METHOD FOR NEUTRALIZING HEPATITIS C VIRUS, FULLY HUMAN MONOCLONAL ANTIBODY AGAINST HEPATITIS C VIRUS (VARIANTS), COMPOSITION OF FULLY HUMAN MONOCLONAL ANTIBODIES AGAINST HEPATITIS C VIRUS AND HYBRID MOUSE/HUMAN PRODUCER CELL LINE OF FULLY HUMAN MONOCLONAL ANTIBODIES AGAINST HEPATITIS C VIRUS (VARIANTS)

20170121390 ยท 2017-05-04

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the field of biotechnology, and specifically to methods and techniques for neutralizing the hepatitis C virus, and specifically to antibodies against the hepatitis C virus, and can be used in medicine, the pharmaceutical industry and related areas of science and technology. Proposed is the use of fully human monoclonal antibodiesRYB1, RYB2 and RYB3and of a composition based thereon for the prevention and treatment of hepatitis C. Said antibodies are produced by cultivation using hybrid BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3. The effectiveness of the antibodies is due to said antibodies binding epitopes, namely Ep1, Ep2 and Ep3 of E2 protein of the hepatitis C viral envelope, respectively. The present invention has demonstrated a neutralizing activity of the antibodies in a model system of infection of human cells in a culture. It has been shown that use of the claimed group of inventions provides for more reliable antibody binding of the hepatitis C virus.

    Claims

    1. A method for neutralizing the hepatitis C virus by contact with antibodies which bind to epitopes of E2 protein of the hepatitis C viral envelope, which is characterized in that contact is made by introducing into the system at least one antibody capable of reacting with at least one epitope selected from the group of epitopes Ep1, Ep2, Ep3, in which epitope Ep1 of the E2 protein of hepatitis C virus isolate H77 is a conformation of a continuous amino acid sequence contained in the region HPEATYSRCG (SEQ ID NO: 30) and containing the amino acids Ser and Arg of this region, epitope Ep2 of the E2 protein of hepatitis C virus isolate H77 is a conformation of a continuous amino acid sequence contained in the region VCGPVYCF (SEQ ID NO: 32) and containing the amino acid Tyr of this region, and epitope Ep3 of the E2 protein of hepatitis C virus isolate H77 is a conformation of a continuous amino acid sequence contained in the region HPEATYSRCGSGPWITP (SEQ ID NO: 34) and containing both Ser amino acids and the amino acid Arg of this region.

    2. A fully human monoclonal antibody RYB1 with an amino acid sequence of the variable region of a heavy chain (VH) SEQ ID NO: 5 and an amino acid sequence of the variable region of a light chain (VL) SEQ ID NO: 9, which has immunologic specificity for the epitope Ep1 of the E2 protein of hepatitis C virus isolate H77, said epitope being a conformation of a continuous amino acid sequence, which is contained in the region HPEATYSRCG (SEQ ID NO: 30) and which contains the amino acids Ser and Arg of this region, and said antibody being secreted by cells of the hybrid (mouse/human) cell line BIONA-RYB1, deposited in the Russian National Collection of Industrial Microorganisms under number H-142.

    3. A fully human monoclonal antibody RYB2 with an amino acid sequence of the variable region of a heavy chain (VH) SEQ ID NO: 13 and an amino acid sequence of the variable region of a light chain (VL) SEQ ID NO: 17, which has immunologic specificity for the epitope Ep2 of the E2 protein of hepatitis C virus isolate H77, said epitope being a conformation of a continuous amino acid sequence, which is contained in the region VCGPVYCF (SEQ ID NO: 32) and which contains the amino acid Tyr of this region, and said antibody being secreted by cells of the hybrid (mouse/human) cell line BIONA-RYB2, deposited in the Russian National Collection of Industrial Microorganisms under number H-143.

    4. A fully human monoclonal antibody RYB3 with an amino acid sequence of the variable region of a heavy chain (VH) SEQ ID NO: 21 and an amino acid sequence of the variable region of a light chain (VL) SEQ ID NO: 25, which has immunologic specificity for the epitope Ep3 of the E2 protein of hepatitis C virus isolate H77, said epitope being a conformation of a continuous amino acid sequence, which is contained in the region HPEATYSRCGSGPWITP (SEQ ID NO: 34) and containing both Ser amino acids and the amino acid Arg of this region, and said antibody being secreted by cells of the hybrid (mouse/human) cell line BIONA-RYB3, deposited in the Russian National Collection of Industrial Microorganisms under number H-144.

    5. A composition based on antibodies having immunological specificity for epitopes Ep1, Ep2 and Ep3 of the E2 protein, which is characterized in that it contains the fully human monoclonal antibodies RYB1, RYB2 and RYB3 as antibodies and in the mass ratio 20-40:20-40:20-40.

    6. The composition according to claim 5, which is characterized in that the ratio of antibodies RYB1, RYB2 and RYB3 in the composition is 1:1:1.

    7. The hybrid mouse/human cell line BIONA-RYB1, deposited in the Russian National Collection of Industrial Microorganisms under number H-142, produces fully human monoclonal antibodies to epitope Ep1 of the E2 protein of hepatitis C virus isolate H77.

    8. The hybrid mouse/human cell line BIONA-RYB2, deposited in the Russian National Collection of Industrial Microorganisms under number H-143, produces fully human monoclonal antibodies to epitope Ep2 of the E2 protein of hepatitis C virus isolate H77.

    9. The hybrid mouse/human cell line BIONA-RYB3, deposited in the Russian National Collection of Industrial Microorganisms under number H-144, produces fully human monoclonal antibodies to epitope Ep3 of the E2 protein of hepatitis C virus isolate H77.

    Description

    [0081] The essence of the claimed inventions is illustrated by the following graphic materials:

    [0082] FIG. 1 shows the structure of the genome of the hepatitis C virus. A rectangular frame contains the region which encodes the polyprotein. The hairpin regions correspond to the 5- and 3-untranslated regions, which include an internal ribosome entry site (IRES). Genomic regions which encode the protein products formed during splitting the polyprotein by cellular and viral peptidases are marked. The known functions of each protein product are indicated. The coordinates of the viral genome coding for regions of the virus isolate H77 (genotype 1a) are: nucleotides 342-914-Core structural protein, nucleotides 342-828-gp2 protein (formed as a result of a translational frameshift), nucleotides 915-1490-structural protein E1, nucleotides 1491-2579-structural protein E2, nucleotides 2580-2768-p7 protein (localized on the membrane), nucleotides 2769-3419-NS2 protein (membrane protein, inhibitor of CIDE-B induced apoptosis), nucleotides 3420-5312-NS3 protein (protease/helicase), nucleotides 5313-5474-NS4A protein (cofactor for NS3 protease), nucleotides 5475-6257-NS4B protein (membrane protein regulator of replication complex NS3-NS5B), nucleotides 6258-7601-NS5A protein (capable of phosphorylation, likely mediates sensitivity to interferon), and nucleotides 7602-9374-NS5B protein (RNA-dependent RNA polymerase). The genome regions 1-341 and 9378-9646 are, respectively, 5- and 3-non-coding.

    [0083] FIG. 2 shows the results of cytofluorimetric analysis of HEK-E1E2 cells (dark histogram) after incubation with a conditioned medium from one of the hybridoma clones. The grey curve is a histogram of immunofluorescence of control untransfected HEK293 cells after incubation with the same conditioned medium.

    [0084] FIG. 3 shows an electrophoregram of samples of purified antibodies RYB1, RYB2 and RYB3 (7.5 g per lane) separated in 7.5% polyacrylamide gel without mercaptoethanol (3A) or in a 10% polyacrylamide gel with mercaptoethanol (3B) in the presence of sodium dodecyl sulphate and stained with Coomassie Brilliant Blue R-250.

    [0085] FIG. 4 shows the mutual competition of the antibodies RYB1, RYB2 and RYB3 for binding to HEK-E1E2 cells expressing the E1-E2 of HCV protein complex. The graphs show the average fluorescence values for the cells after the binding reaction with mixtures with FITC-labelled and unlabeled antibodies at the indicated ratios. Nonspecific binding was measured using HEK293 cells.

    [0086] FIG. 5 shows the mass spectra of E2 recombinant protein complexes with antibodies RYB1, RYB2 and RYB3, where A: pure E2 protein; B-D: preparations of the corresponding antibodies RYB1, RYB2 and RYB3; and E-G: complexes of antibodies with E2 protein.

    [0087] FIG. 6 demonstrates the arrangement of crosslinking reagent molecules on the peptide products of the E2 protein proteolysis in the vicinity of the epitope for the antibody RYB1 before and after the formation of complexes with the antibody. The dark rectangles correspond to peptides present among the proteolysis products of both pure E2 protein and its complexes with antibody RYB1. Amino acids associated with the crosslinking reagent are marked by a dark star. The light rectangles correspond to peptides present among pure E2 protein proteolysis products, but absent after the formation of a complex with the antibody. Amino acids associated with the crosslinking reagent in the case of pure E2 protein proteolysis are marked by a light star. The amino acid sequence of the E2 protein of the analyzed region is shown along the horizontal axis.

    [0088] FIG. 7 shows the arrangement of the cross-linking reagent molecules on the peptide products of the E2 protein proteolysis in the vicinity of the epitope for antibody RYB2 before and after the formation of complexes with the antibody. The dark rectangles correspond to peptides present among the proteolysis products of both pure E2 protein and its complexes with antibody RYB2. The amino acids associated with the crosslinking reagent are denoted by a dark star. The light rectangles correspond to peptides present among the proteolysis products of pure E2 protein, but absent after the formation of a complex with the antibody. The amino acids associated with the crosslinking reagent in the case of proteolysis of pure E2 protein are denoted by a light star. The amino acid sequence of the E2 protein of the analyzed region is shown along the horizontal axis.

    [0089] FIG. 8 shows the arrangement of the cross-linking reagent molecules on the peptide products of the E2 protein proteolysis in the vicinity of the epitope for antibody RYB3 before and after the formation of complexes with the antibody. The dark rectangles correspond to peptides present among the proteolysis products of both pure E2 protein and its complexes with antibody RYB3. The amino acids associated with the crosslinking reagent are denoted by a dark star. The light rectangles correspond to peptides present among the proteolysis products of pure E2 protein, but absent after the formation of a complex with the antibody. The amino acids associated with the crosslinking reagent in the case of proteolysis of pure E2 protein are denoted by a light star. The amino acid sequence of the E2 protein of the analyzed region is shown along the horizontal axis.

    [0090] FIG. 9 shows the mass spectra of complexes of recombinant E2 protein with antibodies RYB1, RYB2 and RYB3 in the presence of an excess of E2 protein proteolysis peptide products.

    [0091] The following examples are to illustrate the essence and industrial applicability of the claims of this invention.

    EXAMPLE 1

    Producing Hybrid Cell Clones (Hybridomas)

    [0092] In order to create hybridoma cells producing natural fully human monoclonal antibodies against proteins of the hepatitis C viral envelope, clinical materials from seven patients who died from hepatitis C were used. In all these patients, the initial diagnosis was made based on the presence of antibodies against HCV antigens. The antibodies were detected by the commercially available enzyme-linked immunosorbent assay (ELISA) method. No exclusion criteria related to age, race or stage of the disease at the time of death were applied. Concomitant infections such as HIV, herpes simplex, human papilloma virus and sexually transmitted diseases were allowed. A history of drug addiction as well as the presence of a malignant neoplasm of the liver and other diseases were also allowed. The only exclusion criteria were septic shock and any autoimmune disease, including lupus, diabetes, etc. All data which could identify the patient who died were removed; and the clinical information only included information regarding age, gender and disease history.

    [0093] The spleen was removed and placed in a 100 mm Petri dish with sterile medium RPMI 1640, supplemented with 4 mM L-glutamine, nonessential amino acids (from a 100-fold concentrate), vitamins (from a 100-fold concentrate), 1 mM sodium pyruvate and 50 g/ml gentamicin. Pieces of spleen were disrupted using forceps and scissors. The disrupted tissue was passed through a metal sieve (50 mesh cells) using glass pestle. 10 ml of the resulting suspension was transferred to sterile conical 15 ml test tubes, containing 5 ml of Histopaque 1077 lymphocyte separation medium (Sigma-Aldrich, USA) and centrifuged for 20 min at 400 g. An opaque ring of mononuclear cells, which is formed on the border between layers, was collected using a Pasteur pipette and diluted to 10 times with the standard serum-free medium RPMI 1640. The cells were centrifuged at 300 g for 10 minutes and washed twice with the medium.

    [0094] BIONA-X cells, which are a specialized hybrid (mouse/human) myeloma cell line created by BionA Pharma Ltd. for the production of human hybridomas, were grown in an RPMI 1640 medium without antibiotics and supplemented with 10% fetal bovine serum (Hyclone), 4 mM L-glutamine, 1 mM sodium pyruvate, nonessential amino acids and vitamins (complete medium). Prior to fusion the cells were cultured in the presence of 20 g/ml of 8-azaguanine (Sigma-Aldrich, USA) to prevent HAT-sensitive cells from reverting to wild type cells. Cells in an exponential growth phase were adjusted to a density of 10% of a monolayer.

    [0095] Cells from the BIONA-X line and mononuclear spleen cells were washed three times in the serum-free medium RPMI 1640 by centrifugation for 5 min at 300 g, these were mixed together in a ratio of 1:5 (BIONA-X: spleen cells) and centrifuged for 10 minutes at 300 g. The supernatant was removed, the cell pellet was resuspended in 100-300 l (depending on cell volume) of DMEM medium, 100-300 l of a solution of polyethyleneglycol-1500/dimethyl sulfoxide (1:1) warmed to room temperature was added to the cell mixture and then the test tube was shaken for 3 minutes with light tapping. Subsequently, 15 ml of a mixture (1:1) of Hanks balanced salt solution and phosphate buffered saline (PBS) was added to the test tube as following: 10 ml slowly over 10 minutes, and then 5 ml over 5 minutes. After which, 10 ml complete medium was added over 5 minutes and, finally, another 5 ml complete medium was added over 1 minute. The total volume was 30 ml. Then 600 l of a 50-fold concentrate of a HT (hypoxanthine-thymidine) solution (Cellgro, USA) and 20-30 l dimethyl sulfoxide were added to the test tube. The cell suspension was stirred in the test tube, transferred to a Petri dish (10015 mm) and incubated at 37 C. in a CO.sub.2 incubator overnight. Thereafter, the cells were collected, centrifuged at 300 g for 10 minutes and resuspended in a complete medium to which a HAT (hypoxanthine-aminopterin-thymidine) solution of a 50-fold concentrate (Cellgro, USA) was added.

    [0096] After fusion, the cells were seeded into 96-well plates in a 200 l volume (approximately 250,000 cells per well) in RPMI 1640 growth medium without antibiotics, supplemented with 10% fetal bovine serum (Hyclone), 4 mM L-glutamine, 1 mM sodium pyruvate, nonessential amino acids and vitamins. A total of 65 plates were inoculated. Twice a week 50% of the medium was removed and replaced with fresh medium. In the first week the cell clones were cultured with the addition to the growth medium of a HAT solution, and the subsequent two weeks with the addition of a HT solution, after which, screening was carried out for the secretion of human immunoglobulins.

    [0097] The hybridoma clones were tested for the secretion of human IgG immunoglobulins as following. ELISA plates were coated with polyclonal goat anti-human IgG immunoglobulins specific for Fc-fragments (Sigma-Aldrich, USA). To this end, antibodies were added to the wells of the plates in a 100 l carbonate buffer (0.1 M sodium carbonate, pH 9.0) at 100 ng per well. The plates were covered by sealed caps and incubated overnight at 4 C. The plates were then washed twice with a PBS solution, the remaining droplets were removed, 200 l of a blocking solution (0.4% dry non-fat milk in PBS) was added to the wells and plates were incubated for 2 hours. The wells were washed 3 times with PBS, and then 50 l hybridoma supernatant diluted with the blocking solution in a ratio of 1:1 was added to each well. The complete cell culture medium served as a negative control. Human serum at a dilution of 1:2000 served as a positive control.

    [0098] The plates were incubated for 2 hours at room temperature, washed 4 times with PBS and horseradish peroxidase labelled goat polyclonal antibodies against human IgG immunoglobulins (Sigma-Aldrich, USA) diluted in a blocking solution in a ratio of 1:2000 were added to the wells. After 1 hour incubation at room temperature the plates were washed 4 times with PBS and a peroxidase substrate (orthophenylenediamine in a phosphate-citrate buffer with hydrogen peroxide) was added to each well. The color reaction was stopped by adding 20 l of 10% hydrochloric acid. Colorimetric measurements were carried out in an Infinite F50 (Tecan, Austria) plate reader at 492 nm.

    [0099] A positive test result was considered to be an optical density value of at least 3 times the optical density level in the negative control wells. 100% of 6240 primary hybridoma clones showed a positive result and, therefore, secreted IgG human immunoglobulins into the culture medium.

    EXAMPLE 2

    Production of HEK293 Cells, Stably Transfected by HCV E1-E2 Genes

    [0100] The nucleotide sequence encoding the polyprotein of hepatitis C virus isolate H77 (genotype 1a) was obtained from the international database NCBI Nucleotide (http://www.ncbi.nlm.nih.gov/nuccore). The sequence has reference number NC_004102.1. To obtain the genetic structure encoding the genes of E1-E2 of HCV, a fragment of this sequence (nucleotides 735-2579, SEQ ID NO: 1) was used which encodes amino acids 132-746 of the polyprotein. The sequence GCAGGTACCGCCGCCGCCATGAATTCC (SEQ ID NO: 2) was attached to the 5-end of the fragment, contains a restriction enzyme Acc651 recognition site, a ribosome binding region and codes for amino acids Met, Asn and Ser. TAATCTAGAGCG (SEQ ID NO: 3) was attached to the 3-end of the fragment, encodes the translation termination signal, and comprises a recognition region of restriction enzyme Xbal recognition site. As a result, a nucleotide sequence was produced which comprises a ribosome binding site and codes for amino acids Met, Asn, Ser, a fragment from 60 C-terminal amino acids of Core protein (amino acids 132-191 of the HCV polyprotein), the E1 protein (amino acids 192-383 of the polyprotein) and the E2 protein (amino acids 384-746 of the polyprotein). A double-stranded DNA fragment with the stated nucleotide sequence (SEQ ID NO: 4) was chemically synthesized, split by restriction enzyme Acc651 and Xbal and inserted into the eukaryotic expression vector pcDNA3.1-neo (Invitrogen, USA) at the sites of restriction enzymes to form the plasmid pcDNA3.1-E1E2.

    [0101] In people infected by hepatitis C virus, the proteins Core, E1, and E2 are formed from the HCV polyprotein as a result of cellular signal peptidases splitting and are translocated to the endoplasmic reticulum. The correct folding of the E1 and E2 proteins and formation of a complex between them largely depends on the joint translocation and processing thereof (Cocquerel L, Meunier J C, Op de Beeck A, Bonte D, Wychowski C, Dubuisson J. J. Gen.Virology. 2001, 82(7): 1629-1635). Therefore, it can be assumed that polyprotein fragment encoded by plasmid pcDNA3.1-E1E2, containing the C-terminal part of Core, E1, and E2, would be split in plasmid-transfected cells in a similar manner. Thus, the E1 and E2 proteins can form heteromeric complexes with each other similar in structure to HCV envelope protein complexes. The transmembrane domains of the E1 and E2 proteins maintain complexes in the endoplasmic reticulum (Flint, M., and J. A. McKeating J. Gen. Virol 1999, 80 (8): 1943-1947), resulting in the need for cell permeabilization prior to fluorometric immunoassay.

    [0102] Human embryonic kidney cells, HEK293, were cultured in a DMEM medium supplemented with 10% fetal bovine serum (Invitrogen, USA), 2.2 mM L-glutamine, 100 IU/ml penicillin and 100 mg/ml streptomycin, at 37 C. in a CO.sub.2 incubator with 5% CO.sub.2. For transfection, cells were seeded to a 24-well plate wells (50,000 cells per well). Next day, cells were transfected by pcDNA3.1-E1E2 plasmid using Lipofectamine 2000 reagent (Invitrogen, USA) at a ratio 1 g of plasmid DNA and 1 g of reagent per well according to the manufacturer's protocol. After 24 hours the culture medium was changed for a fresh medium and the cells were incubated for another 24 hours. Thereafter, the cells were removed from the substrate with trypsin, serial dilutions of the cell suspension were prepared and seeded to 96-well plates. Antibiotic G418 (Invitrogen, USA) was added to the culture medium to a final concentration of 1 mg/ml for a selection of transfected clones. After 2-3 weeks, the cells from the wells containing no more than one cell clone were transferred into wells of a 24-well plate, expanded, transferred into cell culture flasks and then frozen.

    [0103] Cells of transfected clones were tested for expression of E1-E2 protein complexes. For this, the cells were grown in T75 flasks (Corning-Costar, USA) to the condition of a fresh monolayer (5-6 million cells). Flasks with cells were rinsed with 5 ml cold PBS, 5 ml of a cold solution of 20 mM EDTA prepared in PBS were added, and the flasks were incubated on ice for 20 minutes. Then the flasks were shaken to make sure that all cells had detached, 5 mL of PBS were added and the cell pellet was collected by centrifugation for 15 min at 200 g.

    [0104] For the permeabilization of the cells, the pellet was washed twice in 10 ml PBS and resuspended in 1 ml of pre-cooled to 20 C. methanol. Another 9 mL of cold methanol was added to the suspension and cells were incubated at 20 C. for 20 minutes, with occasional vortexing. After incubation, the cells were pelleted by centrifugation at 400 g, washed with PBS, resuspended in 10 ml PBS and placed into Eppendorf tubes for testing conditioned media of hybridoma clones, 10.sup.5 cellsper tube.

    [0105] 1.5 ml solution of 0.3% bovine serum albumin (BSA) in PBS was added to a suspension of permeabilized cells, incubated for 5 min, the cells were pelleted by centrifugation and resuspended in a 20 l solution of 20 g/ml of mouse monoclonal antibodies BDI167 against the HCV antigen E2 (Abcam, USA) prepared in PBS with 0.3% BSA. The cells were incubated for 30 min at room temperature, then washed in a 1.5 ml of a 0.3% BSA solution in PBS, incubated for 30 min at room temperature with 20 l FITC-labelled affinity purified rabbit antibodies against mouse immunoglobulins (Becton Dickinson, USA) at a concentration of 2 g/ml, and washed in a 1.5 ml of a 0.3% BSA solution in PBS and suspended in 400 l of 1% formaldehyde in PBS. The fluorescence of cells was analyzed on a FACS-Calibur flow cytometer (BD Biosciences, USA). A cell clone which has shown the highest expression of the E1-E2 complex was selected for further use and was named HEK-E1E2.

    EXAMPLE 3

    Selection of Hybridoma Clones Producing Human Monoclonal Antibodies to HCV Envelope Proteins

    [0106] To select hybridomas producing human antibodies capable of recognizing E1-E2 protein complex, HEK-E1E2 cells were used, the production of which is described in Example 2. The non-transfected cells of a HEK293 parental cell line served as control. Cells were grown and permeabilized as described in Example 2.

    [0107] Hybridoma conditioned media were tested as following. 1.5 ml of 0.3% BSA in PBS was added to a suspension of permeabilized HEK-E1E2 or HEK293 cells, incubated for 5 min, and the cells were pelleted by centrifugation and resuspended in a 20 l sample of a conditioned medium. The cells were incubated for 30 min at room temperature, then washed in 1.5 ml of a 0.3% BSA solution in PBS, incubated for 30 min at room temperature with 20 l of FITC-labelled affinity purified rabbit antibodies to human immunoglobulins (Company IMTEK, Moscow) at a concentration of 3.3 g/ml, washed in 1.5 ml of a 0.3% BSA solution in PBS and resuspended in 400 l of 1% formaldehyde in PBS. The fluorescence of cells was analyzed using FACS-Calibur flow cytometer (BD Biosciences, USA). The result was considered positive if the average fluorescence value of HEK-E1E2 cells was at least 3 times higher than the average fluorescence value of the HEK293 control cells incubated with the same sample of conditioned medium.

    [0108] FIG. 2 shows a typical result of flow cytometric analysis, which reveals the presence in the conditioned medium of human antibodies recognizing the E1-E2 protein complex in transfected cells. Of 6240 hybridoma clones analyzed, 56 showed a positive result in the test for binding to HEK-E1E2 cells and were selected for recloning. After several rounds of cloning, most cell lines lost the ability to secrete antibodies that recognize the E1-E2 complex. Ultimately three hybridoma cell lines were obtained which stably produce human antibodies against the E1-E2 protein complex. These lines of hybridomas were designated as BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3, and the antibodies they produce were called, respectively, RYB1, RYB2 and RYB3.

    EXAMPLE 4

    Production of a Purified Preparation of Human Monoclonal Antibodies RYB1

    [0109] Hybridoma cell line BIONA-RYB1 were cultured in 8 hollow-fiber bioreactor cartridges of the FiberCell Duet Pump type (FiberCell Systems Inc., USA) in serum-free medium HyClone SFM4MAb (HyClone, USA). For the initial load, 5.Math.10.sup.8 cells per cartridge were used. The first collection of conditioned medium containing monoclonal antibodies was done 4 weeks after the initiation of cell culture. The volume collected was 50 ml from one cartridge, wherein the antibody concentration in the medium ranged from 0.01 mg/ml to 0.05 mg/ml. The conditioned medium was collected every 6 days over 3 months, so that the total volume of the collected medium was 6.0 liters. The batches of medium were frozen and stored at 20 C.

    [0110] In order to chromatographically purify the antibodies, the conditioned medium was thawed and concentrated by an Amicon Filtering System using a 100 kDa MWCO membrane (Millipore, USA). Prior to concentration, the System and membrane were washed with sterile pyrogen-free water to eliminate endotoxins. 800 ml of concentrate containing 90 mg human antibodies was obtained from the 6 liters of medium. The concentrate was diluted with an equal volume of binding buffer and loaded onto a column with 2 mL of protein A/G plus agarose resin (Pierce, USA) for 3 hours. The column was washed with 20 ml binding buffer, the antibodies were eluted with 10 ml of elution buffer and 0.5 ml fractions were collected into test tubes with a neutralizing buffer (100 l 1 M Tris-HCl, pH 8.0). Fractions containing proteins were combined and dialyzed against PBS.

    [0111] The preparation of purified RYB1 antibodies (76 mg) was analyzed using electrophoresis in polyacrylamide gel in the presence of sodium dodecyl sulphate. Analysis showed (FIG. 3) that there were virtually no foreign protein contaminants in the obtained preparation.

    EXAMPLE 5

    Production of a Purified Preparation of Human Monoclonal Antibodies RYB2

    [0112] RYB2 monoclonal antibodies were prepared according to the technique in example 4 using hybridoma BIONA-RYB2. The total volume of the collected medium for hybridoma BIONA-RYB2 was 5.8 l, the yield of purified antibodies RYB2 was 81 mg. Analysis showed (FIG. 3) that virtually no foreign protein contaminants in the obtained preparation.

    EXAMPLE 6

    Preparation of a Purified Preparation of Human Monoclonal Antibodies RYB3

    [0113] RYB3 monoclonal antibodies were prepared according to the technique in example 4 using hybridoma BIONA-RYB3. The total volume of the collected medium for hybridoma BIONA-RYB3 was 6.1 l, the yield of purified antibodies RYB3 was 85 mg. Analysis showed (FIG. 3) that virtually no foreign protein contaminants in the obtained preparation.

    EXAMPLE 7

    Determination of Subclasses of the Heavy and Light Chains of Antibodies

    [0114] The subclasses of heavy chains of antibodies RYB1, RYB2 and RYB3 were determined using the kit Human IgG Subclass Profile Kit (Invitrogen, USA). Mouse monoclonal antibodies against human immunoglobulins of subclasses IgG1, IgG2, IgG3 and IgG4 were added to the wells of an immunological plate according to the manufacturer's instructions, then diluted preparations of purified antibodies RYB1, RYB2 and RYB3 were added, and incubated for 30 min. Following this, the plate wells were washed, peroxidase-labelled anti-human IgG immunoglobulins were applied, incubated for 30 min, the plates were washed again and developed using a TMB substrate. Optical density values at 450 nm were read using plate reader Infinite F50 (Tecan, Austria) after the reaction was stopped. This analysis revealed that heavy chains of all three antibodies belong to the subclass IgG1.

    [0115] Light chain types were determined using the Human IgG Subclass Profile Kit, but goat polyclonal antibodies against kappa-type light chains or against Lambda-type light chains of human immunoglobulins were used as peroxidase labelled antibodies (Bethyl Laboratories, USA). The light chains of antibodies RYB1, RYB2 and RYB3 were determined as kappa type.

    EXAMPLE 8

    Determination of the Amino Acid Sequences of Variable Regions of Heavy and Light Chains of Antibodies RYB1, RYB2 and RYB3

    [0116] In order to determine the amino acid sequences of variable regions of antibodies from hybridoma cells BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3, total cellular RNA was isolated, the cDNA was generated using reverse transcriptase and cDNA fragments encoding variable domains of human immunoglobulins, were amplified. The amplified fragments were cloned, underwent sequencing and, on the basis of nucleotide sequences obtained by translation in silico, the amino acid sequences of corresponding regions of antibodies RYB1, RYB2 and RYB3 were determined. Detailed description and the results are presented below.

    [0117] 5.Math.10.sup.7 cells of each hybridoma were collected in the exponential growth phase. The cells were washed with PBS and lysed in 10 ml of RLT-buffer from the RNA isolation kit RNeasy Midi Kit (Qiagen, USA). To reduce the viscosity of the solution, lysates were pressed once through a 29 G gauge needle, an equal volume (10 ml) of 70% ethanol was added and applied to chromatographic columns of the RNA isolation kit. The columns were washed with solutions RW1 and RPE from the kit, after which the RNA was eluted in 4 ml H.sub.2O. 100 l of 5 M NaCl and 10.5 ml of ethanol were added to the eluates and incubated overnight at 20 C. to precipitate RNA. The RNA precipitates were collected by centrifugation 30 min at 4000 rev/min, dissolved in 900 l H.sub.2O, 100 l 10-fold buffer for DNAase (400 mM Tris-HCl, pH 7.0, 100 mM NaCl, 100 mM MgCl.sub.2), 5 l recombinant DNAase I, 10 u/1, free from impurities of ribonucleases (Roche Applied Science, USA) were added and incubated for 2 hours at room temperature to cleave the residual cellular DNA. The reaction was stopped by adding 40 l 0.5 M EDTA, 4 ml RLT buffer and 2.8 ml ethanol were added and applied to a column from the RNA isolation kit to carry out a second round of purification as described above. The eluted RNA, free from impurities of genomic DNA, was precipitated with ethanol, collected by centrifugation, dissolved in H.sub.2O and the concentration was adjusted to 1 mg/ml. RNA concentration was measured spectrophotometrically at a 260 nm wavelength. The absence of RNA degradation was monitored by electrophoresis in formaldehyde-agarose gel in the presence of ethidium bromide. The ratio of the intensities of the 28s and 18s ribosomal RNA bands was approximately 2:1.

    [0118] The reverse transcription reaction for RNA from BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3 cells took place in a volume of 10 l using 2 g total cellular RNA, oligo(dT)-primer and the reverse transcriptase PowerScript (Clontech, USA) for 2 hours at 42 C. according to the manufacturer's protocol. Aliquots of the obtained cDNA were amplified in the presence of primer sets specific to the 5 and 3 ends of the nucleotide sequences encoding the variable regions of heavy (VH) and light (VL) chains of IgG1 kappa human immunoglobulins (Antibody Engineering: Methods and Protocols, edited by Benny K. C. Lo 2004, Humana Press Inc., p. 282). The amplification products were cloned in vector pCR2.1 (Invitrogen, USA) and the resulting clones (at least 4 clones for each variable region of immunoglobulin) were sequenced. Sequencing results revealed the nucleotide and amino acid sequences of the variable regions of the VH and VL of the antibodies RYB1, RYB2 and RYB3. Regions which determine complementarity (Complementarity Determining Region, CDR) in the VH and VL sequences were identified in accordance with the numbering system IMGT (Lefranc M P, Giudicelli V, Ginestoux C, Bodmer J, Muller W, Bontrop R, Lemaitre M, Malik A, Barbie V, Chaume D. Nucleic Acids Res.1999, 27 (1): 209-212).

    [0119] Thus the following amino acid sequences, which were shown in the sequence list, were determined:

    the sequence of the VH region of the antibody RYB1, SEQ ID NO: 5;
    the CDR1 sequence of the VH region of the antibody RYB1, SEQ ID NO: 6;
    the CDR2 sequence of the VH region of the antibody RYB1, SEQ ID NO: 7;
    the CDR3 sequence of the VH region of the antibody RYB1, SEQ ID NO: 8;
    the VL region sequence of the antibody RYB1, SEQ ID NO: 9;
    the CDR1 sequence of the VL region of the antibody RYB1, SEQ ID NO: 10;
    the CDR2 sequence of the VL region of the antibody RYB1, SEQ ID NO: 11;
    the CDR3 sequence of the VL region of the antibody RYB1, SEQ ID NO: 12;
    the VH region sequence of the antibody RYB2, SEQ ID NO: 13;
    the CDR1 sequence of the VH region of the antibody RYB2, SEQ ID NO: 14;
    the CDR2 sequence of the VH region of the antibody RYB2, SEQ ID NO: 15;
    the CDR3 sequence of the VH region of the antibody RYB2, SEQ ID NO: 16;
    the VL region sequence of the antibody RYB2, SEQ ID NO: 17;
    the CDR1 sequence of the VL region of the antibody RYB2, SEQ ID NO: 18;
    the CDR2 sequence of the VL region of the antibody RYB2, SEQ ID NO: 19;
    the CDR3 sequence of the VL region of the antibody RYB2, SEQ ID NO: 20;
    the VH region sequence of the antibody RYB3, SEQ ID NO: 21;
    the CDR1 sequence of the VH region of the antibody RYB3, SEQ ID NO: 22;
    the CDR2 sequence of the VH region of the antibody RYB3, SEQ ID NO: 23;
    the CDR3 sequence of the VH region of the antibody RYB3, SEQ ID NO: 24;
    the VL region sequence of the antibody RYB3, SEQ ID NO: 25;
    the CDR1 sequence of the VL region of the antibody RYB3, SEQ ID NO: 26;
    the CDR2 sequence of the VL region of the antibody RYB3, SEQ ID NO: 27; and
    the CDR3 sequence of the VL region of the antibody RYB3, SEQ ID NO: 28.

    EXAMPLE 9

    Competition Study of the Antibodies

    [0120] For the study of competition between the antibodies, RYB1, RYB2 and RYB3 were labelled with fluorescein isothiocyanate (FITC) using FluoroTag FITC Conjugation Kit (Sigma-Aldrich, USA) according to the manufacturer's instructions. In preliminary flow cytometric analysis of the binding of FITC-labelled antibodies at various concentrations to permeabilized HEK-E1E2 cells, the association constants K.sub.a and antibody concentrations at which the binding reaction reaches saturation were determined. To this end, the relationship between the mean fluorescence values of cells incubated with labelled antibodies and antibody concentration was measured. Table 1 shows the association constants and antibody concentrations sufficient to saturate specific binding centers which are the HCV E1-E2 protein complexes, after 2-hours incubation.

    TABLE-US-00001 TABLE 1 The association constants and antibody concentrations sufficient to saturate specific binding centers, in HEK-E1E2 cells after 2-hours of incubation. Saturating concentration Antibody Ka (M.sup.1 .Math. c.sup.1) (g/ml) RYB1 8300 5.0 RYB2 10000 4.2 RYB3 20000 2.1

    [0121] In the experiment studying antibody competition, mixtures of FITC-labelled and unlabeled antibodies were established in ratios of 1:0 (only a labelled antibody), 1:5 and 1:20 in all possible combinations. According to preliminary experiment data, the concentration of labelled antibodies in the mixtures was selected to be equal to 5 g/ml for RYB1 and RYB2 and 2 g/ml for RYB3. The fully human monoclonal antibody Adalimumab (brand name Humira), which is specific for tumor necrosis factor alpha and which belongs to the subclass IgG1, was used as the negative control. 1.5 ml of a 0.3 BSA solution in PBS was added to suspended samples of permeabilized HEK-E1E2 cells, incubated 5 min, cells were pelleted by centrifugation and resuspended in 20 l of a mixture of labelled and unlabeled antibodies. Cells were incubated for 2 hours at room temperature, then washed in a 1.5 ml of a 0.3% BSA solution in PBS and suspended in 400 l of 1% formaldehyde in PBS. Cell fluorescence was analyzed on a FACS-Calibur flow cytometer (BD Biosciences, USA) and the average fluorescence values were determined for each sample. The level of fluorescence due to the nonspecific binding of labelled antibodies to cells was determined in a similar manner by using untransfected HEK293 cells instead of HEK-E1E2.

    [0122] The experimental results are shown in FIG. 4. They show that antibodies RYB1, RYB2 and RYB3 effectively compete with each other for binding to the E1-E2 protein complex. The degrees of antibody competition in heterologous pairs are virtually indistinguishable from competition in homologous pairs. Thus, the human antibody Adalimumab does not compete with any of the antibodies studied.

    [0123] It appears that the epitopes of these antibodies overlap each other or are located close to one other in the spatial structure of the protein E2, such that binding an antibody to one of the epitopes prevents the interaction of another epitope with its antibody, indicating the correct use of the proposed set of epitopes for affecting the hepatitis C virus using the obtained antibodies.

    EXAMPLE 10

    Formation of Complexes of Antibodies with Recombinant Protein E2

    [0124] The amino acid sequence (SEQ ID NO: 29), which corresponds to the sequence of the E2 protein of the hepatitis C virus of isolate H77 (genotype 1a), was obtained from the international database NCBI Protein (http://www.ncbi.nlm.nih.gov/protein). The sequence has a reference number NP_751921.1 and contains 363 amino acid residues with coordinates 384-746 of the HCV polyprotein sequence of the same isolate (reference number NP_671491.1). The E2 protein amino acid sequence was subject to reverse translation in silico to produce the nucleotide sequence which encodes the E2 protein and which is codon optimized for expression in the bacteria E. coli. On the basis of this sequence, the E2 protein gene was constructed by chemical synthesis and inserted into the prokaryotic expression vector pET100/D-TOPO (Invitrogen, USA) to produce the plasmid pET100-E2. During insertion, the regions which code Xpress-epitope and 6xHis-tag were removed from the vector.

    [0125] The plasmid PET100-E2 transformed E. coli cells of the strain BL21 (DE3), clones of bacterial transformants were grown at 37 C. in the shaker incubator Innova 43R (New Brunswick Scientific, USA) in glass flasks of 2 l to an optical density of OD.sub.600=0.5, the recombinant product expression was induced by adding IPTG up to 1 mM and then bacteria were grown for another 150 minutes. The recombinant protein E2 was removed from the bacteria lysate using standard chromatographic procedures.

    [0126] Attempts to demonstrate the binding of antibodies RYB1, RYB2, and RYB3 to recombinant E2 protein by the traditional method of Western-analysis in which electrophoresis is carried out in a polyacrylamide gel in the presence of sodium dodecyl sulphate (SDS) did not yield positive results. Apparently a change in the conformation of the E2 protein under the effect of SDS violates the structure of epitopes recognized by the antibodies. Therefore, an alternative approach to monitoring complexes was used which is based on mass spectrometry.

    [0127] For the formation of complexes with antibodies, 5 l purified E2 protein solution with a concentration of 4 M in PBS was mixed with 5 l of a solution of one of the antibodies RYB1, RYB2 and RYB3 with a concentration of 2 M. 1 l of stabilizing reagent K200 from K200 MALDI MS analysis kit (CovalX, Switzerland) was added to 9 l of the produced mixture and incubated for 3 hours at room temperature. Processing using a stabilizing reagent causes covalent crosslinking of the complex components (Bich C, Maedler S, Chiesa K, DeGiacomo F, Bogliotti N, Zenobi Anal Chem 2010 82 (1):172-179). Thus the molecular mass of the complex increased by about 4-5% due to the addition of stabilizing agent molecules.

    [0128] The samples for mass spectrometric analysis by matrix-assisted laser desorption/ionization (MALDI) were prepared in the following manner. After incubation, 1 l matrix, which consists of recrystallized sinapic acid (10 mg/ml) in an acetonitrile-water solution (1:1, v/v) additionally containing 0.1% trifluoroacetic acid, was added to 1 l of a mixture comprising crosslinked complexes. 1 l of the resulting mixture was applied to the MALDI-plate MTP AnchorChip 384 TF (Bruker Daltonik, Germany), where the sample was crystallized at room temperature.

    [0129] Immediately after crystallization, the plate with samples is placed in a receiver device of the time-of-flight mass analyzer Ultraflex III MALDI TOF TOF (Bruker Daltonik, Germany) equipped with the detector HM3 High-Mass system (CovalX, Switzerland), which makes it possible to register microaggregates with a molecular mass of up to 2 MDa with sensitivity in the nanomolar range. Mass spectrometric analysis was performed using a standard nitrogen laser in a linear positive range at the following configurable parameters: Ion Source 1: 20 kV, Ion Source 2: 17 kV, Lens: 12 kV, Pulse Ion Extraction: 400 ns, HM3 Gain Voltage: 3.14 kV, HM3 Acceleration Voltage: 20 kV. The spectra were averaged over 300 events of laser detection. Clusters of insulin, bovine serum albumin and immunoglobulin G were used to calibrate the instrument. The data were processed using the program Complex Tracker analysis, version 2.0 (CovalX, Switzerland). All measurements were repeated three times.

    [0130] Analysis of pure E2 protein, as well as preparations of antibodies taken separately, showed (FIG. 5, A-D) that neither the E2 protein nor antibodies form complexes or aggregates by themselves. It should be noted that due to treatment using a stabilizing reagent, the observed molecular weight of the recombinant E2 protein, which according to calculations is 40048 Da, grows on average to 44215 Da. An additional peak with a molecular weight of about 60 kDa, which is present in the spectra of antibody samples, corresponds, most likely, to an associated protein. After mixing the E2 protein with preparations of antibodies, peaks appear in the spectrum of the samples (FIG. 5 E-G), which correspond in weight to molecular complexes comprising one antibody molecule and one or two molecules of the E2 protein (Table. 2). The stoichiometric structure of the complexes fully corresponds to the bivalent nature of monoclonal IgG antibodies. Thus, the ability of RYB1, RYB2 and RYB3 antibodies to form complexes with recombinant E2 protein in a solution is confirmed.

    TABLE-US-00002 TABLE 2 The molecular weights of complexes of the E2 protein with antibodies RYB1, RYB2 and RYB3. Sample composition Observed molecular weight Molecular structure E2 44,215 Da E2 RYB1 154,158 Da RYB1 RYB2 154,258 Da RYB2 RYB3 155,145 Da RYB3 E2 + RYB1 (2:1) 44,187 Da E2 154,215 Da RYB1 198,214 Da E2-RYB1 242,102 Da E2-RYB1-E2 E2 + RYB2 (2:1) 44,213 Da E2 154,345 Da RYB2 198,321 Da E2-RYB2 242,127 Da E2-RYB2-E2 E2 + RYB3 (2:1) 44,225 Da E2 155,084 Da RYB3 199,402 Da E2-RYB3 243,547 Da E2-RYB3-E2

    EXAMPLE 11

    Determination of Antibody Epitopes

    [0131] In order to determine the epitope specificity of the RYB1, RYB2 and RYB3 antibodies with a high resolution, antigen-antibody complexes were treated with a crosslinking reagent labelled with deuterium, and were then subjected to multienzyme proteolysis. The obtained peptides were analyzed and identified using nano-liquid chromatography followed by mass spectrometry. The epitopes were determined by the disappearance of a series of tagged peptides from the spectrum of antigen proteolysis products in the case of the formation of a complex with an antibody. Below is a detailed description of each of the steps of the procedure.

    [0132] In the first step antigen-antibody complexes were formed in a stoichiometric ratio of 2:1 under the following conditions: 5 l of recombinant E2 protein solution (see example 10) with a concentration of 4 M were mixed with 5 l of a solution of one of the antibodies RYB1, RYB2 or RYB3 with concentration of 2 M and incubated for 180 minutes at 37 C. 10 l of a solution of E2 protein with a concentration of 2 M was used as a pure antigen sample. The pure antigen sample was also incubated for 180 minutes at 37 C.

    [0133] In the second step 1 l of a pre-prepared mixture (1:1) of the crosslinking reagents disuccinimidyl suberate DSS-d0 and disuccinimidyl suberate DSS-d12 labelled with 12 deuterium atoms (CovalX, Switzerland) with a total concentration 2 mg/ml in dimethylformamide were added to the antigen-antibody complex samples and pure antigen sample. The samples were incubated for 180 min at room temperature in order to form crosslinks.

    [0134] In the third step disulphide bonds are reduced and alkylation is carried out on the samples to facilitate subsequent proteolysis. 20 l 25 mM ammonium bicarbonate, pH 8.3, and 2.5 l 500 mM dithiothreitol were added to samples after the crosslinking reaction, incubated for 60 min at 55 C., after which 2.5 l 1M iodoacetamide was added and incubated for another 60 minutes at room temperature in a place without light.

    [0135] In the fourth step the samples were subjected to proteolysis using trypsin or -chymotrypsin. For the treatment with trypsin, 120 l proteolysis buffer (100 mM Tris-HCl, pH 7.8, 10 mM CaCl.sub.2) and a 2 l trypsin solution (1 mg/ml) were added to the samples and incubated overnight at 37 C. For the treatment with -chymotrypsin, 120 l of the same proteolysis buffer and a 2 l -chymotrypsin solution (200 M) were added to the samples and incubated overnight at 30 C.

    [0136] In the fifth step the proteolysis products were separated on the nano-liquid chromatograph Ultimate 3000 (Dionex, Germany) with the aid of a preliminary column 300-m ID5-mm C4 PepMap and main column 75-m ID5-cm C4 PepMap in a gradient (95% H.sub.2O, 5% acetonitrile, 0.1% HCOOH)-(20% H.sub.2O, 80% acetonitrile, 0.1% HCOOH).

    [0137] In the sixth step the material of the chromatographic peaks undergoes mass spectrometric analysis on the instrument LTQ Orbitrap XL (Thermo Scientific, USA) connected by hardware to a chromatographic system. Since the crosslinking reagent used for processing complexes is a mixture of deuterium-labelled and unlabeled molecules in a 1:1 ratio, each peptide, which carries one molecule of crosslinking reagent, is shown in the mass spectrum by two signals of the same intensity, differing from each other by exactly 12 atomic unitsthe number of deuterium atoms in the molecule DSS-d12 (in the case of singly ionized peptides). This fact makes it possible to produce a primary set of signals corresponding to the peptides with a single molecule of the crosslinking reagent. These peptides were further identified with the determination of their amino acid sequence on the basis of data from mass spectrometry using the software XQuest, version 2.0, and databases CovalX_110823_01.fasta of the company CovalX (Switzerland), using an amino acid sequence of recombinant protein E2 (SEQ ID NO: 29). In addition, for each peptide the position of the amino acid covalently linked to the crosslinking reagent molecule was also established.

    [0138] The seventh step involves a comparison of the spectra of pure E2 protein proteolysis products and E2 protein stoichiometric complexes with antibodies. The absence of a specific peptide among the products of proteolysis of the complex indicates close contact between some amino acids of the peptide with an antibody, i.e. overlapping of the peptide sequence with the desired epitope for this antibody. It should be noted that the interaction between the antigen and the antibody itself does not change the spectrum of proteolysis products as the proteolytic reaction is preceded by the reduction of disulphide bonds and alkylation of the samples, leading to the destruction of the antigen-antibody complexes. Furthermore, the formation of the antigen-antibody complex may prevent a chemical reaction binding crosslinking reagent molecules with the antigen amino acids which are in close proximity to the antibody. As a result, peptides comprising these amino acids are free of crosslinking reagent, do not pass primary selection and drop out of observation.

    [0139] Table. 3 shows the sequences of pure E2 protein proteolysis products carrying one molecule of crosslinking reagent. Tables 4-6 show the peptides from Table. 3 which are not present among the proteolysis of the E2 protein complexes with antibodies RYB1, RYB2 and RYB3.

    TABLE-US-00003 TABLE3 E2proteinproteolysisproductscarryingonemoleculeofcrosslinking reagent.Thecoordinatesofthefirstandlastaminoacidsofthe peptidearestated,aswellasthecoordinatesoftheaminoacid covalentlybondedtothecrosslinkingreagent. Aminoacid First Last boundtothe amino amino Proteolysis crosslinking Peptidesequence acid acid enzyme reagent ETHVTGGSAGRTTAGLVGLL 384 403 chymotrypsin His 386 ETHVTGGSAGRTTAGLVGLL 384 403 chymotrypsin Ser 391 ETHVTGGSAGRTTAGLVGLL 384 403 chymotrypsin Arg 394 ETHVTGGSAGRTTAGLVGLL 384 403 chymotrypsin Thr 396 TPGAKQNIQLINTNGSW 404 420 chymotrypsin Lys 408 TPGAKQNIQLINTNGSW 404 420 chymotrypsin Ser 419 INTNGSW 414 420 chymotrypsin Ser 419 NCNESLNTGWL 428 438 chymotrypsin Ser 432 NCNESLNTGWL 428 438 chymotrypsin Thr 435 AQGWGPISY 466 474 chymotrypsin Ser 473 GPISYANGSGLDERPY 470 485 chymotrypsin Ser 473 AQGWGPISY 466 474 chymotrypsin Tyr 474 GPISYANGSGLDERPY 470 485 chymotrypsin Ser 478 ANGSGLDERPY 475 485 chymotrypsin Ser 478 ANGSGLDERPYCW 475 487 chymotrypsin Ser 478 GPISYANGSGLDERPY 470 485 chymotrypsin Arg 483 ANGSGLDERPY 475 485 chymotrypsin Arg 483 ANGSGLDERPYCW 475 487 chymotrypsin Arg 483 CWHYPPRPCGIVPAKSVCGPVY 486 507 chymotrypsin His 488 CWHYPPRPCGIVPAKSVCGPVY 486 507 chymotrypsin Arg 492 HYPPRPCGIVPAKSVCGPVY 488 507 chymotrypsin Arg 492 HYPPRPCGIVPAKSVCGPVY 488 507 chymotrypsin Lys 500 PCGIVPAK 493 500 trypsin Lys 500 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Lys 500 CGIVPAKSVCGPVYCFTPSPVWGTTDR 494 521 trypsin Lys 500 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Lys 500 CWHYPPRPCGIVPAKSVCGPVY 486 507 chymotrypsin Ser 501 HYPPRPCGIVPAKSVCGPVY 488 507 chymotrypsin Ser 501 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Ser 501 CGIVPAKSVCGPVYCFTPSPVVVGTTDR 494 521 trypsin Ser 501 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Ser 501 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Tyr 507 CGIVPAKSVCGPWCFTPSPVVVGTTDR 494 521 trypsin Tyr 507 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Tyr 510 CFTPSPVVVGTTDRS 508 522 chymotrypsin Thr 512 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Ser 512 CFTPSPVVVGTTDRSGAPTY 508 527 chymotrypsin Ser 512 CFTPSPVVVGTTDRS 508 522 chymotrypsin Ser 512 TPSPVWGTTDRSGAPTY 510 527 chymotrypsin Ser 512 CGIVPAKSVCGPVYCFTPSPVVVGTTDR 494 521 trypsin Ser 512 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Ser 512 CFTPSPVVVGTTDR 508 521 trypsin Ser 512 FTPSPVVVGTTDR 509 521 trypsin Ser 512 CGIVPAKSVCGPVYCFPSPVVVGTTDR 494 521 trypsin Thr 518 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Thr 518 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Thr 518 CFTPSPVVVGTTDRSGAPTY 508 527 chymotrypsin Thr 518 CFTPSPVVVGTTDRS 508 522 chymotrypsin Thr 518 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Thr 518 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Thr 518 CFTPSPVVVGTTDR 508 521 trypsin Thr 518 FTPSPVVVGTTDR 509 521 trypsin Thr 519 TPSPVVVGTTDRSGAPTY 510 527 chymotrypsin Thr 519 PCGIVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Arg 521 CFTPSPVWGTTDR 508 521 trypsin Arg 521 FTPSPVWGTTDR 509 521 trypsin Arg 521 CFTPSPVVVGTTDRSGAPTY 508 527 chymotrypsin Ser 522 CFTPSPWVGTTDRS 508 522 chymotrypsin Ser 522 TPSPVVVGTTDRSGAPTY 510 527 chymotrypsin Ser 522 MNSTGFTKVCGAPPCVIGGVGNNTLL 555 580 chymotrypsin Ser 557 MNSTGFTKVCGAPPCVIGGVGNNTLL 555 580 chymotrypsin Lys 562 TKVCGAPPCVIGGVGNNTLL 561 580 chymotrypsin Lys 562 MNSTGFTKVCGAPPCVIGGVGNNTLL 555 580 chymotrypsin Thr 578 TKVCGAPPCVIGGVGNNTLL 561 580 chymotrypsin Thr 578 CPTDCF 581 586 chymotrypsin Thr 583 RKHPEATYSRCGSGPW 587 602 chymotrypsin Arg 587 KHPEATYSRCGSGPWITPR 588 606 trypsin Lys 588 RKHPEATYSRCGSGPW 587 602 chymotrypsin Ser 595 SRCGSGPW 595 602 chymotrypsin Ser 595 KHPEATYSRCGSGPWITPR 588 606 trypsin Ser 595 HPEATYSRCGSGPWITPR 589 606 trypsin Ser 595 RKHPEATYSRCGSGPW 587 602 chymotrypsin Arg 596 SRCGSGPW 595 602 chymotrypsin Arg 596 KHPEATYSRCGSGPWITPR 588 606 trypsin Arg 596 HPEATYSRCGSGPWITPR 589 606 trypsin Arg 596 RKHPEATYSRCGSGPW 587 602 chymotrypsin Ser 599 SRCGSGPW 595 602 chymotrypsin Ser 599 KHPEATYSRCGSGPWITPR 588 606 trypsin Ser 599 HPEATYSRCGSGPWITPR 589 606 trypsin Ser 599 ITPRCMVDYPY 603 613 chymotrypsin Arg 606 KHPEATYSRCGSGPWITPR 588 603 trypsin Arg 606 HPEATYSRCGSGPWITPR 589 603 trypsin Arg 606 CGSGPWITPRCMVDYPYR 597 614 trypsin Arg 606 CGSGPWITPRCMVDYPYR 597 614 trypsin Tyr 611 ITPRCMVDYPY 603 613 chymotrypsin Tyr 613 CGSGPWITPRCMVDYPYR 597 614 trypsin Arg 614 CMVDYPYR 607 614 trypsin Arg 614 MYVGGVEHR 631 639 trypsin Tyr 632 VGGVEHRLEAACNW 633 646 chymotrypsin His 638 VGGVEHRL 633 640 chymotrypsin Arg 639 MYVGGVEHR 631 639 trypsin Arg 639 LEAACNWTR 640 648 trypsin Arg 648 GERCDLEDR 649 657 trypsin Arg 651 GERCDLEDR 649 657 trypsin Arg 657 LLSTTQW 666 672 chymotrypsin Ser 668 LLSTTQW 666 672 chymotrypsin Thr 670 HQNIVDVQY 693 701 chymotrypsin Tyr 701 LYGVGSSIASW 702 712 chymotrypsin Ser 707 YGVGSSIASW 703 712 chymotrypsin Ser 707 LYGVGSSIASW 702 712 chymotrypsin Ser 708 YGVGSSIASW 703 712 chymotrypsin Ser 708 LYGVGSSIASW 702 712 chymotrypsin Ser 711 YGVGSSIASW 703 712 chymotrypsin Ser 711 LADARVCSCLW 726 736 chymotrypsin Arg 730 ADARVCSCL 727 735 chymotrypsin Arg 730 ADARVCSCLW 727 736 chymotrypsin Arg 730 LADARVCSCLW 726 736 chymotrypsin Ser 733 ADARVCSCL 727 735 chymotrypsin Ser 733 ADARVCSCLW 727 736 chymotrypsin Ser 733

    TABLE-US-00004 TABLE4 ThepeptidesfromTable3whicharenotpresentamongtheproteolysis productsoftheE2proteincomplexeswithantibodyRYB1,whichcarry onecrosslinkingreagentmolecule. First Last Aminoacidbound amino amino Proteolysis tothecrosslinking Peptidesequence acid acid enzyme reagent RKHPEATYSRCGSGPW 587 602 chymotrypsin Ser 595 SRCGSGPW 595 602 chymotrypsin Ser 595 KHPEATYSRCGSGPWITPR 588 606 trypsin Ser 595 HPEATYSRCGSGPWITPR 589 606 trypsin Ser 595 RKHPEATYSRCGSGPW 587 602 chymotrypsin Arg 596 SRCGSGPW 595 602 chymotrypsin Arg 596 KHPEATYSRCGSGPWITPR 588 606 trypsin Arg 596 HPEATYSRCGSGPWITPR 589 606 trypsin Arg 596

    TABLE-US-00005 TABLE5 ThepeptidesfromTable3whicharenotpresentamongtheproteolysis productsoftheE2proteincomplexeswithantibodyRYB2,whichcarry onecrosslinkingreagentmolecule. First Last Aminoacidbound amino amino Proteolysis tothecrosslinking Peptidesequence acid acid enzyme reagent PCGOVPAKSVCGPVYCFTPSPVVVGTTDR 493 521 trypsin Tyr 507 CGIVPAKSVCGPVYCFTPSPVVVGTTDR 494 521 trypsin Tyr 507 GIVPAKSVCGPVYCFTPSPVVVGTTDR 495 521 trypsin Tyr 507

    TABLE-US-00006 TABLE6 ThepeptidesfromTable3whicharenotpresentamongtheproteolysis productsoftheE2proteincomplexeswithantibodyRYB3,whichcarry onecrosslinkingreagentmolecule. First Last Aminoacidbound amino amino Proteolysis tothecrosslinking Peptidesequence acid acid enzyme reagent RKHPEATYSRCGSGPW 587 602 chymotrypsin Ser 595 SRCGSGPW 595 602 chymotrypsin Ser 595 KHPEATYSRCGSGPWITPR 588 606 trypsin Ser 595 HPEATYSRCGSGPWITPR 589 606 trypsin Ser 595 RKHPEATYSRCGSGPW 587 602 chymotrypsin Arg 596 SRCGSGPW 595 602 chymotrypsin Arg 596 KHPEATYSRCGSGPWITPR 588 606 trypsin Arg 596 HPEATYSRCGSGPWITPR 589 606 trypsin Arg 596 RKHPEATYSRCGSGPW 587 602 chymotrypsin Ser 599 SRCGSGPW 595 602 chymotrypsin Ser 599 KHPEATYSRCGSGPWITPR 588 606 trypsin Ser 599 HPEATYSRCGSGPWITPR 589 606 trypsin Ser 599

    [0140] Analysis of the arrangement of the crosslinking reagent molecules on the peptide products of the E2 protein proteolysis before and after the formation of complexes with an antibody makes it possible to very accurately locate the regions of E2 which come into contact with the antibody. Thus, in the case of the antibody RYB1, the amino acids of the E2 protein on the regions from the N-terminus to lysine Lys588, inclusive, and beginning from serine Ser599 to the C-terminus, retain the ability to bind with the crosslinking reagent independently of the formation of a complex with the antibody (FIG. 6). In addition, the amino acids serine Ser595 and arginine Arg596 lose the ability to bind with the crosslinking reagent after the complex has been formed. On the basis of these data, it can be concluded that the E2 protein epitope for the antibody RYB1 (epitope Ep1) is a continuous amino acid sequence comprising the amino acids Ser595 and Arg596 and enclosed within the region HPEATYSRCG (589-598) (SEQ ID NO: 30). It is most likely that the epitope is the central fragment of this region of 6 amino acids: EATYSR (591-596) (SEQ ID NO: 31). This epitope is not described in the literature.

    [0141] In the case of the antibody RYB2, the amino acids of the E2 protein on the regions from the N-terminus to serine Ser501, inclusive, and beginning from threonine Thr510 to the C-terminus, retain the ability to bind with the crosslinking reagent independently of the formation of a complex with the antibody (FIG. 7). In addition, the amino acid tyrosine Tyr507 loses the ability to bind with the crosslinking reagent after the complex has been formed. On the basis of these data, it can be concluded that the E2 protein epitope for the antibody RYB2 (epitope Ep2) is a continuous amino acid sequence comprising the amino acid Tyr507 and enclosed within the region VCGPVYCF (502-509) (SEQ ID NO: 32). It is most likely that the epitope is the central fragment of this region of 6 amino acids: CGPVYC (503-508) (SEQ ID NO: 33). This epitope is not described in the literature.

    [0142] In the case of the antibody RYB3, the amino acids of the E2 protein on the regions from the N-terminus to lysine Lys588, inclusive, and beginning from arginine Arg606 to the C-terminus, retain the ability to bind with the crosslinking reagent independently of the formation of a complex with the antibody (FIG. 8). In addition, the amino acids serine Ser595, arginine Arg596 and serine Ser599 lose the ability to bind with the crosslinking reagent after the complex has been formed. On the basis of these data, it can be concluded that the E2 protein epitope for the antibody RYB3 (epitope Ep3) is a continuous amino acid sequence comprising the amino acids Ser595, Arg596 and Ser599 and enclosed within the region HPEATYSRCGSGPWITP (589-605) (SEQ ID NO: 34). It is most likely that the epitope is the inner fragment of this region of 6 amino acids: YSRCGS (594-599) (SEQ ID NO: 35) or SRCGSG (595-600) (SEQ ID NO: 36). This epitope is not described in the literature.

    [0143] It should be noted that the epitopes Ep1 and Ep3 have the amino acids Ser595 and Arg596 arginine in common and therefore overlap, which is consistent with experimental data on the mutual competition of antibodies (Example 9). Analysis of the obtained sequences of epitopes shows (tab. 7) that epitope Ep2 is absolutely conserved for all genotypes. Epitopes Ep1 and Ep3 contain both conservative and variable amino acids.

    TABLE-US-00007 TABLE7 HomologyofthesequencesoftheepitopesandsurroundingregionsoftheE2proteinof HCVofdifferentgenotypes.Themostlikelysequencesofepitopesareindicatedinbold. TheaminoacidsequencesoftheE2proteinofvariousgenotypesweretakenfromthework ofSaboetal.(SaboMC,LucaVC,PrentoeJ,HopcraftSE,BlightKJ,YiM,LemonSM, BallJK,BukhJ,EvansMJ,FremontDH,DiamondMSJVirol2011,85(14):7005-7019). VirusGenotype Virusisolate EpitopeEp1 EpitopeEp2 EpitopeEp3 1 H77 HPEATYSRCG VCGPVYCF HPEATYSRCGSGPWITP 2 J6 HPDTTYLKCG VCGPVYCF HPDTTYLKCGSGPWLTP 3 UKN3a HPEATYSRCG VCGPVYCF HPEATYSRCGSGPWLTP 4 UKN4a HPETTYAKCG VCGPVYCF HPETTYAKCGSGPWITP 5 SA13 HPDATYTKCG VCGPVYCF HPDATYTKCGSGPWLTP 6 UKN6 HPEATYQRCG VCGPVYCF HPEATYQRCGSGPWLTP

    EXAMPLE 12

    Determination of the Conformational Nature of the Epitopes

    [0144] The fact that it was not possible to observe the reaction of antibodies RYB1, RYB2 and RYB3 with the E2 protein by Western-analysis suggests that the epitopes for these antibodies, which were established in Example 11, are conformational in nature. To verify this assumption, a series of experiments were made to determine the ability of short peptides containing epitopes to compete with full-length recombinant protein E2 for binding to antibodies. Since short peptides do not retain the conformation of the starting protein, a positive result of the experiments regarding competition would indicate that the recognition of epitopes by antibodies does not depend on the conformational structure of epitopes and is only determined by the amino acid sequences thereof (linear nature of the epitopes). Conversely, a negative result would indicate the importance of the conformational structure for interacting with these antibodies (conformational nature of the epitopes).

    [0145] A set of peptides was obtained by proteolysis of recombinant E2 protein using immobilized pepsin in the following conditions. 5 l of a suspension of agarose carrier with immobilized pepsin (Thermo Scientific, USA) was added to a 25 l solution of E2 protein (see example 10) in PBS with a concentration of 13 mM, and incubated for 30 minutes at room temperature. After incubation the samples were centrifuged and the supernatant containing the proteolytic products was transferred to other test tubes. The reaction conditions were optimized to obtain most of the peptide products in the range of 1000-3500 Da (8-30 amino acid residues). Pepsin has little specificity regarding hydrolyzable peptide bonds, so it is expected that the representativeness of any short sequences of a starting protein, in particular epitopes for antibodies RYB1, RYB2 and RYB3, among proteolysis products is about the same, and corresponds to the molar concentration of the starting protein.

    [0146] Competition binding experiments were carried out under the following conditions. 5 l of a preparation of one of the antibodies RYB1, RYB2 or RYB3 with a concentration of 4 M was added to 5 l of a peptide mixture sample with a concentration of 13 M (according to staring protein E2) and incubated for 6 hours at 37 C. The concentration of peptides in the sample provided a clear excess of epitope sequences relative to the concentration of antibody binding centers (1625:1). Then, 10 l of a solution of recombinant E2 protein with a concentration of 4 M was added to the reaction mixture and treatment was carried out using stabilizing agent K200 as described in Example 10. The samples then underwent mass spectrometric analysis using MALDI technology with the aid of the time-of-flight mass analyzer Ultraflex III MALDI TOF TOF as described in the same example.

    [0147] The results of the experiments showed (FIG. 9) that short peptides comprising epitopes do not inhibit the binding of a full length E2 protein to antibodies. Protein complexes are formed in the presence of an excess quantity of peptides, which have an identical molecular structure to that of the E2 protein complexes with antibodies, which are characterized in Example 6. Based on these data it can be concluded that binding antibodies RYB1, RYB2 and RYB3 to epitopes thereof is only possible with certain conformations of epitopes in the spatial structure of a molecule of protein E2. Thus, the epitopes of these antibodies are conformational in nature.

    EXAMPLE 13

    Investigation of the Neutralizing Activity of the Antibodies

    [0148] The neutralizing activity of the antibodies, i.e. the ability of antibodies RYB1, RYB2 and RYB3 to prevent cells from becoming infected with the virus, was studied on the model of a human hepatocellular carcinoma cell culture, Huh-7 with the use of pseudo-viral particles HCVpp. HCVpp particles are pseudolentiviral particles carried as E1-E2 envelope protein complexes of the hepatitis C virus (Bartosch B, Dubuisson J, Cosset F L. J Exp Med 2003, 197 (5): 633-642).

    [0149] The pseudo-viral particles HCVpp were prepared as described below. HEK293-TN cells (System Biosciences, USA), which express the large T antigen of the SV40 virus, were grown in T225 flasks (Corning, USA) in a DMEM medium with high quantity of glucose, which additionally contains 10% inactivated fetal bovine serum (Invitrogen, USA) and 2 mM glutamine, to a density of up to 70% of a monolayer. Immediately before transfection, the medium in the vials was changed for a fresh DMEM medium containing 2% fetal bovine serum. Transfection of cells was carried out with a mixture of plasmids pCMVdeltaR8.2, pSIH-CMV-CopGFP-H1 (MonA Ltd., Moscow) and pcDNA3.1-E1E2 (see. Example 3) using the reagent Lipofectamine 2000 (Invitrogen, USA). 225 l of the reagent Lipofectamine 2000 was added to 1.5 ml serum-free DMEM medium, mixed by pipetting and added dropwise to a pre-prepared solution of a mixture of plasmids (54 g pCMVdeltaR8.2, 18 g pSIH-CMV-CopGFPHI and 18 g pcDNA3.1-E1E2 in 1.5 mL serum-free DMEM medium). The resultant solution was stirred and incubated for 15 min and poured into a flask with the HEK293-TN cells. The cells were incubated for 24 hours at 37 C. in a CO.sub.2 incubator in an atmosphere of 5% CO.sub.2, after which the culture medium was replaced with fresh medium and the cells were incubated for 48 hours. After incubation, the culture medium containing the HCVpp particles was collected and filtered through cellulose acetate membrane filters with a pore size of 0.22 m (Corning, USA). Portions of the medium were frozen and stored at 80 C.

    [0150] The plasmid pCMVdeltaR8.2 contains the genes gag-pol and rev of the human immunodeficiency virus (HIV), the expression products of which are necessary for packaging pseudolentiviral particles and incorporating the viral genome into the genomic DNA of the infected host cell. The plasmid pSIH-CMV-CopGFP-H1 encodes the genomic RNA of the lentiviral vector based on HIV and carries in its structure the gene of green fluorescent protein CopGFP of the copepod Pontellina plumata under the control of a highly effective promotor of cytomegalovirus early genes. The plasmid pcDNA3.1-E1E2 encodes proteins E1 and E2 of the HCV envelope. During the simultaneous expression of genes of the above three plasmids in transfected cells, the cells produce the pseudoviral particles HCVpp in the culture medium, the interior of which is lentivector genomic RNA in a complex with the products of the genes gag-pol and rev, and the HCV protein complex E1-E2 serves as an envelope. Such particles can infect Huh-7 cells by a mechanism similar to the mechanism for infecting liver cells with the HCV virus. Thus the CopGFP gene, in the structure of the lentivector genome, integrates into the DNA of the infected cell and is expressed to form a fluorescent product, which makes it possible to detect infection by means of the fluorometric method.

    [0151] An experiment to measure the neutralizing activity of the antibodies was performed as follows. Solutions of the antibodies RYB1, RYB2 and RYB3 were prepared with a concentration of 1 mg/ml. A composition of antibodies RYB1:RYB2:RYB3=1:1:1 was prepared by mixing 200 l of an RYB1 solution, 200 l of an RYB2 solution and 200 l of an RYB3 solution. A composition of antibodies RYB1:RYB2: RYB3=20:40:40 was prepared by mixing 100 l of an RYB1 solution, 200 l of an RYB2 solution and 200 l of an RYB3 solution. A composition of antibodies RYB1:RYB2:RYB3=40:20:40 was prepared by mixing 200 l of an RYB1 solution, 100 l of an RYB2 solution and 200 l of an RYB3 solution. Lastly, a composition of antibodies RYB1:RYB2:RYB3=40:40:20 was prepared by mixing 200 l of an RYB1 solution, 200 l of an RYB2 solution and 100 l of an RYB3 solution.

    [0152] 100 l of solution of antibodies RYB1, RYB2 and RYB3 at a concentration of 1 mg/ml or 100 l of one of the prepared compositions were added to 1.9 ml of cultured medium comprising the pseudoviral particles HCVpp, and incubated for 1 hour at 37 C. The total antibody concentration in all of the samples of the incubation mixture was 50 g/ml. The human monoclonal antibody Adalimumab was used as a negative control, which was also added to a final concentration of 50 g/ml. Huh-7 cells were grown in wells of 6 well culture plates (Corning, USA) in a DMEM medium additionally containing 10% inactivated fetal bovine serum (Invitrogen, USA) and 2 mM glutamine to a state of a density of 30% of a monolayer. In order to infect the cells, the culture medium in the plate wells was replaced with preincubated mixtures of HCVpp particles with antibodies, or compositions thereof, and incubated for 3 hours at 37 C. in a CO.sub.2 incubator. After incubation the medium in the plates was replaced with a fresh medium, the cells were cultured for a further 4 days and were subjected to fluorometric analysis on the FACS-Calibur flow cytometer (BD Biosciences, USA). Infection effectiveness was determined as a percentage of fluorescent cells in the sample. The analysis results are shown in Table. 16. As can be seen, the antibodies RYB1, RYB2 and RYB3 exhibit significant neutralizing activity (inhibition of infection in 22-36 times), which opens up the possibility of their wide use in clinical practice. Furthermore, the highest neutralization result is shown by the composition of the three antibodies in a ratio of 1:1:1 (infection inhibition in 53.6 times), and a reduction the content of any antibody in the composition to 20% causes a reduction of neutralizing activity.

    TABLE-US-00008 TABLE 8 Measuring the neutralizing activity of the antibodies. Infection effectiveness Degree of Antibody or composition (percentage of inhibition of antibodies fluorescent cells) (times) 63.3 1 Adalimumab 58.1 1.09 RYB1 1.93 32.8 RYB2 2.87 22.1 RYB3 1.73 36.6 RYB1:RYB2:RYB3 = 1:1:1 1.18 53.6 RYB1:RYB2:RYB3 = 20:40:40 1.41 44.9 RYB1:RYB2:RYB3 = 40:20:40 1.34 47.2 RYB1:RYB2:RYB3 = 40:40:20 1.67 37.9

    [0153] Thus, experiments studying the neutralizing activity of the antibodies in a model system of human hepatocellular carcinoma cells, Huh-7 demonstrated the ability of the antibodies and compositions thereof to effectively inhibit cell infection using pseudoviral particles HCVpp. The degree of inhibition with the optimal selection of composition reaches about 53 times, which indicates the potential usefulness of these antibodies and compositions thereof for clinical use in the prevention and treatment of hepatitis C.