aspects, the target cell can be a neoplasm cell, tumor cell and/or cancer cell. In some embodiments of any of the aspects, the methods of treatment relate to inducing cell death of and/or inhibiting cell growth of a neoplasm, tumor or cancer cell.

[0064] As used herein, the term cancer relates generally to a class of diseases or conditions in which abnormal cells divide without control and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the blood and lymph systems. There are several main types of cancer. Carcinoma is a cancer that begins in the skin or in tissues that line or cover internal organs. Sarcoma is a cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supportive tissue. Leukemia is a cancer that starts in blood-forming tissue such as the bone marrow, and causes large numbers of abnormal blood cells to be produced and enter the blood. Lymphoma and multiple myeloma are cancers that begin in the cells of the immune system. Central nervous system cancers are cancers that begin in the tissues of the brain and spinal cord.

[0065] In some embodiments of any of the aspects, the cancer is a primary cancer. In some embodiments of any of the aspects, the cancer is a malignant cancer. As used herein, the term malignant refers to a cancer in which a group of tumor cells display one or more of uncontrolled growth (i.e., division beyond normal limits), invasion (i.e., intrusion on and destruction of adjacent tissues), and metastasis (i.e., spread to other locations in the body via lymph or blood). As used herein, the term metastasize refers to the spread of cancer from one part of the body to another. A tumor formed by cells that have spread is called a metastatic tumor or a metastasis. The metastatic tumor contains cells that are like those in the original (primary) tumor. As used herein, the term benign or non-malignant refers to tumors that may grow larger but do not spread to other parts of the body. Benign tumors are self-limited and typically do not invade or metastasize.

[0066] A cancer cell or tumor cell refers to an individual cell of a cancerous growth or tissue. A tumor refers generally to a swelling or lesion formed by an abnormal growth of cells, which may be benign, pre-malignant, or malignant. Most cancer cells form tumors, but some, e.g., leukemia, do not necessarily form tumors. For those cancer cells that form tumors, the terms cancer (cell) and tumor (cell) are used interchangeably.

[0067] As used herein the term neoplasm refers to any new and abnormal growth of tissue, e.g., an abnormal mass of tissue, the growth of which exceeds and is uncoordinated with that of the normal tissues. Thus, a neoplasm can be a benign neoplasm, premalignant neoplasm, or a malignant neoplasm.

[0068] A subject that has a cancer or a tumor is a subject having objectively measurable cancer cells present in the subject's body. Included in this definition are malignant, actively proliferative cancers, as well as potentially dormant tumors or micrometastatses. Cancers which migrate from their original location and seed other vital organs can eventually lead to the death of the subject through the functional deterioration of the affected organs.

[0069] Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cancer of the peritoneum; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer (including gastrointestinal cancer); glioblastoma (GBM); hepatic carcinoma; hepatoma; intra-epithelial neoplasm; kidney or renal cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the respiratory system; salivary gland carcinoma; sarcoma; skin cancer; squamous cell cancer; stomach cancer; testicular cancer; thyroid cancer; uterine or endometrial cancer; cancer of the urinary system; vulval cancer; as well as other carcinomas and sarcomas; as well as B-cell lymphoma (including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs' syndrome.

[0070] A cancer cell is a cancerous, pre-cancerous, or transformed cell, either in vivo, ex vivo, or in tissue culture, that has spontaneous or induced phenotypic changes that do not necessarily involve the uptake of new genetic material. Although transformation can arise from infection with a transforming virus and incorporation of new genomic nucleic acid, or uptake of exogenous nucleic acid, it can also arise spontaneously or following exposure to a carcinogen, thereby mutating an endogenous gene. Transformation/cancer is associated with, e.g., morphological changes, immortalization of cells, aberrant growth control, foci formation, anchorage independence, malignancy, loss of contact inhibition and density limitation of growth, growth factor or serum independence, tumor specific markers, invasiveness or metastasis, and tumor growth in suitable animal hosts such as nude mice.

[0071] In one aspect of any of the embodiments, described herein is a method of treating a schwannoma in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a Schwann cell-specific promoter.

[0072] Schwannoma tumors are composed of Schwann-lineage cells and form along peripheral, spinal and cranial nerves. These tumors can cause pain, sensory/motor dysfunction, and death through compression of peripheral nerves, the spinal cord, and/or the brain stem. Multiple schwannomas in peripheral distal and intracranial nerves are the hallmark of neurofibromatosis 1 and 2 (NF1 and NF2), and schwannomatosis, three types of nerve sheath tumors. Schwannomas are benign tumors composed of neoplastic dedifferentiated Schwann cells. Although typically nonmalignant and slow growing, these tumors can have devastating consequences for patients. They can cause extreme pain and compromise sensory/motor functions, including hearing and vision. Schwannomas in NF2 are frequently associated with neurological deficits, such as paresthesias, weakness, or hearing loss, and similar tumors in schwannomatosis often cause excruciating pain. Some schwannomas become very large, causing compression of adjacent organs or structures, and can lead to paralysis or death due to progressive spinal cord or brainstem compression. Schwannomas may arise sporadically, without presenting any genetic features of NF1, NF2 and schwannomatosis. Most vestibular schwannomas are sporadic schwannomas, so their incidence is very significant. Vestibular schwannomas usually occur as single tumors, not as multiple tumors throughout the body. In some embodiments of any of the aspects, a subject in need of treatment for a schwannoma can be a subject having or diagnosed as having a condition selected from the group consisting of: neurofibromatosis 1 (NF1); neurofibromatosis 2 (NF2); schwannomatosis; meningioma; nerve sheath tumor; schwannoma; vestibular schwannoma; sporadic schwannoma; neurofibrosarcoma; neurofibroma; neurofibromatosis (NF); malignant peripheral nerve sheath tumor; and a combination thereof.

[0073] The standard of care for patients with NF2 and schwannomatosis is surgical resection or radiosurgery of symptomatic tumors to reduce tumor size. Unlike in the case of sporadic schwannomas, in which typically only a single tumor is present and surgery is generally an efficacious treatment strategy as long as the lesion is accessible for resection, in schwannomatosis and NF2, which present with multiple tumors, resection is confounded by both the inaccessibility of many tumors and by risk of nerve damage, including major motor dysfunction, significant sensory loss (including deafness in the case of NF2 vestibular schwannomas), and neuropathic pain. Thus, for most individuals there is substantial morbidity associated with schwannomas in both NF2 and schwannomatosis, as well as with the current therapies. This suffering and debility, in combination with the paucity of therapeutic options, makes the treatment of schwannomas a major unmet medical need.

[0074] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having a tumor or cancer with a vector and/or nucleic acid encoding ASC and/or gasdermin D. Subjects having cancer can be identified by a physician using current methods of diagnosing cancer. For example, symptoms and/or complications of schwannomas which characterize these conditions and aid in diagnosis are well known in the art and include but are not limited to, pain, swelling, hearing loss, loss of coordination and/or balance, muscle weakness, and numbness. Tests that may aid in a diagnosis of, e.g. schwannoma include, but are not limited to, CTs and MRI. A family history of schwnnoma or exposure to risk factors for schwannomas can also aid in determining if a subject is likely to have a schwannoma or in making a diagnosis of schwannoma.

[0075] The compositions and methods described herein can be administered to a subject having or diagnosed as having a neoplasm, tumor and/or cancer. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g. a vector encoding ASC and/or gasdermin D to a subject in order to alleviate a symptom of a neoplasm, tumor and/or cancer. As used herein, alleviating a symptom is ameliorating any condition or symptom associated with the condition. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique. A variety of means for administering the compositions described herein to subjects are known to those of skill in the art. Administration can be local or systemic.

[0076] The administration of the compositions contemplated herein may be carried out in any convenient manner, including by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. In a preferred embodiment, compositions are administered parenterally. The phrases parenteral administration and administered parenterally as used herein refers to modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravascular, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intratumoral, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion. In one embodiment, the compositions contemplated herein are administered to a subject by direct injection into a tumor, lymph node, or site of infection. In some embodiments of any of the aspects, the nucleic acid and/or vector can be administered directly to the tumor. In some embodiments of any of the aspects, the nucleic acid and/or vector can be administered by intratumoral injection. In some embodiments of any of the aspects, the nucleic acid and/or vector can be administered directly to a nerve affected by a schwannoma. In some embodiments of any of the aspects, the nucleic acid and/or vector can be administered intranervously, intracranially, intratumorally, intramuscularly, intravenously, intradermally, or subcutaneously, or a combination thereof

[0077] The term effective amount as used herein refers to the amount of a composition needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect. The term therapeutically effective amount therefore refers to an amount of a composition that is sufficient to provide a particular anti-tumor effect when administered to a typical subject. An effective amount as used herein, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a symptom of the disease), or reverse a symptom of the disease. Thus, it is not generally practicable to specify an exact effective amount. However, for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using only routine experimentation.

[0078] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50. Compositions and methods that exhibit large therapeutic indices are preferred. A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the active ingredient, which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model. Levels in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay, e.g., assay for tumor growth and/or size among others. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.

[0079] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the minimal effective dose and/or maximal tolerated dose. The dosage can vary depending upon the dosage form employed and the route of administration utilized. A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a dosage range between the minimal effective dose and the maximal tolerated dose. The effects of any particular dosage can be monitored by a suitable bioassay, e.g., assay for tumor growth and/or size among others. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.

[0080] In some embodiments of any of the aspects, a method of treatment as described herein can further comprise surgical removal of a neoplasm or tumor, e.g., a schwannoma. In some embodiment of any of the aspects, a nucleic acid and/or vector as described herein can be administered before, concurrently with, or after surgical removal of a neoplasm or tumor, e.g., a schwannoma. Various treatment method of the present invention may further comprise treating the subject with surgery, radiation therapy, or chemotherapy, or a combination thereof

[0081] In some embodiments of any of the aspects, a subject treated according to the methods described herein is not administered a viral vector comprising a caspase gene or a nucleic acid encoding a caspase. In some embodiments of any of the aspects, a subject treated according to the methods described herein is not administered a viral vector comprising a caspase gene or a nucleic acid encoding a caspase concurrently with the treatment as described herein. In some embodiments of any of the aspects, a subject treated according to the methods described herein has not been administered a viral vector comprising a caspase gene or a nucleic acid encoding a caspase. In some embodiments of any of the aspects, a nucleic acid and/or vector as described herein does not comprise a caspase gene.

[0082] In one aspect of any of the embodiments, provided herein is a pharmaceutical composition comprising 1) a nucleic acid encoding ASC and/or gasdermin D or a viral vector comprising a nucleic acid encoding ASC and/or gasdermin D and 2) a pharmaceutically acceptable carrier.

[0083] In some embodiments, the technology described herein relates to a pharmaceutical composition comprising a nucleic acid and/or vector as described herein, and optionally a pharmaceutically acceptable carrier. In some embodiments, the active ingredients of the pharmaceutical composition comprise a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist essentially of a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist of a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein. Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents is well known in the art. Some non-limiting examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as excipient, carrier, pharmaceutically acceptable carrier or the like are used interchangeably herein. In some embodiments, the carrier inhibits the degradation of the active agent, e.g. a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein.

[0084] In some embodiments, the pharmaceutical composition comprising a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein can be a parenteral dose form. Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration of a patient, including, but not limited to, DUROS-type dosage forms and dose-dumping.

[0085] Suitable vehicles that can be used to provide parenteral dosage forms of a vector and/or nucleic acid encoding ASC and/or gasdermin D as disclosed within are well known to those skilled in the art. Examples include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate. Compounds that alter or modify the solubility of a pharmaceutically acceptable salt of a composition disclosed herein can also be incorporated into the parenteral dosage forms of the disclosure, including conventional and controlled-release parenteral dosage forms.

[0086] Conventional dosage forms generally provide rapid or immediate drug release from the formulation. Depending on the pharmacology and pharmacokinetics of the drug, use of conventional dosage forms can lead to wide fluctuations in the concentrations of the drug in a patient's blood and other tissues. These fluctuations can impact a number of parameters, such as dose frequency, onset of action, duration of efficacy, maintenance of therapeutic blood levels, toxicity, side effects, and the like. Advantageously, controlled-release formulations can be used to control a drug's onset of action, duration of action, plasma levels within the therapeutic window, and peak blood levels. In particular, controlled- or extended-release dosage forms or formulations can be used to ensure that the maximum effectiveness of a drug is achieved while minimizing potential adverse effects and safety concerns, which can occur both from under-dosing a drug (i.e., going below the minimum therapeutic levels) as well as exceeding the toxicity level for the drug. In some embodiments, the vector and/or nucleic acid encoding ASC and/or gasdermin D can be administered in a sustained release formulation.

[0087] Controlled-release pharmaceutical products have a common goal of improving drug therapy over that achieved by their non-controlled release counterparts. Ideally, the use of an optimally designed controlled-release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time. Advantages of controlled-release formulations include: 1) extended activity of the drug; 2) reduced dosage frequency; 3) increased patient compliance; 4) usage of less total drug; 5) reduction in local or systemic side effects; 6) minimization of drug accumulation; 7) reduction in blood level fluctuations; 8) improvement in efficacy of treatment; 9) reduction of potentiation or loss of drug activity; and 10) improvement in speed of control of diseases or conditions. Kim, Cherng-ju, Controlled Release Dosage Form Design, 2 (Technomic Publishing, Lancaster, Pa.: 2000).

[0088] Most controlled-release formulations are designed to initially release an amount of drug (active ingredient) that promptly produces the desired therapeutic effect, and gradually and continually release other amounts of drug to maintain this level of therapeutic or prophylactic effect over an extended period of time. In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body. Controlled-release of an active ingredient can be stimulated by various conditions including, but not limited to, pH, ionic strength, osmotic pressure, temperature, enzymes, water, and other physiological conditions or compounds.

[0089] A variety of known controlled- or extended-release dosage forms, formulations, and devices can be adapted for use with the salts and compositions of the disclosure. Examples include, but are not limited to, those described in U.S. Pat. Nos.: 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5674,533; 5,059,595; 5,591 ,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; 5,733,566; and 6,365,185 B1; each of which is incorporated herein by reference. These dosage forms can be used to provide slow or controlled-release of one or more active ingredients using, for example, hydroxypropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems (such as OROS (Alza Corporation, Mountain View, Calif. USA)), or a combination thereof to provide the desired release profile in varying proportions.

[0090] The methods described herein can further comprise administering a second agent and/or treatment to the subject, e.g. as part of a combinatorial therapy. Non-limiting examples of a second agent and/or treatment can include radiation therapy, surgery, gemcitabine, cisplastin, paclitaxel, carboplatin, bortezomib, AMG479, vorinostat, rituximab, temozolomide, rapamycin, ABT-737, PI-103; alkylating agents such as thiotepa and CYTOXAN cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall (see, e.g., Agnew, Chem. Intl. Ed. Engl., 33: 183-186 (1994)); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2,2-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (Ara-C); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERE doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (Camptosar, CPT-11) (including the treatment regimen of irinotecan with 5-FU and leucovorin); topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; combretastatin; leucovorin (LV); oxaliplatin, including the oxaliplatin treatment regimen (FOLFOX); lapatinib (Tykerb); inhibitors of PKC-alpha, Raf, H-Ras, EGFR (e.g., erlotinib (Tarceva)) and VEGF-A that reduce cell proliferation and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0091] In addition, the methods of treatment can further include the use of radiation or radiation therapy. Further, the methods of treatment can further include the use of surgical treatments.

[0092] In some embodiments of any of the aspect, the concentration of the vector is about 110.sup.7-110.sup.12, 110.sup.7-110.sup.10, 110.sup.10-110.sup.12, 110.sup.12-110.sup.15, or 110.sup.15-110.sup.18 copies per l of the pharmaceutical composition. In some embodiments of any of the aspect, the concentration of the rAAV vector is about 110.sup.7-110.sup.12, 110.sup.7-110.sup.10, 110.sup.10-110.sup.12, 110.sup.12-110.sup.15, or 110.sup.15-110.sup.18 genome copies (gc) per l of the pharmaceutical composition.

[0093] In certain embodiments, an effective dose of a composition comprising a vector and/or nucleic acid encoding ASC and/or gasdermin D as described herein can be administered to a patient once. In certain embodiments, an effective dose of a composition comprising a vector and/or nucleic acid encoding ASC and/or gasdermin D can be administered to a patient repeatedly. For systemic administration, subjects can be administered a therapeutic amount of a composition comprising a vector and/or nucleic acid encoding ASC and/or gasdermin D, such as, e.g. 0.1 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 40 mg/kg, 50 mg/kg, or more.

[0094] In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year or longer. Treatment according to the methods described herein can reduce levels of a marker or symptom of a condition, e.g. neoplasm and/or tumor size and/or rate of growth by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% or more.

[0095] The dosage of a composition as described herein can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment. With respect to duration and frequency of treatment, it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment, or make other alterations to the treatment regimen. The dosing schedule can vary from once a week to daily depending on a number of clinical factors, such as the subject's sensitivity to the active ingredient. The desired dose or amount of activation can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the day or other appropriate schedule. In some embodiments, administration can be chronic, e.g., one or more doses and/or treatments daily over a period of weeks or months. Examples of dosing and/or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. A composition described herein can be administered over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25minute period.

[0096] In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of more than 1109 gc (genome copies)/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.5109 gc/kg to about 1.51011 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.5109 gc/kg to 1.51011 gc/kg.

[0097] In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.5109 gc/kg to about 1.51015 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.5109 gc/kg to 1.51015 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.5109 gc/kg to about 1.51019 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.5109 gc/kg to 1.51019 gc/kg.

[0098] In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.01011 gc/kg to about 1.01015 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.01011 gc/kg to 1.01015 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.01011 gc/kg to about 1.01017 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.01011 gc/kg to 1.01017 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from about 1.01011 gc/kg to about 1.01019 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of from 1.01011 gc/kg to 1.01019 gc/kg.

[0099] In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of about 2.01012 gc/kg. In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided at a dose of about 3.31014 gc/kg.

[0100] In some embodiments of any of the aspects, the dose of viral vectors as described herein, e.g., AAV1 vector comprising a human P0 promoter and human ASC gene, are provided directly to a tumor or neoplasm in a volume of from about 5% to about 50% of the total tumor or neoplasm volume.

[0101] The dosage ranges for the administration of the compositions described herein, according to the methods described herein depend upon, for example, the form of the active ingredient, its potency, and the extent to which symptoms, markers, or indicators of a condition described herein are desired to be reduced, for example the percentage reduction desired for tumor size and/or rate of growth or the extent to which, for example, immunity is desired to be induced. The dosage should not be so large as to cause adverse side effects, such as auto-immune conditions. Generally, the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art. The dosage can also be adjusted by the individual physician in the event of any complication.

[0102] The efficacy of a vector and/or nucleic acid encoding ASC and/or gasdermin D in, e.g. the treatment of a condition described herein, or to induce a response as described herein can be determined by the skilled clinician. However, a treatment is considered effective treatment, as the term is used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 10% following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and/or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. tumor size and/or rate of growth. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and/or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease, e.g., causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and/or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy can be assessed in animal models of a condition described herein, for example treatment of mouse models of cancer. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed, e.g. tumor size and/or rate of growth, or induction of inflammasome activity and/or tumor-cell apoptosis.

[0103] In vitro and animal model assays are provided herein which allow the assessment of a given dose of a vector and/or nucleic acid encoding ASC and/or gasdermin D. By way of non-limiting example, the effects of a dose of a vector and/or nucleic acid encoding ASC and/or gasdermin D can be assessed by administering the dose to a mouse in which HEI-193FC cells have been implanted in the sciatic nerve. Tumor growth can be assessed at by immunohistological staining and/or measuring pain responses, e.g., as described in the Examples herein.

[0104] In some embodiments of any of the aspects, the present invention provides provides a supernatant obtained from a culture of a cell transfected with a vector comprising a nucleic acid encoding ASC and/or gasdermin D. In some embodiments of any of the aspects, the cell is a schwannoma cell or a Schwann cell. In various embodiments, the transfected cell is cultured for about 12-24, 24-48, or 48-73 hours.

[0105] In some embodiments of any of the aspects, the present invention provides an extracellular vesicle isolated from a cell transfected with a vector comprising a nucleic acid encoding ASC and/or gasdermin D. In some embodiments of any of the aspects, the cell is a schwannoma cell or a Schwann cell. In various embodiments, the transfected cell is cultured for about 12-24, 24-48, or 48-73 hours.

[0106] In one aspect of any of the embodiments, provided herein is a composition comprising a nucleic acid encoding ASC and/or gasdermin D or a viral vector comprising a nucleic acid encoding ASC and/or gasdermin D, contained within packaging materials. The kit is an assemblage of materials or components, including at least one of the inventive vectors and/or compositions. The exact nature of the components configured in the inventive kit depends on its intended purpose. In one embodiment, the kit is configured particularly for human subjects. In further embodiments, the kit is configured for veterinary applications, treating subjects such as, but not limited to, farm animals, domestic animals, and laboratory animals

[0107] Instructions for use may be included in the kit. Instructions for use typically include a tangible expression describing the technique to be employed in using the components of the kit to affect a desired outcome, such as to treat, reduce the severity of, inhibit or prevent schwannoma in a subject. Still in accordance with the present invention, instructions for use may include a tangible expression describing the preparation of virions and/or at least one method parameter, such as the relative amounts of rAAV vector genome, dosage requirements and administration instructions, and the like, typically for an intended purpose. Optionally, the kit also contains other useful components, such as, measuring tools, diluents, buffers, pharmaceutically acceptable carriers, syringes or other useful paraphernalia as will be readily recognized by those of skill in the art.

[0108] The materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. For example, the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures. The components are typically contained in suitable packaging material(s). As employed herein, the phrase packaging material refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like. The packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment. As used herein, the term package refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components. Thus, for example, a package can be a glass vial used to contain suitable quantities of a composition containing a volume of a vector described herein. The packaging material generally has an external label which indicates the contents and/or purpose of the kit and/or its components.

[0109] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0110] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here.

[0111] The terms decrease, reduced, reduction, or inhibit are all used herein to mean a decrease by a statistically significant amount. In some embodiments, reduce, reduction or decrease or inhibit typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, reduction or inhibition does not encompass a complete inhibition or reduction as compared to a reference level. Complete inhibition is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.

[0112] The terms increased, increase, enhance, or activate are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms increased, increase, enhance, or activate can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, a increase is a statistically significant increase in such level.

[0113] As used herein, a subject means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, individual, patient and subject are used interchangeably herein.

[0114] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of neoplasms, cancer and/or tumors. A subject can be male or female.

[0115] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e.g. schwannoma) or one or more complications related to such a condition, and optionally, have already undergone treatment for the condition or the one or more complications related to the condition. Alternatively, a subject can also be one who has not been previously diagnosed as having the condition or one or more complications related to the condition. For example, a subject can be one who exhibits one or more risk factors for the condition or one or more complications related to the condition or a subject who does not exhibit risk factors.

[0116] A subject in need of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.

[0117] As used herein, the terms protein and polypeptide are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms protein, and polypeptide refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. Protein and polypeptide are often used in reference to relatively large polypeptides, whereas the term peptide is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms protein and polypeptide are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.

[0118] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and/or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a conservatively modified variant where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.

[0119] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. ability to reduce schwannoma growth and/or activate the inflammasome and specificity of a native or reference polypeptide is retained.

[0120] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into His; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gln; Ile into Leu or into Val; Leu into Ile or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into Ile or into Leu.

[0121] In some embodiments, the polypeptide described herein (or a nucleic acid encoding such a polypeptide) can be a functional fragment of one of the amino acid sequences described herein. As used herein, a functional fragment is a fragment or segment of a peptide which retains at least 50% of the wildtype reference polypeptide's activity according to the assays described below herein. A functional fragment can comprise conservative substitutions of the sequences disclosed herein.

[0122] In some embodiments, the polypeptide described herein can be a variant of a sequence described herein. In some embodiments, the variant is a conservatively modified variant. Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example. A variant, as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Variant polypeptide-encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains activity. A wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan.

[0123] A variant amino acid or DNA sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).

[0124] Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are very well established and include, for example, those disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462, which are herein incorporated by reference in their entireties. Any cysteine residue not involved in maintaining the proper conformation of the polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to the polypeptide to improve its stability or facilitate oligomerization.

[0125] As used herein, the term nucleic acid or nucleic acid sequence refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g., genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA.

[0126] In some embodiments of any of the aspects, a polypeptide, nucleic acid, or cell as described herein can be engineered. As used herein, engineered refers to the aspect of having been manipulated by the hand of man. For example, a polypeptide is considered to be engineered when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature. As is common practice and is understood by those in the art, progeny of an engineered cell are typically still referred to as engineered even though the actual manipulation was performed on a prior entity.

[0127] In some embodiments, a nucleic acid encoding a polypeptide as described herein (e.g. ASC and/or gasdermin D) is comprised by a vector. The term vector, as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be viral or non-viral. The term vector encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells. A vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc.

[0128] As used herein, the term expression vector refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification. The term expression refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. Expression products include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene. The term gene means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, e.g. 5 untranslated (5UTR) or leader sequences and 3 UTR or trailer sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0129] As used herein, the term viral vector refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes. The vector and/or particle may be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.

[0130] By recombinant vector is meant a vector that includes a heterologous nucleic acid sequence, or transgene, that is capable of expression in vivo. It should be understood that the vectors described herein can, in some embodiments, be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means of maintaining the nucleotide of interest in the subject in high copy number extra chromosomal DNA thereby eliminating potential effects of chromosomal integration.

[0131] rAAV vector refers to any vector derived from any adeno-associated virus serotype, including, without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7 AAV-8, AAV9, AAV10, AAV11, or AAV12, or a hybrid serotype thereof and the like. rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and/or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are generally necessary for the rescue, replication, packaging and potential chromosomal integration of the AAV genome. Thus, a rAAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e.g., functional ITRs) of the virus. The ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion or substitution of nucleotides) so long as the sequences provide for functional rescue, replication and packaging.

[0132] Recombinant virus refers to a virus that has been genetically altered (e.g., by the addition or insertion of a heterologous nucleic acid construct into the particle).

[0133] AAV virion refers to a complete virus particle, such as a wild-type (wt) AAV virus particle (i.e., including a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid protein coat). In this regard, single-stranded AAV nucleic acid molecules of either complementary sense (i.e., sense or antisense strands) can be packaged into any one AAV virion; both strands are equally infectious. In addition, the AAV capsid protein coat can be from any of the various AAV serotypes depending on the target of the AAV virion.

[0134] A recombinant AAV virion or rAAV virion is defined herein as an infectious, replication-defective virus composed of an AAV protein shell, encapsidating a heterologous DNA molecule of interest (e.g., genes encoding caspase-1) which is flanked on both sides by AAV ITRs. A rAAV virion may be produced in a suitable host cell which has had an rAAV vector, AAV Rep and Cap functions and helper virus functions introduced therein. In this manner, the host cell is rendered capable of producing AAV replication and capsid proteins that are required for replicating and packaging the rAAV vector (i.e., containing a recombinant nucleotide sequence of interest) into recombinant virion particles for subsequent gene delivery. The complete transgene may consist of a promoter, the coding sequences, usually a cDNA and a polyadenylation signal. A transgene may also include regulatory sequences and intron regions. Promoters that would regulate transgene expression may include constitutive, inducible and tissue-specific promoters.

[0135] The term transfection is used herein to refer to the uptake of foreign DNA by a cell. A cell has been transfected when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous DNA moieties, such as a plasmid vector and other nucleic acid molecules, into suitable host cells. The term refers to both stable and transient uptake of the genetic material.

[0136] The term transduction denotes the delivery of a DNA molecule to a recipient cell either in vivo or in vitro, via any method of gene delivery, including replication-defective viral vectors, such as via a rAAV. For example, transduction could mean uptake of a virus, part of which is DNA.

[0137] Extracellular vesicles (EVs, including but are not limited to exosomes, microvesicles, microparticles, circulating microvesicles, shedding microvesicles, nanovesicles, nanoparticles, apoptotic bodies, and membrane vesicles) are fragments of plasma membrane ranging from for example, 20 nm to 10 m, shed from almost all cell types. Microvesicles play a role in intercellular communication and can transport mRNA, miRNA, and proteins between cells. As will be apparent to a person of skill in the art, there are various EV isolation and purification protocols based on filtration, differential centrifugation, ultracentrifugation, flotation of vesicles in gradients (sucrose, OptiPrep), and immunoaffinity capture utilizing antibodies against membrane proteins. Exemplary information for isolating extracelluar vesicles may be found in Simpson R J, Mathivanan S (2012) Extracellular Microvesicles: The Need for Internationally Recognised Nomenclature and Stringent Purification Criteria. J Proteomics Bioinform 5: ii-ii; van der Pol et al., Classification, functions, and clinical relevance of extracellular vesicles, Pharmacol Rev. 2012 July; 64(3):676-705; Raposo and Stoorvogel, Extracellular vesicles: exosomes, microvesicles, and friends, J Cell Biol. 2013 Feb. 18; 200(4):373-83; and Witwer et al., Standardization of sample collection, isolation and analysis methods in extracellular vesicle research, J Extracell Vesicles. 2013 May 27; 2, which are incorporated herein by reference in their entirety. Also, see Sarkar et al., 2009, Taylor and Gercel-Taylor, 2008, and Balaj et al., 2011, which are incorporated herein by reference in their entirety.

[0138] As a non-limiting example, a filtration-based method may be used and the type and size of filters and columns will be apparent to a person of skill in the art. For example, centrifugal ultracentrifugation devices covering sample volumes from 500 l to 2 ml with any type of low-protein retentions and wide pH-range (e.g. 2-12 pH) filter membranes, such as polyethersulfone (PES) can be used. The nominal size of the pores can range between any one or more of 0.1 m to 1 m, 0.2 m to 1 m, 0.3 m to 1 m, 0.4 m to 1 m, 0.5 m to 1 m, 0.6 m to 0.7 m to 0.8 m to 1 m or 0.9 m. In comparison with an ultra-centrifugation based protocol, in which extracellular vesicles (EV) are recovered from the supernatant after centrifugation at 10,000 g/30 min or 100,000 g/60 min, a filtration protocol can filter supernatant at 8,000 g/30 sec using Vivaspin ultrafiltration spin columns.

[0139] As used herein, the terms treat, treatment, treating, or amelioration refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g. a neoplasm, tumor or schwannoma. The term treating includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with, e.g., a tumor. Treatment is generally effective if one or more symptoms or clinical markers are reduced. Alternatively, treatment is effective if the progression of a disease is reduced or halted. That is, treatment includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and/or decreased mortality, whether detectable or undetectable. The term treatment of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).

[0140] As used herein, the term pharmaceutical composition refers to the active agent in combination with a pharmaceutically acceptable carrier e.g. a carrier commonly used in the pharmaceutical industry. The phrase pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and/or ointment. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier that the active ingredient would not be found to occur in in nature.

[0141] As used herein, the term administering, refers to the placement of a compound as disclosed herein into a subject by a method or route which results in at least partial delivery of the agent at a desired site. Pharmaceutical compositions comprising the compounds disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject.

[0142] As used herein, contacting refers to any suitable means for delivering, or exposing, an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, perfusion, injection, or other delivery method well known to one skilled in the art.

[0143] The term statistically significant or significantly refers to statistical significance and generally means a two standard deviation (2SD) or greater difference. In some embodiments, a statistically significant or significant difference refers to a p-value of less than 0.05.

[0144] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term about. The term about when used in connection with percentages can mean1%.

[0145] As used herein, the term comprising means that other elements can also be present in addition to the defined elements presented. The use of comprising indicates inclusion rather than limitation.

[0146] The term consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0147] As used herein the term consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0148] As used herein, the term corresponding to refers to refers to an amino acid or nucleotide at the enumerated position in a first polypeptide or nucleic acid, or an amino acid or nucleotide that is equivalent to an enumerated amino acid or nucleotide in a second polypeptide or nucleic acid. Equivalent enumerated amino acids or nucleotides can be determined by alignment of candidate sequences using degree of homology programs known in the art, e.g., BLAST.

[0149] The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, e.g. is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation e.g. is synonymous with the term for example.

[0150] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0151] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[0152] One of skill in the art can readily identify a chemotherapeutic agent of use (e.g. see Physicians' Cancer Chemotherapy Drug Manual 2014, Edward Chu, Vincent T. DeVita Jr., Jones & Bartlett Learning; Principles of Cancer Therapy, Chapter 85 in Harrison's Principles of Internal Medicine, 18th edition; Therapeutic Targeting of Cancer Cells: Era of Molecularly Targeted Agents and Cancer Pharmacology, Chs. 28-29 in Abeloff's Clinical Oncology, 2013 Elsevier; and Fischer D S (ed): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 2003).

[0153] In some embodiments of any of the aspects, the disclosure described herein does not concern a process for cloning human beings, processes for modifying the germ line genetic identity of human beings, uses of human embryos for industrial or commercial purposes or processes for modifying the genetic identity of animals which are likely to cause them suffering without any substantial medical benefit to man or animal, and also animals resulting from such processes.

[0154] Other terms are defined herein within the description of the various aspects of the invention.

[0155] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0156] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0157] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0158] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.

[0159] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs:

1. A method of treating a schwannoma in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a Schwann cell-specific promoter.
2. A method of inducing cell death of a target cell, the method comprising contacting the target cell with a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D.
3. The method of paragraph 2, wherein contacting step further comprises contacting the target cell with a viral vector comprising the nucleic acid encoding ASC and/or gasdermin D.
4. The method of any of paragraphs 2-3, wherein the target cell is a cancer and/or tumor cell.
5. The method of paragraph 4, wherein the nucleic acid encoding ASC and/or gasdermin D is operably linked to a cancer and/or tumor cell-specific promoter.
6. The method of any of paragraphs 2-5, wherein the contacting step comprises administering the nucleic acid to a subject comprising the target cell.
7. A method of treating a tumor in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a tumor cell-specific promoter.
8. The method of any of paragraphs 1-7, wherein the ASC and/or gasdermin D is a human, mouse, or rat ASC and/or gasdermin D.
9. The method of any of paragraphs 1-8, wherein the Schwann cell-specific promoter is a P0, a peripheral myelin protein 22 (PMP22), or a MBP promoter.
10. The method of any of paragraphs 1-9, wherein the subject in need of treatment for a schwannoma is a subject having or diagnosed as having a condition selected from the group consisting of: neurofibromatosis 1 (NF1); neurofibromatosis 2 (NF2); schwannomatosis; meningioma; nerve sheath tumor; schwannoma; vestibular schwannoma; sporadic schwannoma; neurofibrosarcoma; neurofibroma; neurofibromatosis (NF); malignant peripheral nerve sheath tumor; and a combination thereof.
11. The method of any of paragraphs 1-10, wherein the viral vector is a recombinant adeno-associated virus (rAAV).
12. The method of paragraph 11, wherein the rAAV is of serotype AAV1 or AAV9.
13. The method of any of paragraphs 1-12, wherein the Schwann cell specific promoter is upstream of the nucleic acid encoding ASC and/or gasdermin D.
14. The method of any of paragraphs 1-13, wherein the vector further comprises a polyadenylation signal.
15. The method of paragraph 14, wherein the polyadenylation signal is downstream of the nucleic acid encoding ASC and/or gasdermin D.
16. The method of paragraph 14 or 15, wherein the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.
17. The method of any of paragraphs 1-16, wherein the vector further comprises a first AAV inverted terminal repeat (ITR) located upstream of the Schwann cell specific promoter and a second AAV ITR located downstream of the polyadenylation signal.
18. The method of paragraph 17, wherein the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.
19. The method of any of paragraphs 1-18, wherein the vector is a polynucleotide.
20. The method of any of paragraphs 1-19, wherein the vector is a single-stranded or double-stranded AAV.
21. The method of any of paragraphs 1-20, wherein the vector is a self-complementary AAV (scAAV).
22. The method of any of paragraphs 1-21, wherein the vector is a virus particle.
23. The method of any of paragraphs 1-22, wherein the vector is administered directly to the tumor.
24. The method of any of paragraphs 1-23, wherein the vector is administered by intratumoral injection.
25. The method of any of paragraphs 1-24, wherein the vector is administered directly to a nerve affected by a schwannoma.
26. The method of any of paragraphs 1-25, wherein administering is intranervously, intracranially, intratumorally, intramuscularly, intravenously, intradermally, or subcutaneously, or a combination thereof.
27. The method of any of paragraphs 1-26, wherein the subject is also treated by surgical removal of the schwannoma.
28. The method of any of paragraphs 1-27, wherein the subject is not administered a viral vector comprising a caspase gene.
29. A viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D gene and a Schwann cell-specific promoter.
30. The vector of paragraph 29, wherein the viral vector is a recombinant adeno-associated virus (rAAV).
31. The vector of any of paragraphs 29-30, wherein the rAAV is of serotype AAV1 or AAV9.
32. The vector of any of paragraphs 29-31, wherein the Schwann cell specific promoter is upstream of the nucleic acid encoding ASC and/or gasdermin D.
33. The vector of any of paragraphs 29-32, further comprising a polyadenylation signal.
34. The vector of paragraph 29-33, wherein the polyadenylation signal is downstream of the nucleic acid encoding ASC and/or gasdermin D.
35. The vector of paragraph 29-34, wherein the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.
36. The vector of any of paragraphs 29-35, further comprising a first AAV inverted terminal repeat (ITR) located upstream of the Schwann cell specific promoter and a second AAV ITR located downstream of the polyadenylation signal.
37. The vector of paragraph 36, wherein the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.
38. The vector of any of paragraphs 29-37, wherein the vector is a polynucleotide.
39. The vector of any of paragraphs 29-38, wherein the vector is a single-stranded or double-stranded AAV.
40. The vector of any of paragraphs 29-39, wherein the vector is a self-complementary AAV (scAAV).
41. The vector of any of paragraphs 29-40, wherein the vector is a virus particle.
42. The vector of any of paragraphs 29-41, wherein the vector does not comprise a caspase gene.
43. A pharmaceutical composition comprising the viral vector of any of paragraphs 29-42 and a pharmaceutically acceptable carrier.
44. A kit comprising a composition comprising the viral vector of any of paragraphs 29-42 contained within packaging materials.

[0160] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs:

1. A method of treating a schwannoma in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a Schwann cell-specific promoter.
2. A method of inducing cell death of a target cell, the method comprising contacting the target cell with a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D.
3. The method of paragraph 2, wherein contacting step further comprises contacting the target cell with a viral vector comprising the nucleic acid encoding ASC and/or gasdermin D.
4. The method of any of paragraphs 2-3, wherein the target cell is a cancer and/or tumor cell.
5. The method of paragraph 4, wherein the nucleic acid encoding ASC and/or gasdermin D is operably linked to a cell-type specific promoter or a cancer and/or tumor cell-specific promoter.
6. The method of any of paragraphs 2-5, wherein the contacting step comprises administering the nucleic acid to a subject comprising the target cell.
7. A method of treating a tumor or neoplasm in a subject in need thereof, the method comprising administering a viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D operably linked to a cell-type specific promoter or a tumor cell-specific promoter.
8. The method of any of paragraphs 1-7, wherein the ASC and/or gasdermin D is a human, mouse, or rat ASC and/or gasdermin D.
9. The method of any of paragraphs 1-8, wherein the Schwann cell-specific promoter is a P0, a peripheral myelin protein 22 (PMP22), or a MBP promoter.
10. The method of any of paragraphs 1-9, wherein the promoter is a human or murine promoter.
11. The method of any of paragraphs 1-10, wherein the subject in need of treatment for a schwannoma, tumor, or neoplasm is a subject having or diagnosed as having a condition selected from the group consisting of: neurofibromatosis 1 (NF1); neurofibromatosis 2 (NF2); schwannomatosis; meningioma; nerve sheath tumor; schwannoma; vestibular schwannoma; sporadic schwannoma; neurofibrosarcoma; neurofibroma; neurofibromatosis (NF); malignant peripheral nerve sheath tumor; and a combination thereof.
12. The method of any of paragraphs 1-11, wherein the viral vector is a recombinant adeno-associated virus (rAAV).
13. The method of paragraph 12, wherein the rAAV is of serotype AAV1 or AAV9.
14. The method of any of paragraphs 1-13, wherein the Schwann cell specific promoter is upstream of the nucleic acid encoding ASC and/or gasdermin D.
15. The method of any of paragraphs 1-14, wherein the vector further comprises a polyadenylation signal.
16. The method of paragraph 15, wherein the polyadenylation signal is downstream of the nucleic acid encoding ASC and/or gasdermin D.
17. The method of paragraph 15 or 16, wherein the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.
18. The method of any of paragraphs 1-17, wherein the vector further comprises a first AAV inverted terminal repeat (ITR) located upstream of the Schwann cell specific promoter and a second AAV ITR located downstream of the polyadenylation signal.
19. The method of paragraph 18, wherein the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.
20. The method of any of paragraphs 1-19, wherein the vector is a polynucleotide.
21. The method of any of paragraphs 1-20, wherein the vector is a single-stranded or double-stranded AAV.
22. The method of any of paragraphs 1-21, wherein the vector is a self-complementary AAV (scAAV).
23. The method of any of paragraphs 1-22, wherein the vector is a virus particle.
24. The method of any of paragraphs 1-23, wherein the vector is administered directly to the tumor.
25. The method of any of paragraphs 1-24, wherein the vector is administered by intratumoral injection.
26. The method of any of paragraphs 1-25, wherein the vector is administered directly to a nerve affected by a schwannoma, tumor, or neoplasm.
27. The method of any of paragraphs 1-26, wherein administering is intranervously, intracranially, intratumorally, intramuscularly, intravenously, intradermally, or subcutaneously, or a combination thereof.
28. The method of any of paragraphs 1-27, wherein the subject is also treated by surgical removal or reduction of the schwannoma, tumor, or neoplasm.
29. The method of any of paragraphs 1-28, wherein the subject is not administered a viral vector comprising a caspase gene.
30. A viral vector comprising a nucleic acid encoding Apoptosis-associated Speck-like protein containing a CARD (ASC) and/or gasdermin D gene and a Schwann cell-specific promoter.
31. The vector of paragraph 30, wherein the viral vector is a recombinant adeno-associated virus (rAAV).
32. The vector of any of paragraphs 30-31, wherein the rAAV is of serotype AAV1 or AAV9.
33. The vector of any of paragraphs 30-32, wherein the Schwann cell specific promoter is upstream of the nucleic acid encoding ASC and/or gasdermin D.
34. The vector of any of paragraphs 30-33, wherein the promoter is a human or murine promoter.
35. The vector of any of paragraphs 30-34, further comprising a polyadenylation signal.
36. The vector of paragraph 30-35, wherein the polyadenylation signal is downstream of the nucleic acid encoding ASC and/or gasdermin D.
37. The vector of paragraph 30-36, wherein the polyadenylation signal comprises a bovine growth hormone polyadenylation signal (BGHpA), a SV40 polyadenylation signal or a rabbit beta-globin polyadenylation signal.
38. The vector of any of paragraphs 30-37, further comprising a first AAV inverted terminal repeat (ITR) located upstream of the Schwann cell specific promoter and a second AAV ITR located downstream of the polyadenylation signal.
39. The vector of paragraph 38, wherein the first or second AAV inverted terminal repeat comprises a deletion of the terminal resolution site.
40. The vector of any of paragraphs 30-39, wherein the vector is a polynucleotide.
41. The vector of any of paragraphs 30-40, wherein the vector is a single-stranded or double-stranded AAV.
42. The vector of any of paragraphs 30-41, wherein the vector is a self-complementary AAV (scAAV).
43. The vector of any of paragraphs 30-42, wherein the vector is a virus particle.
44. The vector of any of paragraphs 30-43, wherein the vector does not comprise a caspase gene.
45. A pharmaceutical composition comprising the viral vector of any of paragraphs 30-44 and a pharmaceutically acceptable carrier.
46. A kit comprising a composition comprising the viral vector of any of paragraphs 30-44 contained within packaging materials.

EXAMPLES

Example 1

[0161] Described herein are methods and compositions relating to the activation of the inflammasome and/or induction of apoptosis for the treatment of non-malignant tumors of the central and peripheral nervous system, such as meningioma, type 1 and 2 neurofibromatosis, and schwannomatosis. The inflammasome is a multiprotein structure responsible for: 1) inducing canonical caspase3/7 apoptosis, 2) inducing inflammatory cell death through pyroptosis, 3) releasing immuno-stimulatory cytokines to the extracellular milieu. Thus, this pathway can not only induce death of cancer cells, but also establishing a local zone of resistance or a systemic immune response that prevents formation of new tumors locally or distally.

[0162] As described herein, delivering activated genes downstream of the inflammasome pathway under the control of tumor-specific promoters (such as the P0 promoter of schwannoma cells) induces a death signal very specific to tumor cells without causing any toxicity in the surrounding normal tissue (such as neuronal toxicity when treating schwannomas established in peripheral nerves).

[0163] This treatment is particularly beneficial for non-malignant, non-neuronal, tumors of the central and peripheral nervous system as they develop in environments that frequently can not be operated upon without causing major damage, they are difficult to reach with pharmacotherapy, and permits selective targeted through specific genetic regulation. In addition, these tumors have the characteristic of developing in multiple sites over the patient's life span and therefore require the exploitation of the host's local and systemic immune response to be fully treated.

[0164] Also described herein are adeno-associated viruses, AAV1 and AAV9, activating the inflammasome-induced pyroptosis and apoptosis through the delivery of either Gasdermin D or ASC, respectively, under the control of P0 promoter.

[0165] ASC and Gasdermin D are downstream factors of different inflammasome pathways and they were found to be silenced and/or deleted in human cancers (Saeki N, 2009, PMID: 19051310). It is demonstrated herein that ASC is silenced in human schwannomas through methylation. These data indicate a crucial role for this signaling in controlling cancer progression and initiation. However, no publications have reported the use of these, or other inflammasome genes, for tumor treatment.

[0166] Described herein is the activation of the inflammasome for the treatment of tumors. Further described herein is the use of gene therapy for the above purpose, and the development of new AAV vectors (AAV1 and AAV9) carrying a downstream component of the inflammasome that was shown to be deleted/silenced in human tumors, specifically ASC or Gasdermin D, under the control of the schwannoma-specific promoter P0.

[0167] The methods and compositions described herein can relate to the treatment of schwannomas. Schwannomas are benign tumors associated with three different devastating neurological diseases with the following incidence: [0168] NF1-1:3000

NF2-1:35,000

[0169] Schwannomatosis-1:100,000 [0170] Meningiomas.-. 7:100,000

[0171] Even though these tumors are sometimes successfully removed surgically, in many other cases the surgery may cause debilitating neurological dysfunction or the tumors simply cannot be removed due to location. In addition, when the tumors are removed successfully they usually keep returning through the patient's life and each time they carrying a significant threat of severe neurological consequences. Unlike malignant cancers that are the result of multiple mutations and thus affect primarily the older population, these tumors are due to a single genetic mutation and usually occur in young adults and frequently also in children. Thus, the methods and compositions described herein can also be combined with surgical tumor removal to vaccinate the patients against the potential formation of other tumors. It is important to note that currently there are no pharmacologic means to treat these tumors.

Example 2: Adeno Associated Viral Vectors Delivery of Apoptosis-Associated Speck-Like Protein Containing a CARD Suppresses Schwannoma Tumor Growth in Mouse Models

[0172] Schwannomas are tumors of Schwann cells lineage which cause pain, sensory/motor dysfunction, and death through compression of peripheral nerves, the spinal cord, and/or the brain stem. Neurofibromatosis 2 (NF2) and schwannomatosis originate in children or young adults and develop in multiple locations throughout life. Currently there is no efficient treatment for these tumors, surgical resection is the main treatment approach but it is limited in scope and efficacy and has significant associated morbidity.

[0173] Described herein is the investigation of the epigenetic alteration and biological function of the pro-apoptotic gene ASC/TMS1 in human Schwannoma cell lines. In comparison to cultured human Schwann cells, ASC/TMS1 was down regulated in human Schwannoma cell line HEI-193 and human primary schwannoma cells from three different patients. The down-regulation of ASC/TMS1 was correlated with promoter hypermethylation. Ectopic over expression of ASC in NF2 cells resulted in a significant cell death which is likely due to activation of apoptotic caspase 9 and 3 in addition to direct interaction with pro-apoptotic proteins such as BID. Intra-tumoral injection of an adeno-associated virus (AAV) serotype 1 vector encoding (ASC) under the Schwann-cell specific promoter, P0, lead to significant reduction of the tumor growth in schwannoma mouse model in which immortalized human NF2 schwannoma cells expressing luciferase are implanted in the sciatic nerve of nude mice. The tumor growth reduction is concomitant with resolution of tumor-associated pain, no vector-mediated neuropathology, and no changes in sensory or motor function.

[0174] Schwannomas are slow growing tumors of Schwann cells origin (1, 2). In 60% of the cases these lesions arise in children and young adults and new tumors continue to develop in multiple locations throughout the patient's life (3). Schwannomas lack expression of a functional neurofibromatosis type 2 (NF2) protein, merlin/schwannomin (4, 5). Merlin is a unique member of the ezrin-radixin-moesin gene family with tumor-suppressing activities (6). Its over-expression was shown to reduce cell growth which is associated with cell-cycle arrest and apoptosis (7, 8). Current treatment is limited to resection, which is not always possible because of the risk of nerve or brain stem damage and consequently possible sensory loss (including deafness and pain) and motor dysfunction. Clinical trials testing cancer chemotherapeutics, such as anti-angiogenic compounds and small molecules, are ongoing, but long-lasting significant therapeutic effect has not been proven yet.

[0175] Schwannomas are appropriate targets for gene therapy, as they grow slowly and can be readily localized using magnetic resonance imaging (MRI). The advantage of gene-therapy over surgical resection is that the former utilizes a minimally invasive procedure (image guided needle injection).

[0176] A complex multiprotein structure called the inflammasome is responsible for inducing apoptotic cell death and inflammatory responses. The inflammasome activates a subset of caspases known as the inflammatory caspases, such as caspase-1 (13). When stimulated, inflammasomes assemble to represent the first line of host defense through proteolytic activation of caspase-1 which in turn maturates cytokines interleukin -1B and interleukin 18 and initiate an inflammatory cell death named as pyroptosis (14, 15, 16). The work described herein utilizes the only broadly accepted NF2 cell line model HEI-193.

[0177] Apoptosis-associated speck-like protein containing a CARD (caspase recruitment domain) (ASC or Pycard) is the main and most critical required adaptor that recruits caspase-1 to inflammasome complex (17). ASC is an intracellular signaling molecule consisting of an N-terminal pyrin domain (PYD) and a C-terminal CARD. PYD and CARD domains are death domains that mediate the assembly of large signaling complexes in apoptotic and inflammatory signaling pathways (18). ASC is also referred to as target of methylation-induced silencing (TMS1).

[0178] Matched primary schwannoma and schwann cell lines were screened for the expression of the inflammasome components which have the key role in mediating caspase1 biological effect. In the present study, the data indicate that ASC is epigenetically silenced by methylation in human NF2 cancer cell line (HEI-193) and primary human Schwannoma samples. In vitro over-expression of ASC gene in different NF2 cells resulted in a significant cell death. The data also demonstrated that the effect is likely due to activation of apoptotic caspase 9 and 3 in addition to direct interaction with pro-apoptotic proteins such as BID.

[0179] Also described herein is the development of a gene therapy vector using adeno-associated virus (AAV) to deliver ASC under a Schwann specific cell promoter (P0). AAV-P0-ASC direct intra sciatic nerve injection into the tumor of immune-compromised Schwannoma mice model resulted in a significant reduction in tumor growth, as assessed by in vivo bioluminescence imaging and correlative histopathology. In a proximal sciatic nerve implantation model, designed to cause pain like behavior as assessed by plantar von Frey withdrawal threshold (i.e., mechanical sensitization) and Hargreaves withdrawal latency (i.e. thermal sensitization), intratumoral AAV1-P0-ASC injection alleviated pain sensitivity in parallel with tumor growth inhibition.

[0180] Results

[0181] mRNA expression of ASC/Pycard/TMS1 was analyzed by quantitative RT-PCR in cultured Schwann cells, Schwannoma HEI193 cell lines and three human primary schwannoma cultured cells. The results demonstrated that ASC was down-regulated or silenced in the Schwannoma cells. However, cultured Schwann cells showed higher expression of ASC (FIG. 1A). Exploration of the ASC CpG rich promoter hypermethylation by methylation specific PCR (MS-PCR) revealed full methylation of ASC in the schwannoma cells while no methylation was detected in the cultured Schwann cells ASC (FIG. 1B).

[0182] Further characterization and validation of the methylation density within the ASC promoter was performed using bisulfite genome sequencing. The sequencing data were consistent with those of MS-PCR. Massive methylation was found in the tumor cells, not in the normal cultured cells (FIGS. 2A-2B).

[0183] In vitro effect of ASC over expression on human and mouse Schwannoma cell lines. Human and mouse ASC were cloned into AAV plasmid backbones down-stream of constitutive CBA promoter. Transfection of human schwannoma cell lines (HEI-193) and two mouse schwannoma cell lines (08031-9 and NF2S1) showed significant reduction in cell viability and significant cell death as indicated by increased LDH release upon over expression of ASC into the Schwannoma cells (FIG. 3).

[0184] Further, an increase of caspase 3/7 activity and caspase 9 activity was observed by colorimetric luminescence assays after transfection of HEI-193 with pAAV-CBA-hASC in comparison to the cells transfected with pAAV-CBA-GFP control plasmid and non transfected cells (FIG. 4B). Induction of apoptosis was additionally assessed by immunoblot detection of caspase 1, 3, 7, 8 and 9. As shown in FIG. 4A, over-expression of ASC/TMS1 enhanced the levels of active form of caspase 3 and 9 and expression of pro-apoptotic factor BID.

[0185] To determine whether the ASC/TMS1-mediated growth inhibition was the result of caspases induced apoptosis, in vitro apoptosis staining was performed using TACS 2 TdT-DAB In situ Apoptosis Detection kit (Trevigen). Over expression of ASC/TMS1 resulted in a significant increase in apoptotic cells as compared with vector control in HEI-193 cells. Pan caspase inhibitor (ZVADFMK) and Caspase3 inhibitor (ZDEVDFMK (DEVD is disclosed as SEQ ID NO: 13)) were shown to inhibit the apoptotic effect of ASC (FIGS. 5A-5B).

[0186] Effects of delivery of AAV1-P0-ASC vectors to schwannomas. The therapeutic efficacy of the AAV1-P0-ASC vector was tested in a mouse model in which schwannomas are generated via implantation of HEI-193FC cells in the sciatic nerve of nude mice. Two independent experiments were done in which control group was injected with either AAV-P0-null or PBS. Intratumoral injection of the AAV1-P0-ASC, AAV1-P0-null or PBS was performed at the site of early HEI-193FC tumor formation prevented further growth as assessed by in vivo bioluminescence imaging over a 6 weeks period after vector injections (FIGS. 6A-6B). Two-way ANOVA with repeated measures revealed a significant effect of AAV1-P0-ASC treatment.

[0187] The difference in tumor growth between the two groups was further confirmed by hematoxylin and eosin staining of nerve sections where a clear difference in tumor size could be observed. Also, staining of the nerves for proliferation or apoptosis marker revealed a clear difference between the two groups, with the ASC injected mice showing less proliferation and more apoptotic bodies than the null injected group (FIGS. 7A-7B).

[0188] AAV1-P0-ASC delivery into Schwannoma tumor reduces the induced pain like behavior. As persistent pain can be a major clinical issue in patients with schwannomatosis and NF2. An experimental Schwannoma model was generated to mimic the clinical schwannoma pain by implanting the HEI193FC more proximal into the sciatic nerve which is limited by Pelvic structure. Consequently, tumor expansion would lead to mechanical sensitization and pain like behavior. The Sensory/pain and motor function was assessed after injection of AAV1-P0-ASC or AAV1-P0-Null nude mice that were implanted with HEI193FC tumor cells in the sciatic nerve. Mechanical (pain) sensitivity (allodynia) was tested with von Frey filaments to establish withdrawal threshold of the hind paw ipsilateral to the injected sciatic nerve. Thermal (Pain) sensitivity was tested with Plantar Test (Hargreaves' Method) by positioning a movable infra red source underneath the mouse hind paw, pain sensitivity assessed by measuring the withdrawal latency. Gross motor performance was assayed by the accelerating rotarod test. Schwannoma growth was associated with a significant decrease in the von Frey threshold and Hargreaves withdrawal latency in the hind paw ipsilateral to tumor site starting at 4 weeks post-implantation. AAV1-P0-ASC injection led to a statistically significant regression of tumors and an associated return of von Frey threshold and Hargreaves withdrawal latency values to baseline (i.e., normalization of pain sensitivity) as indicated in FIG. 8.

[0189] Materials and Methods

[0190] Cell culture and transfection. The HEI-193 human schwannoma cell line was established from a schwannoma in a patient with NF2, immortalized with human papillomavirus E6/E7 genes (31) and maintained in Dulbecco's modified Eagle's medium (DMEM) with 2 uM forskolin (Calbiochem, San Diego, Calif.), recombinant human glial growth factor (14 ng/ml; Sigma-Aldrich, St. Louis, Mo.), and G418 disulfate salt (50 ug/ml; Sigma-Aldrich). Mouse NF2S-1 schwannoma cells were generated from a spontaneous tumor that formed in nu/nu mice (NCI) and grown as described (32). Mouse 08031-9 cells were grown as described (33). All cells were infected with lentivirus encoding Fluc and mCherry (34). For all cell types, growth media were supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich) and 1% penicillin-streptomycin (Cellgro, Herndon, Va.) and cells were maintained at 37 C. in a humidified atmosphere of 5% CO2 and 95% air. Human Primary Schwannoma cells were maintained in the same medium as HEI-193. Human Primary Schwann cells culture were obtained from (Sciencells, USA) and maintained in the same medium as for HEI193. For transfections in 24-well format, 100,000 cells were seeded 24 hours prior to transfection. 1 l of liofectamine 2000 (Invitrogen, USA) was used for every 500 ng of transfected plasmid in FBS free medium (Optimem, Invitrogen, USA). The DNA/Lipofectamine mix was incubated at room temperature for 30 minutes before spread over the cells and left for 5-6 hours then replaced by fresh medium. The amount of plasmid/lipofectamine was scaled up according to the plate format used.

[0191] Real-time quantitative PCR analyses. RNA isolation from tissue samples was conducted with TRIzol reagent according to the manufacturer's instructions (Qiagen, USA) and transcribed into cDNA using superscript VILO cDNA synthesis kit (Invitrogen, USA). Taqman real-time PCR was carried out using RealPlex MasterCycler (eppendorf, USA). The difference of Ct values between gene of interest (ASC) and reference gene 18S, (DCt) was translated into a relative expression of ASC. Taqman probes were purchased from life technologies, USA.

[0192] Methylation-specific PCR. gDNA isolated from cultured cells was subjected to bisulfite conversion using the EZDNA Methylation Kit (Zymo Research) according to the manufacturer's directions. Essentially, bisulfite treatment converts non-methylated cytosines into uracil via deamination, which is replicated as thymidine during PCR. In contrast, 5-methyl cytosines are protected and thus identified as cytosines in the resultant PCR product. Briefly, 2 ug of denatured DNA from cell lines was incubated for 4.5 hr in sodium bisulfite and then desalted in DNA-binding columns. Desulphonation by incubation in sodium hydroxide was carried out within the column. The modified DNA was eluted in 20 ul elution buffer, and 50 ng of the recovered DNA was used for MS-PCR analysis. MS-PCRP was performed using primers for the methylated (M) and unmethylated (U) ASC as described (35). Bisulfite modified DNA was amplified by PCR using HotStarTaq Master mix kit from Qiagen, USA with the following reaction conditions: 12.5 ul master mix, 2.5 ul of 10uM primer mix, 50 ng of bisulfite-modified DNA in a final volume of 25 ml. The conditions of the MS-PCR were as follow: 95 C. for 15 min for denaturation, 35 cycles of amplification (94 C., 30 sec; 58 C. 30 sec; 72 C., 45 sec) with a final elongation step of 10 min at 72 C. Reaction products were separated by electrophoresis on a 3% agarose gel, stained with ethidium bromide, and visualized under UV illumination.

[0193] Bisulfite genomic sequencing. Genomic DNA was subjected to bisulfite conversion using the EZDNA Methylation Kit (Zymo Research) according to the manufacturer's directions. Bisulfite-modified DNA (50 ng) was amplified by nested PCR for bisulfite sequencing under the following reaction conditions: HotStarTaq Master mix kit from Qiagen, USA. with the following reaction conditions: 12.5 ul master mix, 2.5 ul of 10uM primer mix, 50 ng of bisulfite-modified DNA in a final volume of 25 ml. The condition of the PCR reaction was as follows: 95 C. for 15 min for denaturation, 35 cycles of amplification (94 C., 30 sec; 57 C. 30 sec; 72 C., 45 sec) with a final elongation step of 10 min at 72 C. Primers were designed to avoid potential methylation sites (CpGs) so that both methylated and unmethylated DNA would be amplified equally. The first primer set was: 5 GGGGATTTTGGAGTTATGGGG 3 (SEQ ID NO: 14) and 5 AAATAATCCCCTTCCCTTCCC 3 (SEQ ID NO: 15). The second PCR round was done using 1/1000 dilution of the PCR product and the following primer set: 5 AAGAAGTTTAAGTTGAAGTTGTTGT 3 (SEQ ID NO: 16) and 5 ACCATCTCCTACAAACCCATATC 3 (SEQ ID NO: 17). The resulting amplification pools were sub-cloned into the pCRII-TOPO vector using the TOPO TA Cloning kit (Invitrogen). 3-7 individual subclones were isolated per PCR reaction and sequenced by the MGH DNA sequencing core facility. Analysis of the sequencing results was done using BiQAnalyzer software.

[0194] AAV plasmids and viral vectors production. AAV vector plasmid dsAAV-CBA-ASC was derived from dsAAV-CBA-BGHpA. dsAAV-P0-ASC and dsAAV-P0-Null plasmids were derived from the plasmid dsAAV-P0-ICE. These plasmids carry two AAV inverted terminal repeat (ITR) elements, one wild type and one in which the terminal resolution site was deleted, as described (36), generating a vector that is packaged as a double-stranded molecule. The dsAAV-rP0-null was generated by cutting the ICE transgene off the dsAAV-rP0-ICE using ECORV. The resulted self ligated vector is dsAAV-rPO-null. The dsAAV-P0-ASC plasmid was generated by inserting PCR-amplified hASC (600 bp) into the dsAAV-rP0-null that was linearized with ECORV.

[0195] The Primers that were used for ASC amplification contain ECORV restriction site, the sequences are: Forward 5GTGATATCGCCACCAtGGGGCGCGCGCGCG3 (SEQ ID NO: 18) and reverse 5AGGATATCCTAGCTCCGCTCCAGGTCCTCC 3 (SEQ ID NO: 19). The dsAAV-CBA-ASC plasmid was produced through inserting PCR-amplified hASC (600 bp) into the dsAAV-CBA-BGHpA that was linearized with HindIII and SpeI.

[0196] The Primers that were used for ASC amplification contain HindIII and SpeI restriction site, the sequences are: Forward 5GTCAAGCTTGCCACCAtgGGGCGCGCGC3 (SEQ ID NO: 20) and reverse 5CAACTAGTCTAGCTCCGCTCCAGGTCCT3 (SEQ ID NO: 21). All AAV vectors carry the bovine growth hormone polyadenylation signal. The identity of all the cloned transgenes was confirmed by sequencing.

[0197] AAV1 serotype vectors were produced by transient co-transfection of 293T cells by calcium phosphate precipitation of vector plasmid (dsAAV-P0-ASC or dsAAV-P0-null), adenoviral helper plasmid pFD6, and a plasmid encoding the AAV1 cap gene (pXR1), as previously described (37). Briefly, AAV vectors were purified by iodixanol gradient centrifugation followed by column chromatography with HiTrap Q anion-exchange columns (GE Healthcare, Piscataway, N.J.). The virus-containing fractions were concentrated with Centricon 100-kDa molecular weight cutoff (MWCO) centrifugal devices (Millipore, Billerica, Mass.) and the titer (genome copies [GC]/ml) was determined by real time PCR amplification with primers and probe specific for the bovine growth hormone polyadenylation signal.

[0198] Cell viability and toxicity assay. The Cell Titer-Glo luminescent cell viability assay (Promega, Madison, Wis.) was used to determine the number of viable cells in culture on the basis of quantitation of ATP levels, an indicator of metabolically active cells. The kit detects as few as 15 cells per well 10 min after adding reagent and mixing, resulting in cell lysis and the generation of a luminescent signal proportional to the amount of ATP present. Hundred thousand HEI-193, NF2S1 or 08031-9 cells were plated into the wells of 24-well plates and transfected by lipofectamine in triplicate with the AAV-CBA-ASC or AAV1-CBA-GFP. After 24 hr, medium was aspirated off and cells were incubated in 100 ul of fresh medium containing 100 ul of CellTiter-Glo reagent for 10 min at room temperature. The luminescence was measured with a luminometer (Dynex Technologies, Chantilly, Va.). Cell death was measured by the LDH assay using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega) according to the manufacturer's instructions.

[0199] Western Not analysis. Cells were washed with cold PBS and total protein was extracted with RIPA lysis buffer (Sigma, USA), supplemented with cocktail protease inhibitor. Equal amounts of proteins were separated by 10-12% SDS-PAGE gel and then transferred onto nitrocellulose membranes. After blocking the membranes with 5% fat free milk in TBST for 1 h at room temperature, the membranes were incubated with specific primary antibodies overnight at 4 C. After washing, the membrane was incubated with HRP-conjugated secondary antibodies for 1 h at room temperature and then washed with TBST. The antibody complexes in the immunoblots were detected by chemiluminescence using an ECL (BIORAD, USA), and visualized using a ChemiDoc Gel Documentation System (BIORAD, USA). Antibodies used were rabbit anti caspase 1 (CST, USA), rabbit anti caspase 3 (CST, USA), rabbit anti caspase 7 (CST, USA), mouse anti caspase 9 (CST, USA), mouse anti caspase 8 (CST, USA), rabbit anti BAX (CST, USA), rabbit anti RIP2 (CST, USA), rabbit anti BID (CST, USA), rabbit anti BCL-2 (CST, USA), mouse anti P53 (Sigma, USA) and rabbit anti NFkB p65 (Santa Cruz, USA).

[0200] Assay of activated caspases. Caspase 3/7 assays (G8090, Promega) were performed according to the manufacturer's instructions. Briefly, 100,000 cells/well were plated overnight in a 24-well plate. Cells were transfected as described in the cell culture section. To measure caspase 3/7 activity, 100 uL of caspase Glo 3/7 reagent was added to 100 ul cells growing medium to each well for 2 h with constant shaking at room temperature. Caspase8 and 9 assays were done in the same procedure using Caspase 8 Glo assay (G8200, Promega) and caspase 9 Glo assay (G8210, Promega). Luminescence was measured using a Biotek synergy plate reader. Colorimetric caspase-1 activity assay was measured using Caspase-1/ICE Colorimetric Assay Kit (Biovision, USA) according to the manufacturer instructions.

[0201] Animals. All animal experimentation was approved by and conducted under the oversight of the Massachusetts General Hospital (Boston, Mass.) Institutional Animal Care and Use Committee. Animals, nu/nu and C57BL/6 mice, were kept on a 12:12 light-to-dark cycle with ad libitum access to food and water. Animals were checked daily to evaluate health.

[0202] Generation of tumors and vector injection. Sciatic nerve schwannomas were generated by direct injection of schwannoma cells into the left sciatic nerve of isoflurane-anesthetized mice, as described (38). Specifically, cells were implanted approximately 4 mm distal to the sciatic notch at a point midway between the sciatic notch and the trifurcation of the sciatic nerve into the common peroneal, tibial, and sural branches. HEI-193FC cells were trypsinized and rinsed with PBS, and 30,000 cells in a volume of 0.5 ul of PBS were injected into the sciatic nerve of athymic nude mice (nu/nu, 5-7 week-old males; National Cancer Institute [NCI]), using a glass micropipette and a gas-powered microinjector (IM-300; Narishige, Tokyo, Japan). Tumor growth was monitored by in vivo bioluminescence imaging at weekly intervals, as described (34). Briefly, mice were injected intraperitoneally with the Fluc substrate d-luciferin, and, 10 min later, signal was acquired with a high efficiency IVIS Spectrum (Caliper Life Sciences, Hopkinton, MA). Tumors were injected with PBS, AAV1-P0-ASC or AAV1-P0-null three weeks post implantation, with 10E10 vector GC in 2 ul PBS, targeting the enlarged part of the nerve where tumor cells were implanted. Volumetric changes in tumors were tracked by in vivo bioluminescence imaging.

[0203] Behavioral analysis. The mice were tested by the von Frey method for pain/mechanical sensitivity, Hargreaves plantar test for Pain/Thermal sensitivity and by rotarod for gross motor function according to published methods (39, 40, and 41). Both nu/nu and C57BL were used for the behavioral experiments. Two microlitres of the vector AAV1-P0-ASC, AAV1-P0-null, or PBS were injected into the sciatic nerve (n=8 per group). All animals were allowed to habituate to the behavioral apparatus for 1 week before testing for baseline. Three baseline measurements on three separate days preceded the first injection. Mice were then tested the day after each injection and twice per week for 8 weeks. Mechanical sensitivity of the hind paw was measured by determining withdrawal thresholds assessed with von Frey filaments employed to determine mechanical sensitivity of the plantar surface of the hind paw, as described in (Prabhakar et. al 2013). The 50% threshold for each paw withdrawal was calculated, as previously described (42). Thermal sensitivity of the hind paw was measured by determining withdrawal latency assessed with Hargreaves plantar test, as described (41). A rotating rod apparatus (Columbus Instruments, Columbus, Ohio) was used to assess motor performance. Mice were placed on the elevated accelerating rod beginning at 1 rpm/min for two trials per day twice per week. Animals fall latency (in seconds) was scored, as described (Prabhakar et. al 2013).

[0204] Apoptosis assay. In-vitro DNA fragmentation of apoptotic cells was assessed TACS 2 TdT-DAB in Situ Apoptosis Detection Kit. In brief, HEI-193 cells on the coated cover glass and transfected with dsAAV-CBA-ASC or dsAAV-CBA-GFP. Fragmented DNA were visualized with diaminobenzidine (DAB) and viewed by light microscope. In-vivo apoptosis study was assessed using the same kit on fresh frozen nerves that were sliced to 15um thin sections using cryostat and fixed in 3.7% formaldehyde.

[0205] Histological and Immunohistochemistry analysis. After treatment with vectors, the animals were anesthetized with isoflurane (3%) followed by decapitation. Sciatic nerves were taken out and snap frozen for hematoxylin and eosin (H&E) and immunohistochemistry staining, as described (43). The sciatic nerves were kept in OCT blocks at 80 C. Sections were stained with H&E in accordance with routine protocols. Proliferation marker staining was performed using antibody against Ki67 (Abcam, USA). Briefly, sections were dried at RT overnight. They were fixed in pre-chilled acetone for 10 minutes before re-drying them at room temperature prior to the staining. Sections were washed in PBS, blocked for endogenous background with protein block serum free (Dako, USA) and quenched for peroxidases in Dual endogenous enzyme block (DAKO, USA). Sections were washed in PBS then incubated with primary antibody against Ki67 for 1 hour at room temperature. They were washed in PBS and incubated with secondary antibody conjugated with horseradish peroxidase for thirty minutes at room temperature. Sections were washed in PBS, incubated with DAB solution (DAKO, USA) for few minutes. Counterstaining was done by dipping the sections in ethanol and xylene before mounting in cytoseal and covered by cover slips for microscopic visualization.

[0206] Data analysis. All data are presented as group averagesSEM. The baseline value for all tests before injection used the average of all measurements before injection. Data were analyzed with graphpad prism and Microsoft EXCEL. The significance of differences between two groups was determined using a two-tailed t-test. Repeated-measure analysis of variance (ANOVA) was used when data were collected in multiple trials, as described (44). p<0.05 was accepted as significant.

REFERENCES

[0207] 1Lu-Emerson, C. and S. R. Plotkin, The neurofibromatoses. Part 2: NF2 and schwannomatosis. Rev Neurol Dis, 2009. (3): p. E81-6. [0208] 2Evans, D. G., Neurofibromatosis type 2 (NF2): a clinical and molecular review. Orphanet J Rare Dis, 2009.: p. 16. [0209] 3Antinheimo, J., Sankila, R., Carpe'n, O., et al. (2000). Population based analysis of sporadic and type 2 neurofibromatosis associated meningiomas and schwannomas. Neurology 54, 71-76 [0210] 4Trofatter J A, MacCollin M M, Rutter J L, Murrell J R, Duyao M P, Parry D M, et al. A novel moesin-, ezrin-, radixin-like gene is a candidate for the neurofibromatosis 2 tumor suppressor. Cell 1993; 72:791-800. [0211] 5'Rouleau G A, Merel P, Lutchman M, Sanson M, Zucman J, Marineau C, et al. Alteration in a new gene encoding a putative membrane-organizing protein causes neuro-fibromatosis type 2. Nature 1993; 363:515-21. [0212] 6Bretscher A, Edwards K, Fehon R G. ERM proteins and merlin: integrators at the cell cortex. Nat Rev 2002; 3:586-99. [0213] 7Lutchman M, Rouleau G A. The neurofibromatosis type 2 gene product, schwannomin, suppresses growth of NIH 3T3 cells. Cancer Res 1995; 55:2270-4. [0214] 8Schulze K M, Hanemann C O, Muller H W, Hanenberg H. Transduction of wild-type merlin into human schwannoma cells decreases schwannoma cell growth and induces apoptosis. Hum Mol Genet 2002; 11: 69-76. [0215] 9Hung, G., Li, X., Faudoa, R., et al. (2002). Establishment and characterization of a schwannoma cell line from a patient with neurofibromatosis 2. Int. J. Oncol. 20,475-482 10-Prabhakar, S., Brennan, G. J., Messerli, S. M., et al. (2010). Imaging and therapy of experimental schwannomas using HSV amplicon vector-encoding apoptotic protein under Schwann cell promoter. Cancer Gene Ther. 17,266-274. [0216] 11Saydam, O., Ozdener, G. B., Senol, O., et al. (2011). A novel imaging-compatible sciatic nerve schwannoma model. J. Neurosci. Methods 195, 75-77 [0217] 12Shilpa Prabhakar, Gary J. Brenner, et al. (2013). Regression of Schwannomas Induced by Adeno-Associated Virus-Mediated Delivery of Caspase-1. Hum Gene Ther 24:152-162 [0218] 13Schroder K, Tschopp J. 2010. The inflammasomes. Cell 140: 821-832. [0219] 14Strowig T, Henao-Mejia J, Elinav E, Flavell R. 2012. Inflammasomes in health and disease. Nature 481: 278-286. [0220] 15de Zoete M R, Flavell R A. 2013. Interactions between Nodlike receptors and intestinal bacteria. Front Immunol 4:462. [0221] 16Latz E, Xiao T S, Stutz A. 2013. Activation and regulation of the inflammasomes. Nat Rev Immunol 13: 397-411 [0222] 17McConnell B B, Vertino P M. TMS1/ASC: the cancer connection. APOPTOSIS. 2004; 9:518. [0223] 18Conway K E, McConnell B B, Bowring C E, Donald C D, Warren S T, Vertino P M (2000) TMS1, a novel proapoptotic caspase recruitment domain protein, is a target of methylation-induced gene silencing in human breast cancers. Cancer Res 60:6236-6242 [0224] 19McConnell B B, Vertino P M. Activation of a caspase-9-mediated apoptotic pathway by subcellular redistribution of the novel caspase recruitment domain protein TMS1. CANCER RES. 2000; 60:6243-6247 [0225] 20Masumoto J, Dowds T A, Schaner P, Chen F F, Ogura Y, Li M, Zhu L, Katsuyama T, Sagara J, Taniguchi S, Gumucio D L, Nunez G, Inohara N. ASC is an activating adaptor for NF-kappa B and caspase-8-dependent apoptosis. BIOCHEM BIOPHYS RES COMMUN. 2003; 303:69-73 [0226] 21Jeoffrey J Levine1, Krista M Stimson-Crider1 and Paula M Vertino. Effects of methylation on expression of TMS1/ASC in human breast cancer cells. Oncogene (2003) 22, 3475-3488 [0227] 22Kerry E. Conway,2 Beth B. McConnell, 2 Claire E. Bowring, Carlton D. Donald, Stephen T. Warren, and Paula M. Vertino3. TMS1, a Novel Proapoptotic Caspase Recruitment Domain Protein, Is a Target of Methylation-induced Gene Silencing in Human Breast Cancers1. CANCER RESEARCH 60, 6236-6242, Nov. 15, 2000 [0228] 23Partha M Das1, Kavitha Ramachandran1, Jane VanWert1, Larry Ferdinand1, Gopal Gopisetty1, Isildinha M Reis1 and Rakesh Singal. Methylation mediated silencing of TMS1/ASC gene in prostate cancer. Molecular Cancer 2006, 5:28ol [0229] 24Guan X, Sagara J, Yokoyama T, Koganehira Y, Oguchi M, Saida T, Taniguchi S: ASC/TMS1, a caspase-1 activating adaptor, is down regulated by aberrant methylation in human melanoma. Int J Cancer 2003, 107:202-208. [0230] 25Stone A R, Bobo W, Brat D J, Devi N S, Van Meir E G, Vertino P M: Aberrant methylation and down-regulation of TMS1/ASC in human glioblastoma. Am J Pathol 2004, 165:1151-1161. [0231] 26D. M. Kordi Tamandani1,2, R. C. Sobti1, M. Shekari1,3, A. Huria4 CPG ISLAND METHYLATION OF TMS1/ASC AND CASP8 GENES IN CERVICAL CANCER. Eur J Med Res (2009) 14: 71-75 [0232] 27KAVITHA RAMACHANDRAN*, HEATHER MILLER*, EDNA GORDIAN, CAIO ROCHA-LIMA and RAKESH SINGAL. Methylation-mediated Silencing of TMS1 in Pancreatic Cancer and its Potential Contribution to Chemosensitivity. ANTICANCER RESEARCH 30: 3919-3926 (2010 [0233] 28C Zhang,1# H Li,2# G Zhou,1* Q Zhang,1 T Zhang,1 J Li,1 J Zhang,1 J Hou,1 CT Liew2 and D Yin3. Transcriptional silencing of the TMS1/ASC tumour suppressor gene by an epigenetic mechanism in hepatocellular carcinoma cells. J Pathol 2007; 212: 134-142 [0234] 29Dhillon V S, Aslam M, Husain S A: The contribution of genetic and epigenetic changes in granulosa cell tumors of ovarian origin. Clin Cancer Res 2004, 10:5537-5545. [0235] 30Terasawa K, Sagae S, Toyota M, Tsukada K, Ogi K, Satoh A, Mita H, Imai K, Tokino T, Kudo R: Epigenetic inactivation of TMS1/ASC in ovarian cancer. Clin Cancer Res 2004, 10:2000-2006. [0236] 31Hung, G., Li, X., Faudoa, R., et al. (2002). Establishment and characterization of a schwannoma cell line from a patient with neurofibromatosis 2. Int. J. Oncol. 20, 475-482. [0237] 32S Prabhakar1,2, S M Messerli1,2,5, A O Stemmer-Rachamimov3, T-C Liu4, S Rabkin4, R Martuza4 and XO Breakefield. Treatment of Implantable NF2 Schwannoma Tumor Models with Oncolytic Herpes Simplex Virus G47D. Cancer Gene Therapy (2007) 14, 460-467. [0238] 33Karo Tanaka1, Ascia Eskin3, Fabrice Chareyre1, Walter J. Jessen6, Jan Manent7, Michiko Niwa-Kawakita8, Ruihong Chen5, Cory H. White2, Jeremie Vitte1, Zahara M. Jaffer1, Stanley F. Nelson3, Allan E. Rubenstein9, and Marco Giovannini1. Therapeutic Potential of HSP90 Inhibition for Neurofibromatosis Type 2. Clin Cancer Res 2013; 19:3856-3870 [0239] 34S Prabhakar1,2,3, G J Brenner1,4, B Sung1,5, SM Messerli1,2,3,8, J Mao1,5, M Sena-Esteves1,2,3, A Stemmer-Rachamimov1,6, B Tannous1,2,7, and XO Breakefield1,2,6,7 Imaging and therapy of experimental schwannomas using HSV amplicon vector-encoding apoptotic protein under Schwann cell promoter. Cancer Gene Ther. 2010 April; 17(4): 266-274 [0240] 35Xiao-Fang Liu, Shi-Guang Zhu, Hao Zhang, Zheng Xu, Hai-Long Su, Shao-Jun Li and Xian-Ting Zhou. The methylation status of the TMS1/ASC gene in cholangiocarcinoma and its clinical significance. Hepatobiliary Pancreat Dis Int 2006; 5: 449-453 [0241] 36McCarty, D. M., Fu, H., Monahan, P. E., et al. (2003). Adenoassociated virus terminal repeat (TR) mutant generates self complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10, 2112-2118 [0242] 37Broekman, M. L., Comer, L. A., Hyman, B. T., and Sena-Esteves, M. (2006). Adeno-associated virus vectors serotyped with AAV8 capsid are more efficient than AAV-1 or -2 serotypes for widespread gene delivery to the neonatal mouse brain. Neuroscience 138, 501-510. [0243] 38Saydam, O., Ozdener, G. B., Senol, O., et al. (2011). A novel imaging-compatible sciatic nerve schwannoma model. J. Neurosci. Methods 195, 75-77. [0244] 39Agarwal, N., Pacher, P., Tegeder, I., et al. (2007). Cannabinoids mediate analgesia largely via peripheral type 1 cannabinoid receptors in nociceptors. Nat. Neurosci. 10, 870-879 [0245] 40Kirschbaum, K. M., Hiemke, C., and Schmitt, U. (2009). Rotarod impairment: Catalepsy-like screening test for antipsychotic side effects. Int. J. Neurosci. 119, 1509-1522 [0246] 41Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 1988; 32:77-88 [0247] 42Chen, Q., Peto, C. A., Shelton, G. D., et al. (2009). Loss of modifier of cell adhesion reveals a pathway leading to axonal degeneration. J. Neurosci. 29 ,118-130 [0248] 43Messerli, S. M., Tang, Y., Giovannini, M., et al. (2002). Detection of spontaneous schwannomas by MRI in a transgenic murine model of neurofibromatosis type 2. Neoplasia 4, 501-509 [0249] 44Harris, J. E., Sheean, P. M., Gleason, P. M., et al. (2012). Publishing nutrition research: A review of multivariate techniques. 2. Analysis

Example 3

[0250] FIG. 11 demonstrates the expression driven by different schwannoma promoters in the indicated cell types. The PMP22, P0, and MBP promoters demonstrate schawnn cell-specific expression.

Example 4

[0251] Gasdermin D expression in schwannomas was demonstrated to kill the schwannoma cells (FIG. 12). Gasdermin D was delivered using mouse and/or human gasdermin D under the control of the CBA promoter in an AAV vetor. In the experiments depicted in FIG. 12, the portion of gasdermin D which is N-terminal of the caspase cleavage site (e.g., after Asp275 in human gasdermin D or Asp276 in mouse gasdermin D) was utilized.

Example 5

[0252] The expression of ASC upon injection of AAV1-rP0-hASC into Schwannoma mouse model is demonstrated in FIG. 13. HEI-193FC cells were implanted into nude mice. AAV1-rP0-hASC or AAV1-rP0-null ws injected at three weeks post implantation. Nerves were harvested for protein extraction 1 week after injection. Protein levels were quantified by western blotting. The results demonstrate increased human ASC protein expression following injection of AAV-P0-ASC into intrasciatic HEI-193 tumors.

Example 6

[0253] 2109 pfu's of virus (in a volume of 2 microliters) was delivered via direct injection into HEI-193 tumors growing in the left sciatic nerve of nu/nu mice. Error bars show SEM. N=7-8 mice per group. ANOVA indicated a significant effect of AAV-rP0-mGASD-N treatment compared to control virus at a significance level of p=0.0016. There was no significant interaction between treatment and time post virus injection (p=0.68).

Example 7

[0254] ASC expression is decreased in schwannomas, e.g., as compared to healthy peripheral nerve cells (FIGS. 15A-15G). The downregulation of ASC was observed in cell lines and primary schwannoma cells (including 6 different human schwannomas). The decrease in expression correlates to promoter methylation and the methylation is reversible, e.g., when treated with 5azadeoxycytidine (FIG. 18).

[0255] Overexpression of ASC via transfection with pAAV-CBA-hASC in schwannoma cells leads to increased levels of cell death (in multiple cell lines (FIGS. 16A-16E). In vivo therapy with AAV1-rPO-hASC increases markers of apoptosis (caspase-3 and caspase-9 expression) and reduces markers of cell proliferation (e.g., Ki67) (FIGS. 17A-17C).

[0256] The therapeutic compositions described herein were demonstrated to provide efficacy with both the rat and human P0 promoters (FIG. 19). A minimal effective dose response curve is provided in FIG. 20A.

[0257] The methods and compositions described herein were demonstrated to effectively treat NF1-associated tumors, malignant peripheral nerve sheath tumor cells (both NF1 deficient and proficient) by overexpressing ASC or GASD-d. Interestingly, vectors comprising caspase-1 (ICE) did not prove effiacacious in this model (FIGS. 21A-21B, 22A-22B, and 23A-23B).

[0258] In a NF1-deficient human tumor cell line, the ASC promoter is highly methylated (FIGS. 24A-24B). ASC promoter is demonstrated to be completely methylated in S462.TY cells (human MPNST, NF1-deficient) and completely unmethylated in STS-26T cells (human sporadic MPNST, NF1-proficient). Such methylation typically suppresses expression of ASC. This finding supports the therapeutic applicability of the methods and compositions described herein, e.g., AAV-P0-ASC therapies.

[0259] In in vitro experiments, human NF1-deficient tumor cells* with methylated ASC promoter display heavy suppression of ASC mRNA levels (FIGS. 24A-24B). This is significant as it indicates that ASC can be suppressed in NF1-deficient tumor cells in vivo, which in turn, supports the concept of delivering ASC as gene therapy transgene as demonstrated herein with the NF2 schwannoma model. (*the cell line is derived from a human malignant peripheral nerve sheath tumor (MPNST). Of interest and as shown, in a human MPNST cell line in which ASC promoter is NOT methylated, ASC mRNA is highly expressed).