Transgenic model for delay-type hypersensitivity (DTH) and use thereof
09955676 ยท 2018-05-01
Assignee
Inventors
- Liang Liu (Macao, MO)
- Ting Li (Macao, MO)
- Kam Wai Wong (Macao, MO)
- Zhihong JIANG (Macao, CN)
- Hua Zhou (Macao, MO)
Cpc classification
A01K2207/12
HUMAN NECESSITIES
A01K2267/01
HUMAN NECESSITIES
A61K49/0008
HUMAN NECESSITIES
G01N2800/102
PHYSICS
International classification
Abstract
The present invention provides an in vivo platform for identifying and determining therapeutic or prophylactic activity of test compounds in delay-type hypersensitivity (DTH) and other inflammatory or cancerous diseases mediated by activation of IKK-.sup.C46A mutants. The in vivo platform of the present invention is a non-human transgenic mammal, e.g., a mouse model, with a site directed mutagenesis at a cysteine residue replaced by alanine in IKK- protein kinase. The site directed mutagenesis is introduced by a specially designed targeting vector containing a transversion in exon 3 of the Ikbkb genes encoding the IKK-. The present invention also provides methods for generating the transgenic mammal and for determining and identifying compounds that can inhibit activation of IKK-.sup.C46A mutants.
Claims
1. A homozygous IKK-.sup.C46A transgenic, knock-in, C57BL/6J mouse whose genome comprises a transgene encoding a single cysteine-to-alanine mutation at position 46 (C46A) in the endogenous amino acid sequence of SEQ ID NO:2, wherein the transgenic mouse comprises kidney tissues with a stronger in vivo kinase activity of IKK- and ear tissues with an enhanced in vivo inflammatory response to a delay-type hypersensitivity (DTH)-inducing agent relative to an equal amount of the respective tissues from a C57BL/6J wild-type mouse.
2. A method of preparing the homozygous IKK-.sup.C46A transgenic, knock-in, C57BL/6J mouse of claim 1, said method comprising: (a) transfecting mouse embryonic stem cells by electroporating with a linearized targeting construct with Neo selection gene, wherein said targeting construct is IKK-.sup.C46A targeting construct comprising the nucleotide sequence of SEQ ID NO: 1; (b) identifying and selecting recombinant embryonic stem cells obtained from step (a) that have undergone correct homologous recombination; (c) injecting recombinant embryonic stem cells from step (b) into blastocysts; (d) transplanting blastocysts obtained from step (c) into a pseudopregnant mouse to generate chimeric IKK-.sup.C46A mice; (e) mating chimeric IKK-.sup.C46A males obtained from step (d) with C57BL/6J females to produce heterologous IKK-.sup.C46A transgenic, knock-in, C57BL/6J mice; and (f) mating heterologous IKK-.sup.C46A transgenic, knock-in, C57BL/6J mice obtained from step (e) to produce homozygous IKK-.sup.C46A transgenic, knock-in, C57BL/6J mouse of claim 1.
3. The method of claim 2, wherein the targeting construct being a template to introduce a single point mutation at the cysteine (C) residue at position 46 in the endogenous amino acid sequence of SEQ ID NO:2 being replaced by alanine (A).
4. The method of claim 2, wherein said recombinant embryonic stem cells are further validated by PCR and gene sequencing using two pairs of forward and reverse primers having SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.
5. The method of claim 2, wherein said linearized targeting construct contains homology arms of 3.8 kb at 5 arm and 2.5 kb at 3 arm, said homology arms being constructed by PCR using five pairs of forward and reverse primers comprising SEQ ID NOs: 7 to 16.
6. The method of claim 4, wherein the forward and reverse primer pairs having SEQ ID No: 3 and SEQ ID NO: 4 are used to evaluate 5arm of the genes expressing IKK-.sup.C46A mutant for genotyping.
7. The method of claim 4, wherein the forward and reverse primer pairs having SEQ ID NO: 5, and SEQ ID NO: 6 are used to evaluate 3arm of the genes expressing IKK- mutant for genotyping.
8. A method for determining therapeutic or prophylactic activity of a test compound in delay-type hypersensitivity (DTH) and other inflammatory or cancerous diseases mediated by activation of IKK-.sup.C46A mutant protein comprising: (a) administering said test compound to the transgenic C57BL/6J mouse of claim 1; (b) measuring one or more physiological, morphological, molecular and/or histological parameter(s); and (c) comparing the measure in (b) with a measure obtained from a control mouse to observe or analyze any difference between two measures qualitatively and quantitatively in order to determine whether the test compound administered is specific and effective for treating or prophylaxing DTH and other inflammatory or cancerous diseases mediated by activation of IKK-.sup.C46A mutant, protein.
9. The method of claim 8, wherein the test compound specifically binds to cysteine 46 residue of the IKK- protein in the epithelial cell in order to inhibit IKK- and NF-B signaling, wherein an activation of said signaling potentially leads to severe inflammatory response or cancerous diseases; otherwise, if the test compound can target IKK- via other binding sites but not on cysteine 46 residue, the activation of IKK-.sup.C46A and NF-B signaling pathway can be suppressed.
10. The method of claim 8, wherein the inflammatory or cancerous diseases are selected from a group consisting of arthritis, delay-type hypersensitivity autoimmune disease and various types of cancer with different origin mediated by activation of IKK-.sup.C46A mutant protein.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(11) As used herein and in the claims, comprising means including the following elements but not excluding others.
(12) The present invention refers to non-human transgenic mammals, preferably mice, which comprise a mutation in the genes encoding for the IKK- protein. These transgenic animals are used as in vivo models in determining therapeutic or prophylactic activity of test compounds in delay-type hypersensitivity (DTH) and other inflammatory or cancerous diseases mediated by IKK-.sup.C46A mutants.
(13) This transgenic mouse can be applied to provide insight on the regulatory mechanisms of IKK- in various inflammatory and cancerous responses, as well as novel indications for personalized drug discovery.
(14) The following preparations and examples are given to enable those skilled in the art to more clearly understand and to practice the present invention. They should not be considered as limiting the scope of the invention, but merely as being illustrative and representative thereof.
Example 1
(15) This example describes the generation of the mutated gene and targeting vector used in a transgenic mouse model of the present invention.
(16) The targeting vector is designed based on the Ikbkb genomic sequence obtained from the Ensembl database (http://www.ensembl.org/index.html). Mouse Ikbkb-001 transcript consists of 22 exons. According to the bioinformatic analysis, the mutation sites are located in exon 3. FRT-neo-FRT template is designed in the construct to allow neomycin selection. The site mutations would result in Cys46Ala (C46A) mutation. The targeting vector containing T-G to G-C transversion mutation at nucleotides 32 and 33 in exon 3 of Ikbkb gene is achieved by ET cloning.
(17) Four little homology arms, A, B, C and D, are amplified by PCR using BAC plasmid as the template. There are five pairs of forward and reverse primers for constructing these four little homology arms which are listed in Table 2. Homology arms A and B are inserted into SalI-SpeI sites of pBR322-2S to obtain the vector for retrieving. Linearization vector by KpnI is transformed into BAC bacterium. The Retrieve vector, containing DNA sequences ranging from A to B, which include 5arm and 3arm, is obtained from BAC plasmid by homologous recombination and ampicillin screening. Homology arm C is inserted into EcoRV-EcoRI sites and D containing site mutations is inserted into BamHI-NotI sites of PL451 plasmid. Double digested by KpnI and NotI, the C-Neo-D fragment is isolated from the vector and knocked into the Retrieve vector by homologous recombination, thus obtaining the targeting vector pBR322-MK-Ikbkb-KI (SEQ ID NO: 1), which is evaluated by restriction endonucleases and sequencing.
(18) The obtained targeting vector is evaluated by restriction endonucleases and sequencing, confirming the insertion of the homologous arms and their direction. The five pairs of forward and reverse primers used to construct or confirm the insertion correspond to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, respectively.
(19) Conclusion.
(20) The circle map of the targeting vector is shown in
(21) TABLE-US-00001 TABLE 1 The locations marked in IKBKB-KI plasmid. 5947-5948: TG-GC transversion mutation at nucleotides 32 and 33 in exon 3 of Ikbkb gene. Ikbkb-KI vector Start End Length Name 58 3867 3810 5 arm 3868 5876 1949 Neo 4342 4322 21 P2 5480 5505 24 P3 5817 8372 2556 3 arm 8373 57 5868 pBR322-TK
(22) TABLE-US-00002 TABLE2 Forwardandreverseprimersforconstructingor confirminginsertionofhomologyarmsofthe Ikbkbgene Name SEQ ofPrimer NucleotideSequence IDNO Ikbkb-A-F CCGCGGTCGACGACAAGGGAAAACTCACCGC 7 Ikbkb-A-R CGGGGTACCGCAGAGGCGTGGAAGCGGG 8 Ikbkb-B-F CGGGGTACCGGTGGATATCATGGCCCAG 9 Ikbkb-B-R CGCACTAGTGACGAAAGGCCCGGAAGG 10 Ikbkb-C-F CGATATCGAGACCCCTGACTGCAGC 11 Ikbkb-C-R GGAATTCACGGGCATCCATACCTTAC 12 Ikbkb-D-F GGTGGATCCACTAGTTCTAGAGCGGC 13 Ikbkb-DM-R CTCCTGTCGGGCTTGCTTGATGGCGATCTG 14 Ikbkb-DM-F CATCAAGCAAGCCCGACAGGAGCTCAGCCC 15 Ikbkb-D-R CGTGCGGCCGCCTCTAGAAGCCTCCAGGAC 16
Example 2
(23) This example describes the preparation and generation of the IKK-.sup.C46A transgenic mice model.
(24) ES Cell Electroporation for DNA Transfer.
(25) Exponentially growing ES cells are digested with 0.125% trypsin-EDTA and counted. Cell suspension is adjusted to a final concentration of 1.5107 cells/ml by adding an appropriate amount of PBS. Mix together 0.8 ml ES cell suspension and 35 g NotI linearized pBR322-MK-Ikbkb-KI vector (
(26) Positive and Negative Drug Selection.
(27) ES cells are selected in medium containing G418 (300 mg/L) and ganciclovir (2 mol/L) 24 h and 48 h after electroporation, respectively. Medium is changed daily and clones can be picked after 7-8 days of culture when resistant ES cells grow into visible clones.
(28) Picking and Culture of Double Resistant ES Cell Clones.
(29) Resistant clones are picked and digested in 96-well plate (U bottom) containing 30 l 0.1% trypsin-EDTA per well for 3 min. Cells are dispersed by gentle agitation and transferred to 96-well culture plates. The majority of the cells are cryopreserved when cells reach 60-80% confluence and the remaining cells are allowed to grow to 100% confluence and used for genomic DNA extraction.
(30) ES Cell Genomic DNA Extraction.
(31) Aspirate the medium from the well and add 80 l lysis buffer containing 1 g/L proteinase K. After overnight digestion at 56 C., add anhydrous ethanol and extract DNA following conventional method and DNA is dissolved in 100 l TE buffer.
(32) PCR Genotyping of Homologous Recombinant Clones.
(33) As shown in
(34) During ES cell electroporation, the actual voltage and the discharge time are 256 V and 10.2 ms, respectively. 96 resistant clones are obtained. After extraction of the genomic DNA from ES cells in 96-well plate, positive clones are screened by PCR. Two clones (1C4 and 2A1) were identified in
(35) Blastocyst Microinjection of ES Cells and Embryo Transfer.
(36) DMEM complete medium without LIF is used during blastocyst microinjection. About 15 ES cells are injected into each blastocyst and the injected blastocysts are incubated in DMEM complete medium without LIF at 37 C., 5% CO.sub.2 for about 1 h before they are transplanted into the uterine horns of 2.5-day-postcoitum pseudopregnant females, with 8-10 embryos per side. The pseudopregnant recipient mice are bred in the SPF animal house of Shanghai Research Center for Model Organisms and are allowed to deliver chimeric offspring naturally.
(37) Chimeric Mice Breeding and PCR Genotyping:
(38) Chimeric males with more than 50% coat color chimerism are selected and mated with pure C57BL/6J females to produce mice with white-bellied agouti coat, which are originated from the injected ES cells. Finally, five heterozygous mice are identified by PCR using the same method as in ES cell genotyping in
Example 3
(39) This example describes the in vitro and in vivo kinase activity and the inflammatory response of Cys-46 IKK- mutant.
(40) IKK- Kinase Assay.
(41) IKK- kinase assay is performed using a K-LISA IKK-Inhibitor Screening Kit (Calbiochem).
(42) Delay-Type Hypersensitivity Test and Immunohistochemical Staining.
(43) The in vivo anti-inflammatory effect of a well-known IKK- inhibitor, DMY, is examined by administering this inhibitor to a mouse with delay-type hypersensitivity (DTH) induced based on the previously described method. The ear samples of DTH mice are fixed in 4% neutral-buffered formalin. Each sample is cut longitudinally into half and embedded in paraffin (Panreac), and then cut into 5 m sections.
(44) Results:
(45) Site-directed mutagenesis reveals that mutation of IKK- cysteine-46 to alanine (C46A) contributes to the most significantly increased kinase activity as compared to mutation in other cysteine residues (
(46) Conclusion:
(47) These findings indicate a stronger kinase activity and enhanced inflammatory response in homozygous IKK-.sup.C46A mutant mice.
Example 4
(48) This example describes an in vitro study to verify that cysteine 46 is a specific drug binding site on IKK- for regulation of IKK- and NF-B signaling.
(49) IKK- Kinase Assay.
(50) IKK- kinase assay is performed using a K-LISA IKK-Inhibitor Screening Kit (Calbiochem).
(51) Western Blotting Analysis.
(52) IKK-.sup./ deficient mouse embryonic fibroblasts (MEFs) are provided as a gift by Prof. Michael Karin (University of California, San Diego). IKK-.sup./ deficient MEFs transfected with IKK- wild-type or mutant C46A constructs are pretreated with DMY at 37 C. for 60 min, and then the cells are stimulated with TNF- and harvested for western blotting analysis. The expressions of IB, p-p65.sup.ser536, FLAG-IKK- and actin are detected with their specific antibodies.
(53) Results:
(54) To determine the specificity to which cysteine residue(s) on IKK- for the inhibitory action of a well-known inhibitor, DMY, all other 15 single point mutation IKK- constructs with cysteine (C) residues are replaced with alanine (A) by site-directed mutagenesis (
(55) Conclusion:
(56) Collectively, Cys-46 is verified as a functional cysteine residue as well as specific drug binding site in regulating kinase activity of IKK- and its in vivo inflammatory response.
Example 5
(57) This example describes the diminished anti-inflammatory effect of DMY as determined by the population of CD4.sup.+ and CD8.sup.+ T lymphocytes in the ear tissues of DTH-IKK-.sup.+/+ wild type and -IKK-.sup.C46A mutant mice.
(58) Delay-Type Hypersensitivity Test and Immunohistochemical Staining.
(59) The in vivo anti-inflammatory effect of DMY on CD4.sup.+ and CD8.sup.+ lymphocytes is examined by administering this inhibitor to the mouse with delay-type hypersensitivity (DTH) based on the previously described method. The ear samples of DTH mice are fixed in 4% neutral-buffered formalin. Each sample is cut longitudinally into half and embedded in paraffin (Panreac), and then cut into 5 m sections. Immunohistochemical staining is performed on slides.
(60) Results:
(61) The effector CD4.sup.+ and CD8.sup.+ lymphocytes, which mediate DNFB-induced DTH, are consistently increased in number in the ear sections of DNFB-treated IKK-.sup.C46A mutant mice compared to IKK-.sup.+/+ mice. In DMY-treated animals, the number of CD8.sup.+ lymphocytes gradually decreases in IKK-.sup.+/+ mice, but not in IKK-.sup.C46A mutant mice (
(62) Conclusion:
(63) These findings suggest that IKK-.sup.C46A mutant mice show higher inflammatory potency and is less sensitive to the anti-inflammatory effect of DMY compared to IKK-.sup.+/+ wild-type mice.
Example 6
(64) This example describes an in vivo study to demonstrate the anti-inflammatory effect of DMY on Collagen-II induced arthritis (CIA) rat model.
(65) Experimental arthritis induced by collagen-II in rats. CIA is induced in female Wistar rats. Dexamethasone (DEX, 0.1 mg/kg), methotrexate (MTX, 3.75 mg/kg, twice per week) and indomethacin (Indo, 1 mg/kg) are used as reference drugs.
(66) Results:
(67) In contrast to the failure of inflammatory suppression effect of DMY in IKK-.sup.C46A mutant mice, the anti-inflammatory effect of DMY has been further validated in CIA rat models using wild-type animal. In rat CIA model, DMY is demonstrated to significantly decrease hind paw volumes and arthritic scores in rats as compared to vehicle-treated CIA rats (
(68) Conclusion:
(69) These data demonstrates that DMY exhibits potent anti-inflammatory effect on CIA rat model with wild type IKK-.
(70) The exemplary embodiments of the present invention are thus fully described. Although the description refers to particular embodiments, it will be clear to one skilled in the art that the present invention may be practiced with variation of these specific details. Hence the present invention should not be construed as limited to the embodiments set forth herein.
CONCLUSION
(71) In summary, the present invention identifies the role of cysteine-46 (Cys-46) on IKK- kinase in transgenic mice models in modulating inflammatory responses and as a specific drug-binding site to mediate the anti-inflammatory actions of drugs.
(72) In vitro site-directed mutagenesis and in vivo experiments on homozygous IKK-.sup.C46A transgenic mice demonstrate that mutated IKK- kinase has stronger IKK- kinase activity than wild-type. Severe inflammation and diminished anti-inflammatory potency of dihydromyricetin (DMY), a well-known IKK- inhibitor which is derived from the medicinal plant Ampelopsis megalophylla, are observed in the delayed-type hypersensitivity (DTH) responses in the homozygous IKK-.sup.C46A mutant mice, suggesting that Cys-46 is a potent functional site for modulating IKK- kinase activity and anti-inflammatory responses.
(73) The identification of the specific drug-binding site Cys-46 on IKK- kinase and establishment of homozygous IKK-.sup.C46A transgenic mice should provide new platforms for mechanistic studies of IKK--associated inflammation and Cys-46-targeting personalised therapy.