METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES

20170037404 ยท 2017-02-09

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays.

    Claims

    1. A synthetic RNA molecule of between 17 and 125 residues in length comprising a) an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and b) a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence.

    2. The RNA molecule of claim 1, further comprising one or more of the following: i) a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the RNA molecule; ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3 end of the complementary region and the corresponding nucleotides of the miRNA region.

    3. The RNA molecule of claim 2, comprising a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the RNA molecule.

    4. The RNA molecule of claim 3, wherein the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2oxygen-methyl (2O-Me), 4,4-dimethoxytrityl with oxygen (DMTO), fluoroscein, a thiol, or acridine.

    5. The RNA molecule of claim 3, wherein the phosphate of the nucleotide at the 5 terminus of the RNA molecule has been replaced.

    6. The RNA molecule of claim 3, wherein the hydroxyl of the nucleotide at the 5 terminus of the RNA molecule has been replaced.

    7. The RNA molecule of claim 2, comprising one or more sugar modifications in the first or last 1 to 6 residues of the complementary region.

    8. The RNA molecule of claim 7, wherein the sugar modification is a 2O-Me modification.

    9. The RNA molecule of claim 7, comprising one or more sugar modifications in the first 1 to 6 residues of the complementary region.

    10. The RNA molecule of claim 7, comprising one or more sugar modifications in the last 1 to 6 residues of the complementary region.

    11. The RNA molecule of claim 7, comprising one or more sugar modifications in the first or last 2 to 4 residues of the complementary region.

    12. The RNA molecule of claim 2, comprising noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3 end of the complementary region and the corresponding nucleotides of the miRNA region.

    13. The RNA molecules of claim 12, wherein there is noncomplementarity with at least 2 nucleotides in the complementary region.

    14. The RNA molecule of claim 2, comprising at least two of i), ii), or iii).

    15. The RNA molecule of claim 14, comprising i), ii), and iii).

    16. The RNA molecule of claim 1, wherein the RNA molecule is a single polynucleotide.

    17. The RNA molecule of claim 16, further comprising a linker region between the miRNA region and the complementary region.

    18. The RNA molecule of claim 17, wherein the linker region is between 3 and 30 residues in length.

    19. The RNA molecule of claim 1, wherein the RNA molecule is double stranded.

    20. A library of 10 or more different RNA molecules of claim 1.

    21. A library of 10 or more different miRNA inhibitor molecules, wherein each miRNA inhibitor molecule is between about 17 to 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA.

    22. The library of claim 21, wherein the miRNA inhibitor molecules have a replacement group for the phosphate or hydroxyl of the nucleotide at the 5 terminus of the molecule.

    23. The library of claim 22, wherein the replacement group is an amine group, a lower alkylamine group, an acetyl group, or 2O-Me.

    24. The library of claim 22, wherein the phosphate of the nucleotide at the 5 terminus of the miRNA inhibitor molecule has been replaced.

    25. The library of claim 22, wherein the hydroxyl of the nucleotide at the 5 terminus of the miRNA inhibitor molecule has been replaced.

    26. The library of claim 21, wherein the miRNA inhibitor comprises DNA.

    27. A method of characterizing an miRNA activity or function in a cell comprising: a) introducing into one or more cells the RNA molecule of claim 1; b) comparing one or more characteristics of cell(s) having the RNA molecule with cells not having the RNA molecule.

    28. The method of claim 27, wherein at least five RNA molecules are introduced into different cells.

    29. The method of claim 27, further comprising assaying the cell for the presence of the RNA molecule.

    30. The method of claim 27, further comprising synthesizing the RNA molecule.

    31. The method of claim 30, wherein the RNA molecule further comprises one or more of the following: i) a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the RNA molecule; ii) one or more sugar modifications in the first or last 1 to 6 residues of the complementary region; or, iii) noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3 end of the complementary region and the corresponding nucleotides of the miRNA region.

    32. The method of claim 31, wherein the RNA molecule comprises a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the RNA molecule.

    33. The method of claim 32, wherein the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2O-Me, DMTO, fluoroscein, a thiol, or acridine.

    34. The method of claim 32, wherein the phosphate of the nucleotide at the 5 terminus of the RNA molecule has been replaced.

    35. The method of claim 32, wherein the hydroxyl of the nucleotide at the 5 terminus of the RNA molecule has been replaced.

    36. The method of claim 31, wherein the RNA molecule comprises one or more sugar modifications in the first or last 1 to 6 residues of the complementary region.

    37. The method of claim 36, wherein the sugar modification is a 2O-Me modification.

    38. The method of claim 36, wherein the RNA molecule comprises one or more sugar modifications in the first 1 to 6 residues of the complementary region.

    39. The method of claim 36, wherein the RNA molecule comprises one or more sugar modifications in the last 1 to 6 residues of the complementary region.

    40. The method of claim 36, wherein the RNA molecule comprises one or more sugar modifications in the first or last 2 to 4 residues of the complementary region.

    41. The method of claim 31, wherein the RNA molecule comprises noncomplementarity between one or more nucleotides in the last 1 to 5 residues at the 3 end of the complementary region and the corresponding nucleotides of the miRNA region.

    42. The method of claim 41, wherein there is noncomplementarity with at least 2 nucleotides in the complementary region.

    43. The method of claim 31, wherein the RNA molecule comprises at least two of i), ii), or iii).

    44. The method of claim 43, wherein the RNA molecule comprises i), ii), and iii).

    45. The method of claim 27, wherein the RNA molecule is a single polynucleotide.

    46. The method of claim 45, wherein the RNA molecule further comprises a linker region between the miRNA region and the complementary region.

    47. The method of claim 46, wherein the linker region is between 3 and 30 residues in length.

    48. The method of claim 27, wherein the RNA molecule is composed of two polynucleotides.

    49. The method of claim 27, wherein the RNA molecule is introduced into the cell by calcium phosphate transfection, lipid transfection, electroporation, microinjection, or injection.

    50. A method of reducing or eliminating activity of one or more miRNAs from a cell comprising: a) introducing into a cell an miRNA inhibitor that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA.

    51. The method of claim 50, further comprising: b) comparing one or more characteristics of a cell having the miRNA inhibitor with a cell not having the miRNA inhibitor.

    52. The method of claim 50, further comprising assaying the cell for expression of the mature miRNA.

    53. The method of claim 50, further comprising synthesizing the miRNA inhibitor.

    54. The method of claim 51, wherein the miRNA inhibitor further comprises one or more of the following: i) a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the miRNA inhibitor; or ii) one or more sugar modifications.

    55. The method of claim 54, wherein the miRNA inhibitor comprises a replacement group for phosphate or hydroxyl of the nucleotide at the 5 terminus of the miRNA inhibitor.

    56. The method of claim 55, wherein the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2O-Me, DMTO, fluoroscein, a thiol, or acridine.

    57. The method of claim 55, wherein the phosphate of the nucleotide at the 5 terminus of the miRNA inhibitor has been replaced.

    58. The method of claim 55, wherein the hydroxyl of the nucleotide at the 5 terminus of the miRNA inhibitor has been replaced.

    59. The method of claim 54, wherein the miRNA inhibitor comprises one or more sugar modifications in the first or last 1 to 6 residues.

    60. The method of claim 59, wherein the sugar modification is a 2O-Me modification.

    61. The method of claim 59, wherein the miRNA inhibitor comprises one or more sugar modifications in the first 1 to 6 residues of the complementary region.

    62. The method of claim 59, wherein the miRNA inhibitor comprises one or more sugar modifications in the last 1 to 6 residues of the complementary region.

    63. The method of claim 59, wherein the miRNA inhibitor comprises one or more sugar modifications in the first or last 2 to 4 residues of the complementary region.

    64. The method of claim 54, wherein the miRNA inhibitor comprises both i) and ii).

    65. The method of claim 50, wherein the miRNA inhibitor is a single polynucleotide.

    66. The method of claim 50, wherein the miRNA inhibitor is introduced into the cell by calcium phosphate transfection, lipid transfection, electroporation, microinjection, or injection.

    67. A method for reducing or inhibiting cell proliferation in a cell comprising introducing into the cell an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of: mir-31, mir-92, mir-99a, mir-100, mir-125a, mir-129, mir-130a, mir-150, mir-187, miR-190, miR-191, miR-193, miR 204, mir-210, mir-211, mir-212, mir-213, mir-215, mir-216, mir-217, miR 218, mir-224, mir-292, mir-294, mir-320, mir-324, mir-325, mir-326, mir-330, mir-331, mir-338, mir-341, mir-369, and mir-370; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the mature miRNA sequence, wherein the mature miRNA sequence is selected from the group consisting of: miR-15a, miR-16, miR 21, miR 24, miR-96, miR-101, miR-105, miR-124, miR-126, miR-142, miR-147, miR-192, miR-194, miR-206, miR-215, or miR-346.

    68. The method of claim 67, further comprising identifying a cell or a patient having the cell as in need of reducing or inhibiting cell proliferation.

    69. A method for inducing or increasing cell proliferation in a cell comprising introducing into the cell an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of let7a-1, Let-7a, Let-7b, let7b-1, let7c, let7d, Let-7g, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-21, mir-23a, mir-23b, mir-24, mir-25, mir-92, mir-95, mir-133a, mir-133a-2, mir-133b, mir-142, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-191, mir-193, mir-194, mir-196, mir-199a-1, mir-200b, mir-204, mir-206, mir-211, mir-222, mir-223, mir-298, mir-328, mir-342, mir-371, and mir-412; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence selected from the group consisting of: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, miR-7, mir-9, miR-10a, miR-10b, miR-15a, miR-18, miR-19a, miR-17-3p, miR-20, miR-23b, mir-25, miR-26a, miR-26a, mir-30e-5p, mir-31, mir-32, mir-92, mir-93, miR-100, miR-125a, miR-125b, miR-126, mir-127, miR-128, miR-129, mir-130a, mir-135, mir-138, mir-139, miR-140, mir-141, mir-143, mir-145, mir-146, miR-150, mir-154, mir-155, mir-181a, miR-182, mir-186, miR-187, miR-188, mir-190, mir-191, mir-193, mir-194, mir-196, mir-197, mir-198, mir-199, mir-201, mir-204, mir-216, mir-218, miR-223, mir-293, miR-291-3p, miR-294, miR-295, miR-322, mir-333, mir-335, mir-338, mir-341, mir-350, mir-369, miR-373, mir-410, and mir-412.

    70. The method of claim 69, further comprising identifying a cell or a patient having the cell as in need of inducing or increasing cell proliferation.

    71. A method for reducing cell viability comprising introducing into one or more cells an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of: miR-107, miR-133, miR-137, miR-152, miR-155, miR-181a, miR-191, miR-203, and miR-215; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence selected from the group consisting of: let-7a, let-7b, mir-1, mir-7, miR-10b, miR-17-3p, miR-19a, mir-23, mir-24, mir-27a, miR-29a, miR-30a-3p, mir-31, mir-32, miR-34a, miR-101, miR-107, miR-108, miR-122, mir-124, miR-133a, miR-134, miR-135, miR-139, mir-140, miR-141, miR-145, mir-150, mir-192, mir-193, mir-195, mir-206, mir-208, mir-210, mir-210, mir-292-3p, mir-293, mir-297, mir-299, mir-329, mir-337, mir-337, mir-345, mir-346, and mir-409.

    72. The method of claim 71, further comprising identifying a cell or a patient having the cell as in need of reducing cell viability.

    73. A method for increasing cell viability comprising introducing into one or more cells an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of miR-7, miR-19a, miR-23, miR-24, miR-27a, miR-31, miR-32, miR-134, miR-140, miR-150, miR-192, and miR-193; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence selected from the group consisting of: let-7a, let-7b, let-7c, let-7d, let-7g, miR-10a, miR-10b, miR-15a, miR-17-3p, miR-18, miR-19a, miR-20, mir-23a, mir-23b, mir-24, miR-25, miR-26a, mir-32, miR-107, miR-125a, miR-126, mir-128, miR-129, miR-133, miR-137, mir-139, miR-143, miR-152, miR-155, miR-181a, miR-182, miR-191, miR-203, miR-215, and mir-331.

    74. The method of claim 73, further comprising identifying a cell or a patient having the cell as in need of increasing cell viability.

    75. A method for inducing apoptosis in a cell comprising introducing into the cell an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of: miR-31 and miR-214; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence selected from the group consisting of: let-7b, let-7g, mir-1, mir-1d, mir-7, mir-10a, miR-10b, miR-17-3p, miR-19a, miR-28, miR-28, miR-28, miR-29a, miR-32, miR-34a, miR-122, mir-148, mir-149, mir-154, mir-184, mir-186, mir-188, mir-192, mir-195, mir-196, mir-199a, mir-204, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-293, mir-296, mir-299, mir-321, mir-328, and mir-344.

    76. The method of claim 75, further comprising identifying a cell or a patient having the cell as in need of inducing apoptosis.

    77. A method for inhibiting apoptosis in a cell comprising introducing into the cell an effective amount of at least one i) miRNA inhibitor molecule that is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA selected from the group consisting of: miR-7, miR-1d, miR-148, miR-195, miR-196, miR-199a, miR-204, miR-210, miR-211, miR-212, miR-215, miR-216, miR-218, miR-296, and miR-321; or ii) synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence selected from the group consisting of: Let-7b, mir-21, mir-23b, mir-25, miR-26a, mir-28, mir-29a, mir-31, miR-32, mir-30a-3p, mir-34a, mir-96, miR-98, mir-100, mir-101, mir-105, mir-108, miR-125b, miR-126, mir-126, mir-128, mir-137, miR-143, miR-155, mir-207, mir-214, mir-216, mir-223, mir-292-3p, mir-328, mir-335, mir-340, mir-341, mir-367, mir-368, mir-380-3p, and mir-410.

    78. The method of claim 77, further comprising identifying a cell or a patient having the cell as in need of inhibiting apoptosis.

    79. A method for treating cancer in a subject comprising administering to the subject an effective amount of one or more synthetic miRNA molecules and/or miRNA inhibitors corresponding to miR-21, miR-126, miR-143, miR-145, miR-188, miR-200b, miR-219, or miR-331.

    80. The method of claim 79, wherein the cancer is breast cancer and the subject is administered 1) one or more miRNA inhibitors corresponding to miR-21, miR-15a, miR-16, miR-24, and/or miR-25, and/or 2) one or more miRNAs corresponding to miR-99, miR-100, miR-205, miR-197, miR-126, miR-143, miR-145 and/or miR-321.

    81. The method of claim 79, wherein the cancer is colon cancer and the subject is administered 1) one or more miRNA inhibitors corresponding to miR-21, miR-106, miR-189, miR-200b, miR-223, miR-224, miR-31, and/or miR-17; and/or 2) one or more miRNAs corresponding to miR-145, miR-143, miR-133, miR-342, miR-125a, miR-195, miR-30a, miR-10a, miR-130, miR-130a, miR-192, miR-194, miR-215, miR-144, miR-23, miR-26a, miR-126, miR-199a, miR-188, miR-331, and/or miR-21.

    82. The method of claim 79, wherein the cancer is thyroid cancer and the subject is administered 1) one or more miRNA inhibitors corresponding to miR-21 miR-125, miR-24, miR-200b, miR-29b, miR-221, miR-222, miR-224, miR-10a, and/or miR-183; and/or 2) one or more miRNAs corresponding to miR-145, miR-22, miR-331, miR-126, miR-30a, miR-199a, miR-223, and/or miR-321.

    83. The method of claim 79, wherein the cancer is lung cancer and the subject is administered 1) one or more miRNA inhibitors corresponding to miR-223, miR-106, miR-21, miR-200b, miR-321, miR-182, miR-183, miR-17, and/or miR-205; and/or 2) one or more miRNAs corresponding to miR-130a, miR-145, miR-126, miR-331, miR-342, miR-143, Let-7, miR-30a, miR-16, miR-26a, miR-125a, miR-29b, miR-24, miR-328, miR-201, miR-195, miR-22, miR-181a, miR-331, and/or miR-321.

    84. A method for treating cancer in a subject comprising administering to the subject an effective amount of one or more synthetic miRNA molecules and/or miRNA inhibitors corresponding to let-7, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-23, miR-24, miR-26a, miR-29b, miR-30a, miR-106, miR-125a, miR-126, miR-130, miR130a, miR-133, miR-143, miR-144, miR-145, miR-181a, miR-182, miR-183, miR-188, miR-189, miR-219, miR-192, miR-194, miR-195, miR-199a, miR-200b, miR-201, miR-205, miR-215, miR-223, miR-224, miR-321, miR-328, miR-331, or miR-342.

    85. A method of treating cancer in a patient comprising administering to the patient the cancer therapeutic and an effective amount of at least one miRNA molecule that improves the efficacy of the cancer therapeutic or protects non-cancer cells.

    86. The method of claim 85, wherein the miRNA molecule enhances the efficacy of the cancer therapeutic and is selected from the group consisting of ambi-miR-7100, mir-28, mir-101, mir-124, mir-125a, mir-126, mir-132, mir-136, mir-147, mir-155, mir-182, mir-186, mir-202, mir-206, mir-216, mir-221, mir-224, mir-291, mir-292-3p, mir-297, mir-302, mir-337, mir-372, mir-373, and mir-376b.

    87. The method of claim 85, wherein the miRNA molecule protects non-cancer cells from the cancer therapeutic and is selected from the group consisting of mir-16, mir-24, mir-30a-3p, mir-125b, mir-152, mir-194, mir-197, mir-214, and mir-331.

    88. A method for treating lupus in a subject comprising administering to the subject an effective amount of 1) one or more miRNA inhibitors corresponding to miR-21, miR-223, and/or mir-342 expression; and/or 2) one or more miRNAs corresponding to miR-95, miR-105, miR-137, miR-186, miR-188, miR-199, miR-211, miR-215, mu-miR-290, miR-301, and/or miR-331.

    89. A method for treating a prion disease in a subject comprising administering to the subject an effective amount of 1) one or more miRNA inhibitors corresponding miR-7, miR-9-as, miR-16, miR-24, miR-26A, miR-27A, miR-130A, and/or miR-239 expression; and/or 2) one or more miRNAs corresponding to miR-95 and/or miR-135A.

    90. A method for preventing or treating ischemia in a subject comprising administering to the subject an effective amount of 1) one or more miRNA inhibitors corresponding to miR-28, miR-30A, miR-31, miR-138, miR-139, miR-140, miR-291-5P and/or miR-298 expression; and/or 2) one or more miRNAs corresponding to Let7F-2 and/or miR-16.

    91. A method for inducing transformation in a cell comprising administering to the cell an effective amount of at least one miRNA selected from the group consisting of mir-192, mir-198, and mir-199.

    92. A method for activating ERK in cells comprising providing or introducing into the cells an effective amount of one or more nucleic acids capable of being processed into a mature miRNA when it is inside the cell, wherein the mature miRNA is let-7, miR-19a, miR-25, miR-96, miR-125a, miR-134, miR-148, miR-152, miR-206, miR-207, miR-210, miR-212, miR-216, miR-217, miR-218, miR-223, mu-miR-294, mu-miR-295, miR-301, miR-328, mu-miR-329, miR-339, miR-370, or miR-372.

    93. A method for activating hTert in a cell comprising introducing into the cell an effective amount of one or more nucleic acids capable of being processed into a mature miRNA inside the cell, wherein the mature miRNA is miR-15a, miR-16, miR-21, mir-24, miR-26a, miR-92, miR-105, miR-125a, miR-125b, miR-128, mir-147, miR-195, miR-207, miR-224, mu-miR-295, mir-301, miR-337, mir-368, or mir-371.

    94. A method for identifying an miRNA that inhibits an hTert activating gene product comprising: a) introducing into a cell a candidate miRNA into a cell; b) assaying the level of hTert expression or hTert activity in the cell, wherein a reduction in hTert expression or activity compared to a cell lacking the miRNA identifies the miRNA as a potential inhibitor of an hTert activating gene product.

    95. The method of claim 94, wherein the sequence of the candidate miRNA was previously evaluated for an ability to inhibit an hTert activating gene product.

    96. The method of calim 87.7, wherein the hTert activating gene product is selected from the group consisting of ACOX1, AKT1, APAF1, COX-5B, COX6, COX7B, CPOX, DUOX2, GPX1, GPX2, GPX4, LPO, MAPK1, MAPK4, MTCO1, NOX3, NOX5, PAOX, PPDX, PRKCA, PRKCD, and TNFRSF6.

    97. A method for inhibiting hTert in a cell comprising providing to the cell an effective amount of an miRNA selected from the group consisting of miR-26a, miR-147, mir-195, and mir-368.

    98. A method for inhibiting stimulation of Stat3 in a cell comprising providing to the cell an effective amount of an miRNA selected from the group consisting of mir-93, mir-100, mir-134, mir-99a, mir-103, mir-128, mir-129, mir-181b, mir-193, mir-197, mir-212, mir-218, mir-219, mir-302, mir-323, mir-324-3p, mir-325, mir-330, mir-331, mir-340, mmu-mir-350, mir-425, mir-491, mir-518f, and mir-520a*.

    99. A kit for evaluating miRNA molecules comprising, in suitable containers, at least five RNA molecules of claim 1.

    100. A kit for evaluating miRNA molecules comprising, in suitable containers, at least five miRNA inhibitor molecules, wherein each miRNA inhibitor molecule is between 17 and 25 nucleotides in length and comprises a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA.

    101. A kit comprising, in suitable containers: a) at least one synthetic miRNA molecule of between 17 and 125 residues in length comprising an miRNA region whose sequence from 5 to 3 is identical to a mature miRNA sequence, and a complementary region whose sequence from 5 to 3 is between 60% and 100% complementary to the miRNA sequence; and b) at least one miRNA inhibitor between 17 and 25 nucleotides in length and comprising a 5 to 3 sequence that is at least 90% complementary to the 5 to 3 sequence of a mature miRNA.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0119] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

    [0120] FIG. 1 Overview of miRNA Expression and Activation. MiRNAs are transcribed as part of longer RNA molecules that can be as long as a thousand nucleotides (Lee, 2002). The RNAs are processed in the nucleus into hairpin RNAs of 70-100 nucleotides by the dsRNA-specific ribonuclease Drosha (Lee 2003) (FIG. 1). The hairpin RNAs are transported to the cytoplasm and digested by a second, double-strand specific ribonuclease called Dicer. The resulting 19-23mer miRNA is bound by a complex that is similar to or identical to the RNA-Induced Silencing Complex (RISC) that participates in RNA interference (Hutvagner, 2002). The complex-bound, single-stranded miRNA binds mRNAs with sequences that are significantly, though not completely, complementary to the miRNA. By a mechanism that is not fully understood, but that does not involve mRNA degradation, the bound mRNA is not translated, resulting in reduced expression of the corresponding gene.

    [0121] FIG. 2. Methods for Introducing miRNAs into Cells. There are three basic methods for introducing miRNAs into cells. In the first, a DNA bearing a promoter upstream of a sequence encoding a miRNAs is introduced into cells where it is transcribed to produce an RNA molecule that includes the mature miRNA. Processing and uptake by the protein complex for miRNA-induced gene regulation results in the activation of the miRNA. This method suffers from inefficient introduction of the DNA construct into cells. In the second method, an siRNA-like dsRNA molecule, one of whose strands is identical to an active miRNA is introduced into cells where it is taken up by the protein complex for miRNA activation. This method provides efficient deliver, but often uptake of the unintended complementary RNA molecule. The third method, described herein, involves modifying the complementary strand so as to favor uptake and activation of the active strand of the synthetic miRNA construct.

    [0122] FIG. 3. Preferential Uptake of Active Strands in synthetic miRNAs of the invention. Reporter vectors with luciferase under the control of target sites for miR-33 or let-7 or the complementary strands of the afore-mentioned siRNAs. Co-transfection of synthetic miRNAs and reporter vectors followed by luciferase assay 24 hours post-transfection revealed miRNAs that are activated following transfection.

    [0123] FIG. 4. Synthetic miRNA Activity for various miRNAs. Synthetic miRNAs with siRNA and Pre-miR (5amine) design were prepared and transfected into HeLa cells at 3 and 10 nM final concentration. The synthetic miRNAs were co-transfected with reporter vectors bearing target sites for the mature miRNAs. The expression of the luciferase reporter in co-transfected cells was measured twenty-four hours post-transfected and expressed in the figure as the reporter expression relative to cells co-transfeted with negative control synthetic miRNAs.

    [0124] FIG. 5. Synthetic miRNA Activity across Cell Types and Against Natural Targets. Synthetic miRNAs were tested for proper strand activation and cell-type specificity to ensure that the design is robust. Four different cell types were co-transfected with synthetic miRNA and associated active and complementary strand strand activation. Panel A shows that different cell types respond similarly to synthetic miRNAs. Four different synthetic miRNAs were then transfected into various cell types and the expression levels of natural targets of the miRNAs were measured (Panel B).

    [0125] FIG. 6. Schematic for screening with libraries of synthetic miRNAs or miRNA inhibitors. Synthetic miRNAs and/or miRNA inhibitors are distributed to wells of a microtiter plate. Transfection reagent and then cells are added to each well. At some time post-transfection, samples are evaluated for a phenotype. MiRNAs that induce a change that is significant relative to a negative control are selected for further study.

    [0126] FIG. 7. Screen for miRNAs that affect cell proliferation. In 96-well plates, 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection, cells were fixed with 4% paraformaldehyde, permiabilized with 0.1% TritonX 100 and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP labtech Acumen Explorer. Morphology changes in cells inhibited for mir 31. HeLa cells were transfected with Anti-mir31 and cells were fixed and stained with anti-beta actin antibody and DAPI to visualize cell morphology changes in response to inhibition to mir-31 micro-RNA function.

    [0127] FIG. 8. Screen for miRNAs that affect cell proliferation in A549 cells. Screen for miRNA involved in cell viability in A549 cells. In 96-well plates, 8,000 A549 cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were trypsinized and counted using the Guava cell counting instrument. Cell number was graphed and normalized to a gap inhibitor. In this figure, mir1d refers to mir-1-2.

    [0128] FIG. 9. Screen for miRNAs that affect apoptosis in HeLa cells. Effects of miRNA inhibitors on caspase activity in HeLa. In 96-well plates, 8,000 HeLa cells were reverse transfected with miRNA inhibitors (5 pmoles) in triplicates using Ambion siPORT Neo-FX. 72 hours post-transfection cells were analyzed using caspase activity assay and normalized based on esterase activity assay. In this figure, mir1d refers to mir-1-2.

    [0129] FIG. 10. miRNA Expression in Lung and Colon Cancer Patients. The miRNA expression profiles of tumor vs normal adjacent tissues were compared for lung and colon cancer patients. The miRNAs are provided in rows; the patients are presented in columns. Green in the heat map shows miRNAs that are down-regulated in the tumor sample relative to the normal adjacent tissue sample, and red shows miRNAs that are up-regulated in the tumor sample relative to the normal adjacent tissue sample.

    [0130] FIG. 11. Validation of miRNA Array Expression Results in Lung Cancer Patients. Total RNA samples from two lung cancer patients were analyzed for expression of miR-16, miR-21, miR-143, miR-145, and let-7 using Northern analysis. The graphs show the relative abundance of each miRNA (ratio of tumor:NAT) from the array analysis and Northern phosphoimager analysis.

    [0131] FIG. 12. Some miRNAs are differentially expressed in multiple cancer types. miRNA array analysis comparing tumor and normal adjacent tissues from patients with various types of cancer was used to identify miRNAs that are differentially expressed in cancer. The percentage of patients exhibiting up- or down-regulation of a given miRNA was calculated for each cancer type. The eight that were most often differentially expressed across sample types are presented.

    [0132] FIG. 13. Shown are miRNAs having greater than 1.5-fold expression changes between both infected vs. uninfected and sensitive vs. insensitive. On the right is a cluster of the results from 2 arrays of each model.

    [0133] FIG. 14. Differentially expressed miRNAs in 3 preconditioned mice relative to non-treated mice.

    [0134] FIG. 15A-C. Synthetic miRNAs that decrease cell proliferation. A. BT549 and MCF12A (breast), HeLa (cervical) and 22 Rv1 (prostate) cells were evaluated for cell proliferation. B. TE354T and TE353SK (skin), BJ (skin), and A549 (lung) cells were examined for cell proliferation. C. CRL5826 and HTB-57 (lung), Jurkats (T cell), and primary T cells were evaluated for cell proliferation.

    [0135] FIG. 16. Synthetic miRNAs that increase cell proliferation. HeLa (cervical), 22 Rv1 (prostate), TE354T and TE353SK (skin), BJ (skin), A549 (lung), Jurkats (T cell), primary T cells, CRL5826 and HTB-57 (lung) cells were evaluated for cell proliferation.

    [0136] FIG. 17. miRNA inhibitors that reduce cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.

    [0137] FIG. 18. miRNA inhibitors that increase cell proliferation. 22 Rv1 (prostate), TE354T (skin), MCF12a (breast), and A549 (lung) cells were evaluated for cell proliferation.

    [0138] FIG. 19. miRNAs that affect cell viability. Jurkats (T cell), primary T cells, HeLa (cervical) and A549 (lung) cells were evaluated for increases and decreases in cell viability.

    [0139] FIG. 20. miRNAs that affect apoptosis. 22 Rv1 (prostate), TE354T (skin), Jurkats (T cell), and HeLa (cervical) cells were evaluated for increases and decreases in apoptosis.

    [0140] FIG. 21. miRNAs that affect cell viability in the presence of a therapeutic. A549 (lung) cells were evaluated for increases and decreases in cell viability in the presence and absence of TRAIL or etoposide. HTB-57 and CRL5826 (lung) and HeLa (cervical) cells were evaluated for a reduction in cell viability in the absence and presence of etoposide.

    [0141] FIG. 22. miRNAs that affect cell cycle. BJ (skin) and HeLa (cervical) cells were evaluated for increases or decreases in the number of cells at certain phases of the cell cycle (G1, S, G2/M, DNA replication).

    [0142] FIG. 23. Phenotypes of miRNAs with similar sequences. Comparison of related let-7 sequences and their effects on A549 and Jurkat cell proliferation. The sequences correspond to positions 6-27 of SED ID NO:3 (let-7a-1), 6-27 of SEQ ID NO:6 (let-7b), 11-32 of SEQ ID NO:7 (let-7c), 8-28 of SEQ ID NO:8 (let-7d), and 5-25 of SEQ ID NO:15 (let-7g).

    [0143] FIG. 24. Genes associated with hTert regulation and miRNA sequences predicted to modulate their expression. FIG. 23 exemplifies 4 miRNAs (miR-26a, miR-147, miR-195, and miR-368) and the thTert activating gene products with which they interact.

    DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

    [0144] The present invention is directed to compositions and methods relating to preparation and characterization of miRNAs, as well as use of miRNAs for therapeutic, prognostic, and diagnostic applications. To overcome the problem with previous inefficient plasmid-based systems for introducing miRNA into cells, the inventors developed small, partially double-stranded RNAs that can be delivered with high efficiency to both immortalized and primary cells. The small RNAs have the same functional activities as endogenously expressed miRNAs. Because the small RNAs can be delivered to cells with much higher efficiency than can plasmids, they induce a much stronger phenotype that is easier to detect and quantify, making it possible to identify many of the functions of miRNAs in cells.

    [0145] The inventors have also created a library of the small, double-stranded RNA molecules that can be used to introduce miRNAs into cells, as well as a library of antisense molecules that inhibit the activities of known miRNAs that are present in cells. These libraries have been used to sequentially up- or down-regulate one or more miRNAs in cells to identify those miRNAs that are critical for cellular processes like cell cycle, apoptosis, differentiation, viability, angiogenesis, metabolism, and other processes with therapeutic potential. miRNAs that regulate the expression of important genes like p53, MYC, and RAS are also being identified and characterized to further pinpoint miRNAs that might provide important intervention points for treating disease. For example, let-7 has been shown to be involved with RAS. See Johnson et al., 2005, which is hereby incorporated by reference. These processes of serially modulating miRNA activities and assaying for cellular phenotypes are collectively referred to as miRNA functional screening.

    I. miRNA Molecules

    [0146] MicroRNA molecules (miRNAs) are generally 21 to 22 nucleotides in length, though lengths of 17 and up to 25 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule (precursor miRNA). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved by an enzyme called Dicer in animals. Dicer is ribonuclease III-like nuclease. The processed miRNA is typically a portion of the stem.

    [0147] The processed miRNA (also referred to as mature miRNA) become part of a large complex to down-regulate a particular target gene. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al., 1999; Seggerson et al., 2002). SiRNA molecules also are processed by Dicer, but from a long, double-stranded RNA molecule. SiRNAs are not naturally found in animal cells, but they can function in such cells in a RNA-induced silencing complex (RISC) to direct the sequence-specific cleavage of an mRNA target (Denli et al., 2003).

    [0148] The study of endogenous miRNA molecules is described in U.S. Patent Application 60/575,743, which is hereby incorporated by reference in its entirety.

    Synthetic miRNAs

    [0149] miRNAs are apparently active in the cell when the mature, single-stranded RNA is bound by a protein complex that regulates the translation of mRNAs that hybridize to the miRNA. Introducing exogenous RNA molecules that affect cells in the same way as endogenously expressed miRNAs requires that a single-stranded RNA molecule of the same sequence as the endogenous mature miRNA be taken up by the protein complex that facilitates translational control. A variety of RNA molecule designs have been evaluated. Three general designs that maximize uptake of the desired single-stranded miRNA by the miRNA pathway have been identified. An RNA molecule with an miRNA sequence having at least one of the three designs is referred to as a synthetic miRNA.

    [0150] Synthetic miRNAs of the invention comprise, in some embodiments, two RNA molecules wherein one RNA is identical to a naturally occurring, mature miRNA. The RNA molecule that is identical to a mature miRNA is referred to as the active strand. The second RNA molecule, referred to as the complementary strand, is at least partially complementary to the active strand. The active and complementary strands are hybridized to create a double-stranded RNA, called the synthetic miRNA, that is similar to the naturally occurring miRNA precursor that is bound by the protein complex immediately prior to miRNA activation in the cell. Maximizing activity of the synthetic miRNA requires maximizing uptake of the active strand and minimizing uptake of the complementary strand by the miRNA protein complex that regulates gene expression at the level of translation. The molecular designs that provide optimal miRNA activity involve modifications to the complementary strand.

    [0151] Two designs incorporate chemical modifications in the complementary strand. The first modification involves creating a complementary RNA with a chemical group other than a phosphate or hydroxyl at its 5 terminus. The presence of the 5 modification apparently eliminates uptake of the complementary strand and subsequently favors uptake of the active strand by the miRNA protein complex. The 5 modification can be any of a variety of molecules including NH.sub.2, NHCOCH.sub.3, biotin, and others.

    [0152] The second chemical modification strategy that significantly reduces uptake of the complementary strand by the miRNA pathway is incorporating nucleotides with sugar modifications in the first 2-6 nucleotides of the complementary strand. It should be noted that the sugar modifications consistent with the second design strategy can be coupled with 5 terminal modifications consistent with the first design strategy to further enhance synthetic miRNA activities.

    [0153] The third synthetic miRNA design involves incorporating nucleotides in the 3 end of the complementary strand that are not complementary to the active strand. Hybrids of the resulting active and complementary RNAs are very stable at the 3 end of the active strand but relatively unstable at the 5 end of the active strand. Studies with siRNAs indicate that 5 hybrid stability is a key indicator of RNA uptake by the protein complex that supports RNA interference, which is at least related to the miRNA pathwy in cells. The inventors have found that the judicious use of mismatches in the complementary RNA strand significantly enhances the activity of the synthetic miRNA.

    MiRNA Libraries

    [0154] A key application for the synthetic miRNAs is the identification of cellular functions for individual or groups of miRNAs. The inventors have created a library of synthetic miRNAs that can be used to sequentially introduce each of the known miRNAs into cultured cells (FIG. 6). Cell populations with each of the different synthetic miRNAs can then be assayed to identify miRNAs whose presence induces a cellular phenotype.

    [0155] The inventors have created a library of antisense molecules that inhibit miRNA activity. The miRNA inhibitors are used to serially inhibit the activities of miRNAs in cells to identify miRNAs whose absence induces a cellular phenotype.

    [0156] The number of different synthetic miRNAs or miRNA inhibitors in the libraries is variable. It is contemplated that there may be, be at least, or be at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 31, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 6000, 7000, 8000, 9000, 10000 or more, or any range derivable therein, different miRNA-specific molecules in the library. In specific embodiments, libraries have between 5 and 1000 different miRNA-specific molecules, between 20 and 500 different miRNA-specific molecules, between 50 and 250 different miRNA-specific molecules, or between 100 and 225 different miRNA-specific molecules. Different miRNA-specific molecules refers to nucleic acids that are specific to miRNAs with different sequences.

    [0157] Synthetic miRNAs are contemplated to be made primarily of RNA, though in some embodiments, they may be RNA, nucleotide analogs, DNA, or any combination of DNA, RNA, nucleotide analogs, and PNAs.

    [0158] As suggested above, it is contemplated that libraries of the invention may be specific for one or more miRNAs. In embodiments of the invention, a library has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 31, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 6000, 7000, 8000, 9000, 10000 or more, or any range derivable therein, different miRNAs or miRNA inhibitors. Accordingly, it is understood that the library contains one or more nucleic acids for these different miRNAs. In specific embodiments, the library is specific to human miRNAs, though libraries for multiple organisms are contemplated.

    [0159] RNA molecules of the invention have miRNA regions or complementary regions. In specific embodiments, a synthetic miRNA or miRNA inhibitor has a sequence or complementary sequence that derives from any of SEQ ID NOs: 1-805, inclusive. It is particularly contemplated that synthetic nucleic acid molecules of the invention may be derived from any of the mature miRNA sequences in SEQ ID NOs: 1-805 or their complement.

    [0160] As discussed above, miRNAs are processed from a precursor molecule. In certain embodiments, the specific length of a mature miRNA is unknown. It is contemplated that versions of the synthetic miRNA and miRNA inhibitor libraries will include sequence that extends at least 1 to 5 nucleotides of coding sequence upstream and/or downstream of the predicted miRNA sequence. In some embodiments, molecules have up to 1, 2, 3, 4, 5, 6, 7, or more contiguous nucleotides, or any range derivable therein, that flank the sequence encoding the predominant processed miRNA on one or both sides (5 and/or 3 end).

    [0161] The present invention concerns methods for creating functional profile for all of the known miRNAs. The term functional profile refers to a set of data regarding the cellular phenotypes that result from introducing and inhibiting miRNAs in cells using synthetic miRNA and miRNA inihibitor libraries. Functional profiles for individual miRNAs will enable identification of miRNAs with therapeutic or diagnostic potential. For instance, a functional profile for a miRNA might reveal that its absence leads to uncontrolled cell proliferation and an inability to induce apoptosis following DNA damage. Furthermore, the expression of p53 correlates with whether the miRNA is being up-regulated with a synthetic miRNA or down-regulated with a miRNA inhibitor. Based on its ties to cell proliferation, apoptosis, and p53 expression, this miRNA might be a target for cancer therapeutics.

    [0162] In certain embodiments, methods concern identifying miRNAs indicative of a disease or condition by detecting a correlation between the activity of particular miRNAs and cellular phenotypes that coincide with a disease or condition.

    [0163] Libraries of the invention can contain miRNA sequences from any organism having miRNAs, specifically including but not limited to, mammals such as humans, mice, and rats. Specifically contemplated are libraries having, having at least, or having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, 10000 or more different synthetic miRNAs and/or miRNA inhibitors (that is, miRNA-specific molecules having different sequences derived from different miRNA genes). Specifically contemplated are such libraries described in the previous sentence with respect to any of SEQ ID NOs: 1-805, particularly those corresponding to miRNA sequence s(mature sequence) or the complement thereof.

    [0164] A. Nucleic Acids

    [0165] The present invention concerns nucleic acid molecules that can introduce or inhibit miRNAs in cultured cells. The nucleic acids may have been produced in cells or in vitro by purified enzymes though they are preferentially produced by chemical synthesis. They may be crude or purified. The term miRNA, unless otherwise indicated, refers to the processed RNA, after it has been cleaved from its precursor. Table 1 indicates which SEQ ID NO corresponds to the particular precursor sequence of an miRNA and what sequences within the SEQ ID NO correspond to the mature sequence. The name of the miRNA is often abbreviated and referred to without the prefix and will be understood as such, depending on the context. Unless otherwise indicated, miRNAs referred to in the application are human sequences identified as mir-X or let-X, where X is a number and/or letter.

    TABLE-US-00001 TABLE 1 Human miRNA Sequences Processed Sequence miRNA name Precursor Relative to Precursor hsa-mir-1-2 SEQ ID NO: 1 53-73 hsa-mir-1-1 SEQ ID NO: 2 46-66 hsa-let-7a-1 SEQ ID NO: 3 6-27 hsa-let-7a-2 SEQ ID NO: 4 5-26 hsa-let-7a-3 SEQ ID NO: 5 4-25 hsa-let-7b SEQ ID NO: 6 6-27 hsa-let-7c SEQ ID NO: 7 11-32 hsa-let-7d SEQ ID NO: 8 8-28 hsa-let-7e SEQ ID NO: 9 8-28 hsa-let-7f-1 SEQ ID NO: 10 7-28 hsa-let-7f-2 SEQ ID NO: 11 8-29 hsa-mir-7-1 SEQ ID NO: 12 24-44 hsa-mir-7-2 SEQ ID NO: 13 32-52 hsa-mir-7-3 SEQ ID NO: 14 31-51 hsa-let-7g SEQ ID NO: 15 5-25 hsa-let-7i SEQ ID NO: 16 6-24 hsa-mir-9-1 SEQ ID NO: 17 16-38 and/or 56-76 hsa-mir-9-2 SEQ ID NO: 18 16-38 and/or 54-74 hsa-mir-9-3 SEQ ID NO: 19 16-38 and/or 56-76 hsa-mir-10a SEQ ID NO: 20 22-44 hsa-mir-10b SEQ ID NO: 21 27-48 hsa-mir-15a SEQ ID NO: 22 14-35 hsa-mir-15b SEQ ID NO: 23 20-41 hsa-mir-16-1 SEQ ID NO: 24 14-35 hsa-mir-16-2 SEQ ID NO: 25 10-31 hsa-mir-17 SEQ ID NO: 26 14-37 and/or 51-70 hsa-mir-18 SEQ ID NO: 27 6-27 hsa-mir-19a SEQ ID NO: 28 49-71 hsa-mir-19b-1 SEQ ID NO: 29 54-76 hsa-mir-19b-2 SEQ ID NO: 30 62-84 hsa-mir-20 SEQ ID NO: 31 8-29 hsa-mir-21 SEQ ID NO: 32 8-29 hsa-mir-22 SEQ ID NO: 33 53-74 hsa-mir-23a SEQ ID NO: 34 45-65 hsa-mir-23b SEQ ID NO: 35 58-80 hsa-mir-24-1 SEQ ID NO: 36 6-28 and/or 44-65 hsa-mir-24-2 SEQ ID NO: 37 50-71 hsa-mir-25 SEQ ID NO: 38 52-73 hsa-mir-26a-1 SEQ ID NO: 39 10-31 hsa-mir-26b SEQ ID NO: 40 12-32 hsa-mir-26a-2 SEQ ID NO: 41 14-35 hsa-mir-27a SEQ ID NO: 42 51-72 hsa-mir-27b SEQ ID NO: 43 61-80 hsa-mir-28 SEQ ID NO: 44 14-35 hsa-mir-29a SEQ ID NO: 45 41-62 hsa-mir-29b-1 SEQ ID NO: 46 51-70 hsa-mir-29b-2 SEQ ID NO: 47 52-71 hsa-mir-29c SEQ ID NO: 48 54-75 hsa-mir-30a SEQ ID NO: 49 47-68 hsa-mir-30c-2 SEQ ID NO: 50 7-29 hsa-mir-30d SEQ ID NO: 51 6-27 hsa-mir-30b SEQ ID NO: 52 17-37 hsa-mir-30c-1 SEQ ID NO: 53 17-39 hsa-mir-30e SEQ ID NO: 54 2-21 hsa-mir-31 SEQ ID NO: 55 9-29 hsa-mir-32 SEQ ID NO: 56 6-26 hsa-mir-33 SEQ ID NO: 57 6-24 hsa-mir-34a SEQ ID NO: 58 22-43 hsa-mir-34b SEQ ID NO: 59 14-35 hsa-mir-34c SEQ ID NO: 60 13-34 hsa-mir-92-1 SEQ ID NO: 61 48-69 hsa-mir-92-2 SEQ ID NO: 62 48-69 hsa-mir-93 SEQ ID NO: 63 12-33 hsa-mir-95 SEQ ID NO: 64 49-70 hsa-mir-96 SEQ ID NO: 65 9-30 hsa-mir-98 SEQ ID NO: 66 2-23 hsa-mir-99a SEQ ID NO: 67 13-34 hsa-mir-99b SEQ ID NO: 68 7-28 hsa-mir-100 SEQ ID NO: 69 13-34 hsa-mir-101-1 SEQ ID NO: 70 47-68 hsa-mir-101-2 SEQ ID NO: 71 49-70 hsa-mir-103-2 SEQ ID NO: 72 48-70 hsa-mir-103-1 SEQ ID NO: 73 48-70 hsa-mir-105-1 SEQ ID NO: 74 13-32 hsa-mir-105-2 SEQ ID NO: 75 13-32 hsa-mir-106a SEQ ID NO: 76 13-36 hsa-mir-106b SEQ ID NO: 77 12-32 hsa-mir-107 SEQ ID NO: 78 50-72 hsa-mir-122a SEQ ID NO: 79 15-37 hsa-mir-124a-1 SEQ ID NO: 80 52-73 hsa-mir-124a-2 SEQ ID NO: 81 61-82 hsa-mir-124a-3 SEQ ID NO: 82 52-73 hsa-mir-125b-1 SEQ ID NO: 83 15-36 hsa-mir-125a SEQ ID NO: 84 15-37 hsa-mir-125b-2 SEQ ID NO: 85 17-38 hsa-mir-126 SEQ ID NO: 86 15-35 and/or 52-72 hsa-mir-127 SEQ ID NO: 87 57-78 hsa-mir-128a SEQ ID NO: 88 50-71 hsa-mir-128b SEQ ID NO: 89 52-73 hsa-mir-129-2 SEQ ID NO: 90 15-35 hsa-mir-130a SEQ ID NO: 91 55-74 hsa-mir-130b SEQ ID NO: 92 51-72 hsa-mir-132 SEQ ID NO: 93 59-80 hsa-mir-133a-1 SEQ ID NO: 94 54-75 hsa-mir-133a-2 SEQ ID NO: 95 60-81 hsa-mir-133b SEQ ID NO: 96 67-87 hsa-mir-134 SEQ ID NO: 97 8-28 hsa-mir-135a-1 SEQ ID NO: 98 17-39 hsa-mir-135a-2 SEQ ID NO: 99 23-45 hsa-mir-135b SEQ ID NO: 100 16-37 hsa-mir-136 SEQ ID NO: 101 15-37 hsa-mir-137 SEQ ID NO: 102 60-81 hsa-mir-138-2 SEQ ID NO: 103 10-26 hsa-mir-138-1 SEQ ID NO: 104 23-39 hsa-mir-139 SEQ ID NO: 105 7-24 hsa-mir-140 SEQ ID NO: 106 24-44 hsa-mir-141 SEQ ID NO: 107 60-80 hsa-mir-142 SEQ ID NO: 108 16-35 and/or 52-74 hsa-mir-143 SEQ ID NO: 109 61-82 hsa-mir-144 SEQ ID NO: 110 52-73 hsa-mir-145 SEQ ID NO: 111 16-39 hsa-mir-146 SEQ ID NO: 112 21-42 hsa-mir-147 SEQ ID NO: 113 47-66 hsa-mir-148a SEQ ID NO: 114 44-65 hsa-mir-148b SEQ ID NO: 115 63-84 hsa-mir-149 SEQ ID NO: 116 15-36 hsa-mir-150 SEQ ID NO: 117 16-37 hsa-mir-151 SEQ ID NO: 118 46-67 hsa-mir-152 SEQ ID NO: 119 54-74 hsa-mir-153-1 SEQ ID NO: 120 54-73 hsa-mir-153-2 SEQ ID NO: 121 53-72 hsa-mir-154 SEQ ID NO: 122 15-36 hsa-mir-155 SEQ ID NO: 123 4-25 hsa-mir-181a SEQ ID NO: 124 39-61 hsa-mir-181b-1 SEQ ID NO: 125 36-59 hsa-mir-181c SEQ ID NO: 126 27-48 hsa-mir-181b-2 SEQ ID NO: 127 16-39 hsa-mir-182 SEQ ID NO: 128 23-44 and/or 67-87 hsa-mir-183 SEQ ID NO: 129 27-49 hsa-mir-184 SEQ ID NO: 130 53-74 hsa-mir-185 SEQ ID NO: 131 15-32 hsa-mir-186 SEQ ID NO: 132 15-37 hsa-mir-187 SEQ ID NO: 133 71-91 hsa-mir-188 SEQ ID NO: 134 15-36 hsa-mir-190 SEQ ID NO: 135 15-36 hsa-mir-191 SEQ ID NO: 136 16-37 hsa-mir-192 SEQ ID NO: 137 24-44 hsa-mir-193 SEQ ID NO: 138 55-75 hsa-mir-194-1 SEQ ID NO: 139 15-36 hsa-mir-194-2 SEQ ID NO: 140 15-36 hsa-mir-195 SEQ ID NO: 141 15-35 hsa-mir-196-1 SEQ ID NO: 142 7-27 hsa-mir-196-2 SEQ ID NO: 143 25-45 hsa-mir-197 SEQ ID NO: 144 48-69 hsa-mir-198 SEQ ID NO: 145 6-24 hsa-mir-199a-1 SEQ ID NO: 146 6-28 and/or 46-67 hsa-mir-199a-2 SEQ ID NO: 147 31-53 and/or 69-90 hsa-mir-199b SEQ ID NO: 148 26-48 hsa-mir-200b SEQ ID NO: 149 54-77 hsa-mir-200c SEQ ID NO: 150 45-66 hsa-mir-200a SEQ ID NO: 151 54-75 hsa-mir-203 SEQ ID NO: 152 65-86 hsa-mir-204 SEQ ID NO: 153 33-54 hsa-mir-205 SEQ ID NO: 154 34-55 hsa-mir-206 SEQ ID NO: 155 53-74 hsa-mir-208 SEQ ID NO: 156 44-65 hsa-mir-210 SEQ ID NO: 157 66-86 hsa-mir-211 SEQ ID NO: 158 26-47 hsa-mir-212 SEQ ID NO: 159 71-91 hsa-mir-213 SEQ ID NO: 160 24-46 and/or 64-85 hsa-mir-214 SEQ ID NO: 161 71-91 hsa-mir-215 SEQ ID NO: 162 27-47 hsa-mir-216 SEQ ID NO: 163 19-39 hsa-mir-217 SEQ ID NO: 164 35-58 hsa-mir-218-1 SEQ ID NO: 165 25-45 hsa-mir-218-2 SEQ ID NO: 166 25-45 hsa-mir-219-1 SEQ ID NO: 167 21-41 hsa-mir-219-2 SEQ ID NO: 168 19-39 hsa-mir-220 SEQ ID NO: 169 23-43 hsa-mir-221 SEQ ID NO: 170 65-87 hsa-mir-222 SEQ ID NO: 171 69-92 hsa-mir-223 SEQ ID NO: 172 68-88 hsa-mir-224 SEQ ID NO: 173 8-30 hsa-mir-296 SEQ ID NO: 174 14-34 hsa-mir-299 SEQ ID NO: 175 7-28 hsa-mir-301 SEQ ID NO: 176 51-73 hsa-mir-302 SEQ ID NO: 177 44-66 hsa-mir-320 SEQ ID NO: 178 48-70 hsa-mir-321 SEQ ID NO: 179 10-30 hsa-mir-323 SEQ ID NO: 180 50-71 hsa-mir-324 SEQ ID NO: 181 16-38 and/or 51-72 hsa-mir-326 SEQ ID NO: 182 60-79 hsa-mir-328 SEQ ID NO: 183 48-69 hsa-mir-330 SEQ ID NO: 184 57-79 hsa-mir-331 SEQ ID NO: 185 61-81 hsa-mir-335 SEQ ID NO: 186 16-38 hsa-mir-337 SEQ ID NO: 187 56-78 hsa-mir-338 SEQ ID NO: 188 42-64 hsa-mir-339 SEQ ID NO: 189 15-35 hsa-mir-340 SEQ ID NO: 190 58-80 hsa-mir-342 SEQ ID NO: 191 61-84 hsa-mir-345 SEQ ID NO: 573 17-37 hsa-mir-346 SEQ ID NO: 574 4-26 hsa-mir-367 SEQ ID NO: 575 44-65 hsa-mir-368 SEQ ID NO: 576 44-65 hsa-mir-369 SEQ ID NO: 577 44-64 hsa-mir-370 SEQ ID NO: 578 48-68 hsa-mir-371 SEQ ID NO: 579 44-64 hsa-mir-372 SEQ ID NO: 580 42-64 hsa-mir-373 SEQ ID NO: 581 44-66 hsa-mir-374 SEQ ID NO: 582 12-33 hsa-mir-375 SEQ ID NO: 677 40-61 hsa-mir-376a SEQ ID NO: 678 44-64 hsa-mir-377 SEQ ID NO: 679 45-66 hsa-mir-378 SEQ ID NO: 680 5-26 and 44-65 hsa-mir-379 SEQ ID NO: 681 6-24 hsa-mir-380 SEQ ID NO: 682 5-26 and 40-61 hsa-mir-381 SEQ ID NO: 683 49-70 hsa-mir-382 SEQ ID NO: 684 11-32 hsa-mir-383 SEQ ID NO: 685 7-28 hsa-mir-384 SEQ ID NO: 686 57-76 hsa-mir-422a SEQ ID NO: 687 11-32 hsa-mir-423 SEQ ID NO: 688 53-74 hsa-mir-424 SEQ ID NO: 689 11-32 hsa-mir-425 SEQ ID NO: 690 55-75 hsa-mir-448 SEQ ID NO: 691 71-92 hsa-mir-429 SEQ ID NO: 692 51-72 hsa-mir-449 SEQ ID NO: 693 16-37 hsa-mir-450-1 SEQ ID NO: 694 17-38 hsa-mir-450-2 SEQ ID NO: 704 22-43 hsa-mir-451 SEQ ID NO: 705 17-39 hsa-mir-452 SEQ ID NO: 706 17-38 hsa-mir-453 SEQ ID NO: 707 43-64 hsa-mir-455 SEQ ID NO: 708 16-37 hsa-mir-483 SEQ ID NO: 709 48-70 hsa-mir-484 SEQ ID NO: 710 2-23 hsa-mir-485 SEQ ID NO: 711 9-30 hsa-mir-486 SEQ ID NO: 712 4-25 hsa-mir-487 SEQ ID NO: 713 49-70 hsa-mir-488 SEQ ID NO: 714 14-34 hsa-mir-489 SEQ ID NO: 715 51-73 hsa-mir-490 SEQ ID NO: 716 76-97 hsa-mir-491 SEQ ID NO: 717 16-38 hsa-mir-492 SEQ ID NO: 718 30-52 hsa-mir-493 SEQ ID NO: 719 16-37 hsa-mir-494 SEQ ID NO: 720 48-71 hsa-mir-495 SEQ ID NO: 721 50-72 hsa-mir-496 SEQ ID NO: 722 61-77 hsa-mir-497 SEQ ID NO: 723 24-44 hsa-mir-498 SEQ ID NO: 724 34-56 hsa-mir-499 SEQ ID NO: 725 33-55 hsa-mir-500 SEQ ID NO: 726 52-73 hsa-mir-501 SEQ ID NO: 727 14-35 hsa-mir-502 SEQ ID NO: 728 1-21 hsa-mir-503 SEQ ID NO: 729 6-28 hsa-mir-504 SEQ ID NO: 730 13-33 hsa-mir-505 SEQ ID NO: 731 52-73 hsa-mir-506 SEQ ID NO: 732 71-91 hsa-mir-507 SEQ ID NO: 733 56-76 hsa-mir-508 SEQ ID NO: 734 61-83 hsa-mir-509 SEQ ID NO: 735 55-77 hsa-mir-510 SEQ ID NO: 736 10-32 hsa-mir-511-1 SEQ ID NO: 737 16-36 hsa-mir-511-2 SEQ ID NO: 738 16-36 hsa-mir-512-1 SEQ ID NO: 739 14-36 hsa-mir-512-2 SEQ ID NO: 740 20-42 hsa-mir-513-1 SEQ ID NO: 741 37-58 hsa-mir-513-2 SEQ ID NO: 742 36-57 hsa-mir-514-1 SEQ ID NO: 743 39-58 hsa-mir-514-2 SEQ ID NO: 744 39-58 hsa-mir-514-3 SEQ ID NO: 745 39-58 hsa-mir-515-1 SEQ ID NO: 746 14-37 hsa-mir-515-2 SEQ ID NO: 747 14-37 hsa-mir-516-1 SEQ ID NO: 748 61-78 hsa-mir-516-2 SEQ ID NO: 749 61-78 hsa-mir-516-3 SEQ ID NO: 750 15-37 hsa-mir-516-4 SEQ ID NO: 751 15-37 hsa-mir-517a SEQ ID NO: 752 15-36 hsa-mir-517b SEQ ID NO: 753 6-27 hsa-mir-517c SEQ ID NO: 754 20-41 hsa-mir-518a-1 SEQ ID NO: 755 14-34 hsa-mir-518a-2 SEQ ID NO: 756 15-34 hsa-mir-518b SEQ ID NO: 757 51-72 hsa-mir-518c SEQ ID NO: 758 24-46 hsa-mir-518d SEQ ID NO: 759 16-36 hsa-mir-518e SEQ ID NO: 760 54-75 hsa-mir-518f SEQ ID NO: 761 16-38 hsa-mir-519a-1 SEQ ID NO: 762 15-38 hsa-mir-519a-2 SEQ ID NO: 763 54-78 hsa-mir-519b SEQ ID NO: 764 13-36 hsa-mir-519c SEQ ID NO: 765 16-39 hsa-mir-519d SEQ ID NO: 766 54-76 hsa-mir-519e SEQ ID NO: 767 14-35 hsa-mir-520a SEQ ID NO: 768 15-35 hsa-mir-520b SEQ ID NO: 769 41-61 hsa-mir-520c SEQ ID NO: 770 16-36 hsa-mir-520d SEQ ID NO: 771 15-37 hsa-mir-520e SEQ ID NO: 772 54-74 hsa-mir-520f SEQ ID NO: 773 55-76 hsa-mir-520g SEQ ID NO: 774 55-78 hsa-mir-520h SEQ ID NO: 775 55-76 hsa-mir-521-1 SEQ ID NO: 776 54-75 hsa-mir-521-2 SEQ ID NO: 777 54-75 hsa-mir-522 SEQ ID NO: 778 16-39 hsa-mir-523 SEQ ID NO: 779 16-39 hsa-mir-524 SEQ ID NO: 780 16-37 hsa-mir-525 SEQ ID NO: 781 15-35 hsa-mir-526a-1 SEQ ID NO: 782 15-35 hsa-mir-526a-2 SEQ ID NO: 783 7-27 hsa-mir-526b SEQ ID NO: 784 14-37 hsa-mir-527 SEQ ID NO: 785 14-34 ambi-mir-7100 SEQ ID NO: 803 mir-526b* SEQ ID NO: 804 mir-520a* SEQ ID NO: 805

    TABLE-US-00002 TABLE 2 Mouse miRNA Sequences Processed Sequence miRNA name Precursor Relative to Precursor mmu-mir-1-1 SEQ ID NO: 192 49-69 mmu-mir-1-2 SEQ ID NO: 193 47-67 mmu-let-7g SEQ ID NO: 194 7-27 mmu-let-7i SEQ ID NO: 195 6-24 mmu-let-7d SEQ ID NO: 196 16-36 + 70-91 mmu-let-7a-1 SEQ ID NO: 197 13-34 mmu-let-7a-2 SEQ ID NO: 198 17-38 mmu-let-7b SEQ ID NO: 199 7-28 mmu-let-7c-1 SEQ ID NO: 200 16-37 mmu-let-7c-2 SEQ ID NO: 201 14-35 mmu-let-7e SEQ ID NO: 202 15-35 mmu-let-7f-1 SEQ ID NO: 203 8-29 mmu-let-7f-2 SEQ ID NO: 204 8-29 mmu-mir-7-1 SEQ ID NO: 205 24-44 mmu-mir-7-2 SEQ ID NO: 206 19-39 mmu-mir-7b SEQ ID NO: 207 30-50 mmu-mir-9-2 SEQ ID NO: 208 8-30 and/or 46-66 mmu-mir-9-1 SEQ ID NO: 209 16-38 and/or 56-76 mmu-mir-9-3 SEQ ID NO: 210 16-38 and/or 56-76 mmu-mir-10b SEQ ID NO: 211 7-28 mmu-mir-10a-1 SEQ ID NO: 212 22-44 mmu-mir-10a-2 SEQ ID NO: 213 22-44 mmu-mir-15b SEQ ID NO: 214 4-25 mmu-mir-15a SEQ ID NO: 215 15-36 mmu-mir-16-1 SEQ ID NO: 216 16-37 mmu-mir-16-2 SEQ ID NO: 217 17-38 mmu-mir-17 SEQ ID NO: 218 14-37 and/or 51-70 mmu-mir-18 SEQ ID NO: 219 17-38 mmu-mir-19b-2 SEQ ID NO: 220 54-76 mmu-mir-19a SEQ ID NO: 221 49-71 mmu-mir-19b-1 SEQ ID NO: 222 54-76 mmu-mir-20 SEQ ID NO: 223 27-49 mmu-mir-21 SEQ ID NO: 224 18-39 mmu-mir-22 SEQ ID NO: 225 57-78 mmu-mir-23b SEQ ID NO: 226 46-68 mmu-mir-23a SEQ ID NO: 227 46-66 mmu-mir-24-1 SEQ ID NO: 228 6-28 and/or 44-65 mmu-mir-24-2 SEQ ID NO: 229 61-82 mmu-mir-25 SEQ ID NO: 230 52-73 mmu-mir-26a-1 SEQ ID NO: 231 16-37 mmu-mir-26b SEQ ID NO: 232 15-36 mmu-mir-26a-2 SEQ ID NO: 233 14-35 mmu-mir-27b SEQ ID NO: 234 49-68 mmu-mir-27a SEQ ID NO: 235 56-76 mmu-mir-28 SEQ ID NO: 236 14-35 mmu-mir-29b-1 SEQ ID NO: 237 47-68 mmu-mir-29a SEQ ID NO: 238 53-74 mmu-mir-29c SEQ ID NO: 239 54-75 mmu-mir-29b-2 SEQ ID NO: 240 52-73 mmu-mir-30a SEQ ID NO: 241 47-68 mmu-mir-30b SEQ ID NO: 242 2-22 mmu-mir-30e SEQ ID NO: 243 2-21 mmu-mir-30c-1 SEQ ID NO: 244 17-39 mmu-mir-30c-2 SEQ ID NO: 245 14-36 mmu-mir-30d SEQ ID NO: 246 12-33 mmu-mir-31 SEQ ID NO: 247 28-49 mmu-mir-32 SEQ ID NO: 248 6-26 mmu-mir-33 SEQ ID NO: 249 6-24 mmu-mir-34c SEQ ID NO: 250 13-35 mmu-mir-34b SEQ ID NO: 251 13-35 mmu-mir-34a SEQ ID NO: 252 20-42 mmu-mir-92-2 SEQ ID NO: 253 55-75 mmu-mir-92-1 SEQ ID NO: 254 50-70 mmu-mir-93 SEQ ID NO: 255 15-37 mmu-mir-96 SEQ ID NO: 256 24-46 mmu-mir-98 SEQ ID NO: 257 2-23 mmu-mir-99a SEQ ID NO: 258 6-25 mmu-mir-99b SEQ ID NO: 259 7-28 mmu-mir-100 SEQ ID NO: 260 13-34 mmu-mir-101 SEQ ID NO: 261 38-57 mmu-mir-101b SEQ ID NO: 262 61-82 mmu-mir-103-1 SEQ ID NO: 263 52-74 mmu-mir-103-2 SEQ ID NO: 264 52-74 mmu-mir-106a SEQ ID NO: 265 5-26 mmu-mir-106b SEQ ID NO: 266 12-32 mmu-mir-107 SEQ ID NO: 267 52-74 mmu-mir-122a SEQ ID NO: 268 6-28 mmu-mir-124a-3 SEQ ID NO: 269 43-64 mmu-mir-124a-1 SEQ ID NO: 270 52-73 mmu-mir-124a-2 SEQ ID NO: 271 61-82 mmu-mir-125a SEQ ID NO: 272 6-28 mmu-mir-125b-2 SEQ ID NO: 273 7-28 mmu-mir-125b-1 SEQ ID NO: 274 15-36 mmu-mir-126 SEQ ID NO: 275 9-29 and/or 46-66 mmu-mir-127 SEQ ID NO: 276 43-64 mmu-mir-128a SEQ ID NO: 277 44-65 mmu-mir-128b SEQ ID NO: 278 48-69 mmu-mir-129-1 SEQ ID NO: 279 6-27 mmu-mir-129-2 SEQ ID NO: 280 15-36 mmu-mir-130a SEQ ID NO: 281 42-61 mmu-mir-130b SEQ ID NO: 282 51-72 mmu-mir-132 SEQ ID NO: 283 42-63 mmu-mir-133a-1 SEQ ID NO: 284 44-65 mmu-mir-133a-2 SEQ ID NO: 285 60-81 mmu-mir-133b SEQ ID NO: 286 67-87 mmu-mir-134 SEQ ID NO: 287 7-27 mmu-mir-135a-1 SEQ ID NO: 288 17-39 mmu-mir-135b SEQ ID NO: 289 16-37 mmu-mir-135a-2 SEQ ID NO: 290 23-45 mmu-mir-136 SEQ ID NO: 291 5-27 mmu-mir-137 SEQ ID NO: 292 46-67 mmu-mir-138-2 SEQ ID NO: 293 2-18 mmu-mir-138-1 SEQ ID NO: 294 23-39 mmu-mir-139 SEQ ID NO: 295 7-24 mmu-mir-140 SEQ ID NO: 296 7-27 mmu-mir-141 SEQ ID NO: 297 49-69 mmu-mir-142 SEQ ID NO: 298 4-23 and/or 40-61 mmu-mir-143 SEQ ID NO: 299 40-61 mmu-mir-144 SEQ ID NO: 300 43-64 mmu-mir-145 SEQ ID NO: 301 7-30 mmu-mir-146 SEQ ID NO: 302 6-27 mmu-mir-148a SEQ ID NO: 303 61-82 mmu-mir-149 SEQ ID NO: 304 4-25 mmu-mir-150 SEQ ID NO: 305 6-27 mmu-mir-151 SEQ ID NO: 306 43-63 mmu-mir-152 SEQ ID NO: 307 47-67 mmu-mir-153 SEQ ID NO: 308 44-63 mmu-mir-154 SEQ ID NO: 309 6-27 mmu-mir-155 SEQ ID NO: 310 4-25 mmu-mir-181a SEQ ID NO: 311 7-29 mmu-mir-181b-1 SEQ ID NO: 312 12-35 mmu-mir-181c SEQ ID NO: 313 17-38 mmu-mir-181b-2 SEQ ID NO: 314 16-39 mmu-mir-182 SEQ ID NO: 315 7-28 mmu-mir-183 SEQ ID NO: 316 6-28 mmu-mir-184 SEQ ID NO: 317 45-66 mmu-mir-185 SEQ ID NO: 318 7-24 mmu-mir-186 SEQ ID NO: 319 7-29 mmu-mir-187 SEQ ID NO: 320 40-61 mmu-mir-188 SEQ ID NO: 321 6-27 mmu-mir-190 SEQ ID NO: 322 6-27 mmu-mir-191 SEQ ID NO: 323 7-28 mmu-mir-192 SEQ ID NO: 324 14-31 mmu-mir-193 SEQ ID NO: 325 41-61 mmu-mir-194-1 SEQ ID NO: 326 7-28 mmu-mir-194-2 SEQ ID NO: 327 16-37 mmu-mir-195 SEQ ID NO: 328 1-21 mmu-mir-196-1 SEQ ID NO: 329 24-44 mmu-mir-196-2 SEQ ID NO: 330 16-36 mmu-mir-199a-1 SEQ ID NO: 331 6-28 and/or 45-66 mmu-mir-199a-2 SEQ ID NO: 332 31-53 and/or 69-90 mmu-mir-199b SEQ ID NO: 333 26-48 mmu-mir-200b SEQ ID NO: 334 45-67 mmu-mir-200a SEQ ID NO: 335 54-75 mmu-mir-200c SEQ ID NO: 336 46-67 mmu-mir-201 SEQ ID NO: 337 6-26 mmu-mir-202 SEQ ID NO: 338 45-66 mmu-mir-203 SEQ ID NO: 339 49-69 mmu-mir-204 SEQ ID NO: 340 6-28 mmu-mir-205 SEQ ID NO: 341 7-28 mmu-mir-206 SEQ ID NO: 342 46-67 mmu-mir-207 SEQ ID NO: 343 52-74 mmu-mir-208 SEQ ID NO: 344 50-71 mmu-mir-210 SEQ ID NO: 345 66-86 mmu-mir-211 SEQ ID NO: 346 26-47 mmu-mir-212 SEQ ID NO: 347 56-76 mmu-mir-213 SEQ ID NO: 348 14-36 and/or 54-75 mmu-mir-214 SEQ ID NO: 349 71-91 mmu-mir-215 SEQ ID NO: 350 30-50 mmu-mir-216 SEQ ID NO: 351 7-27 mmu-mir-217 SEQ ID NO: 352 34-57 mmu-mir-218-2 SEQ ID NO: 353 25-45 mmu-mir-219-1 SEQ ID NO: 354 21-41 mmu-mir-219-2 SEQ ID NO: 355 19-39 mmu-mir-221 SEQ ID NO: 356 60-81 mmu-mir-222 SEQ ID NO: 357 49-71 mmu-mir-223 SEQ ID NO: 358 68-88 mmu-mir-224 SEQ ID NO: 359 8-30 mu-miR-290 SEQ ID NO: 360 15-37 mmu-mir-291 SEQ ID NO: 361 14-35 and/or 50-72 mmu-mir-292 SEQ ID NO: 362 12-33 and/or 51-73 mmu-mir-293 SEQ ID NO: 363 48-69 mmu-mir-294 SEQ ID NO: 364 51-72 mmu-mir-295 SEQ ID NO: 365 43-65 mmu-mir-296 SEQ ID NO: 366 13-33 mmu-mir-297-1 SEQ ID NO: 367 15-35 mmu-mir-297-2 SEQ ID NO: 368 36-56 mmu-mir-298 SEQ ID NO: 369 11-32 mmu-mir-299 SEQ ID NO: 370 7-28 mmu-mir-300 SEQ ID NO: 371 51-72 mmu-mir-301 SEQ ID NO: 372 51-73 mmu-mir-302 SEQ ID NO: 373 44-66 mmu-mir-320 SEQ ID NO: 374 48-70 mmu-mir-321 SEQ ID NO: 375 10-30 mmu-mir-323 SEQ ID NO: 376 50-71 mmu-mir-324 SEQ ID NO: 377 18-40 and/or 53-74 mmu-mir-325 SEQ ID NO: 378 16-38 mmu-mir-326 SEQ ID NO: 379 60-80 mmu-mir-328 SEQ ID NO: 380 61-82 mmu-mir-329 SEQ ID NO: 381 61-82 mmu-mir-330 SEQ ID NO: 382 61-83 mmu-mir-331 SEQ ID NO: 383 61-81 mmu-mir-337 SEQ ID NO: 384 61-83 mmu-mir-338 SEQ ID NO: 385 61-83 mmu-mir-339 SEQ ID NO: 386 16-36 mmu-mir-340 SEQ ID NO: 387 61-83 mmu-mir-341 SEQ ID NO: 388 61-81 mmu-mir-342 SEQ ID NO: 389 61-84 mmu-mir-344 SEQ ID NO: 390 61-83 mmu-mir-345 SEQ ID NO: 391 16-36 mmu-mir-346 SEQ ID NO: 392 16-38 mmu-mir-350 SEQ ID NO: 393 61-84 mmu-mir-351 SEQ ID NO: 583 16-39 mmu-mir-370 SEQ ID NO: 584 48-70 mmu-mir-376a SEQ ID NO: 585 44-64 mmu-mir-376b SEQ ID NO: 586 51-72 mmu-mir-380 SEQ ID NO: 587 40-61 mmu-mir-409 SEQ ID NO: 588 47-69 mmu-mir-410 SEQ ID NO: 589 50-71 mmu-mir-411 SEQ ID NO: 590 56-78 mmu-mir-412 SEQ ID NO: 591 50-72 mmu-mir-425 SEQ ID NO: 695 54-74 mmu-mir-429 SEQ ID NO: 696 51-72 mmu-mir-448 SEQ ID NO: 697 72-93 mmu-mir-449 SEQ ID NO: 698 16-37 mmu-mir-450 SEQ ID NO: 699 17-38 mmu-mir-451 SEQ ID NO: 786 17-38 mmu-mir-452 SEQ ID NO: 787 17-38 mmu-mir-463 SEQ ID NO: 788 4-24 mmu-mir-464 SEQ ID NO: 789 47-69 mmu-mir-465 SEQ ID NO: 790 5-27 mmu-mir-466 SEQ ID NO: 791 51-73 mmu-mir-467 SEQ ID NO: 792 50-71 mmu-mir-468 SEQ ID NO: 793 53-75 mmu-mir-469 SEQ ID NO: 794 6-31 mmu-mir-470 SEQ ID NO: 795 9-29 mmu-mir-471 SEQ ID NO: 796 7-29 mmu-mir-483 SEQ ID NO: 797 45-67 mmu-mir-484 SEQ ID NO: 798 2-23 mmu-mir-485 SEQ ID NO: 799 9-30 mmu-mir-486 SEQ ID NO: 800 4-25

    TABLE-US-00003 TABLE 3 Rat miRNA Sequences Processed Sequence miRNA name Precursor Relative to Precursor rno-let-7d SEQ ID NO: 394 14-34 and/or 68-89 rno-mir-7-1 SEQ ID NO: 395 19-39 and/or 61-82 rno-let-7a-1 SEQ ID NO: 396 13-34 rno-let-7a-2 SEQ ID NO: 397 17-38 rno-let-7b SEQ ID NO: 398 7-28 rno-let-7c-1 SEQ ID NO: 399 16-37 rno-let-7c-2 SEQ ID NO: 400 14-35 rno-let-7e SEQ ID NO: 401 15-35 rno-let-7f-1 SEQ ID NO: 402 8-29 rno-let-7f-2 SEQ ID NO: 403 8-29 rno-let-7i SEQ ID NO: 404 6-24 rno-mir-7-2 SEQ ID NO: 405 19-39 rno-mir-7b SEQ ID NO: 406 29-49 rno-mir-9-1 SEQ ID NO: 407 16-38 rno-mir-9-3 SEQ ID NO: 408 16-38 rno-mir-9-2 SEQ ID NO: 409 16-38 rno-mir-10a SEQ ID NO: 410 22-44 rno-mir-10b SEQ ID NO: 411 26-47 rno-mir-15b SEQ ID NO: 412 20-41 rno-mir-16 SEQ ID NO: 413 17-38 rno-mir-17 SEQ ID NO: 414 14-37 rno-mir-18 SEQ ID NO: 415 17-38 rno-mir-19b-1 SEQ ID NO: 416 54-76 rno-mir-19b-2 SEQ ID NO: 417 62-84 rno-mir-19a SEQ ID NO: 418 49-71 rno-mir-20 SEQ ID NO: 419 16-38 and/or 52-72 rno-mir-21 SEQ ID NO: 420 18-39 rno-mir-22 SEQ ID NO: 421 57-78 rno-mir-23a SEQ ID NO: 422 46-66 rno-mir-23b SEQ ID NO: 423 58-80 rno-mir-24-1 SEQ ID NO: 424 44-65 rno-mir-24-2 SEQ ID NO: 425 61-82 rno-mir-25 SEQ ID NO: 426 52-73 rno-mir-26a SEQ ID NO: 427 16-37 rno-mir-26b SEQ ID NO: 428 15-36 rno-mir-27b SEQ ID NO: 429 61-80 rno-mir-27a SEQ ID NO: 430 56-76 rno-mir-28 SEQ ID NO: 431 14-35 rno-mir-29b-2 SEQ ID NO: 432 52-73 rno-mir-29a SEQ ID NO: 433 53-74 rno-mir-29b-1 SEQ ID NO: 434 51-72 rno-mir-29c SEQ ID NO: 435 54-75 rno-mir-30c-1 SEQ ID NO: 436 17-39 rno-mir-30e SEQ ID NO: 437 2-21 rno-mir-30b SEQ ID NO: 438 16-36 rno-mir-30d SEQ ID NO: 439 12-33 rno-mir-30a SEQ ID NO: 440 47-68 rno-mir-30c-2 SEQ ID NO: 441 14-36 rno-mir-31 SEQ ID NO: 442 28-49 rno-mir-32 SEQ ID NO: 443 6-26 rno-mir-33 SEQ ID NO: 444 6-24 rno-mir-34b SEQ ID NO: 445 13-35 rno-mir-34c SEQ ID NO: 446 13-35 rno-mir-34a SEQ ID NO: 447 20-42 rno-mir-92-1 SEQ ID NO: 448 48-68 rno-mir-92-2 SEQ ID NO: 449 55-75 rno-mir-93 SEQ ID NO: 450 15-37 rno-mir-96 SEQ ID NO: 451 24-46 rno-mir-98 SEQ ID NO: 452 2-23 rno-mir-99a SEQ ID NO: 453 13-34 rno-mir-99b SEQ ID NO: 454 7-28 rno-mir-100 SEQ ID NO: 455 13-34 rno-mir-101b SEQ ID NO: 456 61-82 rno-mir-101 SEQ ID NO: 457 47-68 rno-mir-103-2 SEQ ID NO: 458 52-74 rno-mir-103-1 SEQ ID NO: 459 52-74 rno-mir-106b SEQ ID NO: 460 12-32 rno-mir-107 SEQ ID NO: 461 52-74 rno-mir-122a SEQ ID NO: 462 15-37 rno-mir-124a-3 SEQ ID NO: 463 52-73 rno-mir-124a-1 SEQ ID NO: 464 52-73 rno-mir-124a-2 SEQ ID NO: 465 61-82 rno-mir-125a SEQ ID NO: 466 15-37 rno-mir-125b-1 SEQ ID NO: 467 15-36 rno-mir-125b-2 SEQ ID NO: 468 17-38 rno-mir-126 SEQ ID NO: 469 9-29 and/or 46-66 rno-mir-127 SEQ ID NO: 470 57-78 rno-mir-128a SEQ ID NO: 471 50-71 rno-mir-128b SEQ ID NO: 472 52-73 rno-mir-129-2 SEQ ID NO: 473 19-40 and/or 61-82 rno-mir-129-1 SEQ ID NO: 474 6-27 rno-mir-130a SEQ ID NO: 475 55-74 rno-mir-130b SEQ ID NO: 476 51-72 rno-mir-132 SEQ ID NO: 477 59-80 rno-mir-133a SEQ ID NO: 478 53-74 rno-mir-134 SEQ ID NO: 479 8-28 rno-mir-135b SEQ ID NO: 480 16-37 rno-mir-135a SEQ ID NO: 481 23-45 rno-mir-136 SEQ ID NO: 482 15-37 rno-mir-137 SEQ ID NO: 483 60-81 rno-mir-138-2 SEQ ID NO: 484 9-25 rno-mir-138-1 SEQ ID NO: 485 23-39 rno-mir-139 SEQ ID NO: 486 7-24 rno-mir-140 SEQ ID NO: 487 23-43 and/or 61-84 rno-mir-141 SEQ ID NO: 488 59-79 rno-mir-142 SEQ ID NO: 489 16-35 and/or 52-74 rno-mir-143 SEQ ID NO: 490 60-81 rno-mir-144 SEQ ID NO: 491 50-71 rno-mir-145 SEQ ID NO: 492 16-39 rno-mir-146 SEQ ID NO: 493 17-38 rno-mir-148b SEQ ID NO: 494 61-82 rno-mir-150 SEQ ID NO: 495 16-37 rno-mir-151 SEQ ID NO: 496 16-37 and/or 50-71 rno-mir-152 SEQ ID NO: 497 53-73 rno-mir-153 SEQ ID NO: 498 53-72 rno-mir-154 SEQ ID NO: 499 15-36 rno-mir-181c SEQ ID NO: 500 24-45 rno-mir-181a SEQ ID NO: 501 39-61 rno-mir-181b-1 SEQ ID NO: 502 36-59 rno-mir-181b-2 SEQ ID NO: 503 15-38 rno-mir-183 SEQ ID NO: 504 27-49 rno-mir-184 SEQ ID NO: 505 47-68 rno-mir-185 SEQ ID NO: 506 14-31 rno-mir-186 SEQ ID NO: 507 15-37 rno-mir-187 SEQ ID NO: 508 66-86 rno-mir-190 SEQ ID NO: 509 15-36 rno-mir-191 SEQ ID NO: 510 15-36 rno-mir-192 SEQ ID NO: 511 24-44 rno-mir-193 SEQ ID NO: 512 54-74 rno-mir-194-1 SEQ ID NO: 513 15-36 rno-mir-194-2 SEQ ID NO: 514 15-36 rno-mir-195 SEQ ID NO: 515 15-35 rno-mir-196 SEQ ID NO: 516 25-45 rno-mir-199a SEQ ID NO: 517 31-53 rno-mir-200c SEQ ID NO: 518 46-67 rno-mir-200a SEQ ID NO: 519 54-75 rno-mir-200b SEQ ID NO: 520 54-77 rno-mir-203 SEQ ID NO: 521 52-73 rno-mir-204 SEQ ID NO: 522 33-54 rno-mir-205 SEQ ID NO: 523 33-54 rno-mir-206 SEQ ID NO: 524 51-72 rno-mir-208 SEQ ID NO: 525 50-71 rno-mir-210 SEQ ID NO: 526 66-86 rno-mir-211 SEQ ID NO: 527 26-47 rno-mir-212 SEQ ID NO: 528 72-92 rno-mir-213 SEQ ID NO: 529 55-76 rno-mir-214 SEQ ID NO: 530 71-91 rno-mir-216 SEQ ID NO: 531 19-39 rno-mir-217 SEQ ID NO: 532 32-55 rno-mir-218-2 SEQ ID NO: 533 25-45 rno-mir-218-1 SEQ ID NO: 534 25-45 rno-mir-219-1 SEQ ID NO: 535 21-41 rno-mir-219-2 SEQ ID NO: 536 19-39 rno-mir-221 SEQ ID NO: 537 65-87 rno-mir-222 SEQ ID NO: 538 62-85 rno-mir-223 SEQ ID NO: 539 68-88 rno-mir-290 SEQ ID NO: 540 14-36 rno-mir-291 SEQ ID NO: 541 14-35 and/or 50-72 rno-mir-292 SEQ ID NO: 542 12-33 and/or 51-73 rno-mir-296 SEQ ID NO: 543 13-33 rno-mir-297 SEQ ID NO: 544 26-48 rno-mir-298 SEQ ID NO: 545 11-32 rno-mir-299 SEQ ID NO: 546 7-28 rno-mir-300 SEQ ID NO: 547 51-72 rno-mir-301 SEQ ID NO: 548 61-85 rno-mir-320 SEQ ID NO: 549 48-70 rno-mir-321 SEQ ID NO: 550 10-30 rno-mir-322 SEQ ID NO: 551 61-80 rno-mir-323 SEQ ID NO: 552 50-71 rno-mir-324 SEQ ID NO: 553 16-38 and/or 51-72 rno-mir-325 SEQ ID NO: 554 16-38 rno-mir-326 SEQ ID NO: 555 60-80 rno-mir-328 SEQ ID NO: 556 48-69 rno-mir-329 SEQ ID NO: 557 61-82 rno-mir-330 SEQ ID NO: 558 60-82 rno-mir-331 SEQ ID NO: 559 61-81 rno-mir-333 SEQ ID NO: 560 16-35 rno-mir-336 SEQ ID NO: 561 16-36 rno-mir-337 SEQ ID NO: 562 60-82 rno-mir-338 SEQ ID NO: 563 41-63 rno-mir-339 SEQ ID NO: 564 16-36 rno-mir-341 SEQ ID NO: 565 61-81 rno-mir-342 SEQ ID NO: 566 61-84 rno-mir-344 SEQ ID NO: 567 61-83 rno-mir-345 SEQ ID NO: 568 16-36 rno-mir-346 SEQ ID NO: 569 16-38 rno-mir-349 SEQ ID NO: 570 61-82 rno-mir-350 SEQ ID NO: 571 61-84 rno-mir-351 SEQ ID NO: 572 16-39 rno-mir-352 SEQ ID NO: 592 61-81 rno-mir-421 SEQ ID NO: 593 10-30 rno-mir-429 SEQ ID NO: 700 53-74 rno-mir-448 SEQ ID NO: 701 72-93 rno-mir-449 SEQ ID NO: 702 16-37 rno-mir-450 SEQ ID NO: 703 17-38 rno-mir-451 SEQ ID NO: 801 17-38 rno-mir-483 SEQ ID NO: 802 45-67

    [0166] It is understood that an miRNA is derived from genomic sequences or a gene. In this respect, the term gene is used for simplicity to refer to the genomic sequence encoding the precursor miRNA for a given miRNA. However, embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.

    [0167] The term recombinant may be used and this generally refers to a molecule that has been manipulated in vitro or that is the replicated or expressed product of such a molecule.

    [0168] The term nucleic acid is well known in the art. A nucleic acid as used herein will generally refer to a molecule (one or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine A, a guanine G, a thymine T or a cytosine C) or RNA (e.g., an A, a G, an uracil U or a C). The term nucleic acid encompass the terms oligonucleotide and polynucleotide, each as a subgenus of the term nucleic acid.

    [0169] The term miRNA generally refers to a single-stranded molecule, but in specific embodiments, molecules implemented in the invention will also encompass a region or an additional strand that is partially (between 10 and 50% complementary across length of strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, nucleic acids may encompass a molecule that comprises one or more complementary or self-complementary strand(s) or complement(s) of a particular sequence comprising a molecule. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary.

    [0170] As used herein, hybridization, hybridizes or capable of hybridizing is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term anneal as used herein is synonymous with hybridize. The term hybridization, hybridize(s) or capable of hybridizing encompasses the terms stringent condition(s) or high stringency and the terms low stringency or low stringency condition(s).

    [0171] ion will comprise, in some embodiments the miRNA sequence of any miRNA described in SEQ ID NOs: 1-805, and/or any sequence with the complement thereof. It is contemplated that nucleic acids sequences of the invention can have, have at least, or have at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 contiguous nucleotides from SEQ ID NOs: 1-805 (or any ranger derivable therein), or be a complement thereof. In other embodiments, nucleic acids are, are at least, or are at most 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identical or complementary to the miRNA sequence of SEQ ID NOs: 1-805 or to the entire sequence of any of SEQ ID NOs: 1-805, or any combination or range derivable therein.

    [0172] Moreover, sequences are provided in the appendix. The appendix provides a list of 1) miRNAs that were screened, any one of which can be screened for using any array or method of the present invention; 2) the names of the probe used to screen for that miRNA; and, 3) the sequence of the named probe. It is clear that a particular probe can be used for identifying the level of expression of one or more target miRNAs, or set of target miRNAs (sets of targeted miRNAs may include completely unrelated RNAs, inadditions to sets that are either related or in the same gene family). It is contemplated that any of these sequences in the appendix can be used in embodiments of the invention.

    [0173] 1. Nucleobases

    [0174] As used herein a nucleobase refers to a heterocyclic base, such as for example a naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least one naturally occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally occurring derivative(s) and analogs of such a nucleobase. A nucleobase generally can form one or more hydrogen bonds (anneal or hybridize) with at least one naturally occurring nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g., the hydrogen bonding between A and T, G and C, and A and U).

    [0175] Purine and/or pyrimidine nucleobase(s) encompass naturally occurring purine and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof, including but not limited to, those a purine or pyrimidine substituted by one or more of an alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or alkylthiol moeity. Preferred alkyl (e.g., alkyl, caboxyalkyl, etc.) moieties comprise of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil, a 5-chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, a N,N-diemethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6-hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like. Other examples are well known to those of skill in the art.

    [0176] A nucleobase may be comprised in a nucleoside or nucleotide, using any chemical or natural synthesis method described herein or known to one of ordinary skill in the art. Such nucleobase may be labeled or it may be part of a molecule that is labeled and contains the nucleobase.

    [0177] 2. Nucleosides

    [0178] As used herein, a nucleoside refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a nucleobase linker moiety is a sugar comprising 5-carbon atoms (i.e., a 5-carbon sugar), including but not limited to a deoxyribose, a ribose, an arabinose, or a derivative or an analog of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-carbon sugar include a 2-fluoro-2-deoxyribose or a carbocyclic sugar where a carbon is substituted for an oxygen atom in the sugar ring.

    [0179] Different types of covalent attachment(s) of a nucleobase to a nucleobase linker moiety are known in the art. By way of non-limiting example, a nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently attaches the 9 position of a purine or a 7-deazapurine to the 1-position of a 5-carbon sugar. In another non-limiting example, a nucleoside comprising a pyrimidine nucleobase (i.e., C, T or U) typically covalently attaches a 1 position of a pyrimidine to a 1-position of a 5-carbon sugar (Kornberg and Baker, 1992).

    [0180] 3. Nucleotides

    [0181] As used herein, a nucleotide refers to a nucleoside further comprising a backbone moiety. A backbone moiety generally covalently attaches a nucleotide to another molecule comprising a nucleotide, or to another nucleotide to form a nucleic acid. The backbone moiety in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3- or 5-position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.

    [0182] 4. Nucleic Acid Analogs

    [0183] A nucleic acid may comprise, or be composed entirely of, a derivative or analog of a nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs may also be labeled according to methods of the invention. As used herein a derivative refers to a chemically modified or altered form of a naturally occurring molecule, while the terms mimic or analog refer to a molecule that may or may not structurally resemble a naturally occurring molecule or moiety, but possesses similar functions. As used herein, a moiety generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art, and have been described (see for example, Scheit, 1980, incorporated herein by reference).

    [0184] Additional non-limiting examples of nucleosides, nucleotides or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or analogs, include those in: U.S. Pat. No. 5,681,947, which describes oligonucleotides comprising purine derivatives that form triple helixes with and/or prevent expression of dsDNA; U.S. Pat. Nos. 5,652,099 and 5,763,167, which describe nucleic acids incorporating fluorescent analogs of nucleosides found in DNA or RNA, particularly for use as fluorescent nucleic acids probes; U.S. Pat. No. 5,614,617, which describes oligonucleotide analogs with substitutions on pyrimidine rings that possess enhanced nuclease stability; U.S. Pat. Nos. 5,670,663, 5,872,232 and 5,859,221, which describe oligonucleotide analogs with modified 5-carbon sugars (i.e., modified 2-deoxyfuranosyl moieties) used in nucleic acid detection; U.S. Pat. No. 5,446,137, which describes oligonucleotides comprising at least one 5-carbon sugar moiety substituted at the 4 position with a substituent other than hydrogen that can be used in hybridization assays; U.S. Pat. No. 5,886,165, which describes oligonucleotides with both deoxyribonucleotides with 3-5 internucleotide linkages and ribonucleotides with 2-5 internucleotide linkages; U.S. Pat. No. 5,714,606, which describes a modified internucleotide linkage wherein a 3-position oxygen of the internucleotide linkage is replaced by a carbon to enhance the nuclease resistance of nucleic acids; U.S. Pat. No. 5,672,697, which describes oligonucleotides containing one or more 5 methylene phosphonate internucleotide linkages that enhance nuclease resistance; U.S. Pat. Nos. 5,466,786 and 5,792,847, which describe the linkage of a substituent moiety which may comprise a drug or label to the 2 carbon of an oligonucleotide to provide enhanced nuclease stability and ability to deliver drugs or detection moieties; U.S. Pat. No. 5,223,618, which describes oligonucleotide analogs with a 2 or 3 carbon backbone linkage attaching the 4 position and 3 position of adjacent 5-carbon sugar moiety to enhanced cellular uptake, resistance to nucleases and hybridization to target RNA; U.S. Pat. No. 5,470,967, which describes oligonucleotides comprising at least one sulfamate or sulfamide internucleotide linkage that are useful as nucleic acid hybridization probe; U.S. Pat. Nos. 5,378,825, 5,777,092, 5,623,070, 5,610,289 and 5,602,240, which describe oligonucleotides with three or four atom linker moiety replacing phosphodiester backbone moiety used for improved nuclease resistance, cellular uptake and regulating RNA expression; U.S. Pat. No. 5,858,988, which describes hydrophobic carrier agent attached to the 2-O position of oligonucleotides to enhanced their membrane permeability and stability; U.S. Pat. No. 5,214,136, which describes oligonucleotides conjugated to anthraquinone at the 5 terminus that possess enhanced hybridization to DNA or RNA; enhanced stability to nucleases; U.S. Pat. No. 5,700,922, which describes PNA-DNA-PNA chimeras wherein the DNA comprises 2-deoxy-erythro-pentofuranosyl nucleotides for enhanced nuclease resistance, binding affinity, and ability to activate RNase H; and U.S. Pat. No. 5,708,154, which describes RNA linked to a DNA to form a DNA-RNA hybrid; U.S. Pat. No. 5,728,525, which describes the labeling of nucleoside analogs with a universal fluorescent label.

    [0185] Additional teachings for nucleoside analogs and nucleic acid analogs are U.S. Pat. No. 5,728,525, which describes nucleoside analogs that are end-labeled; U.S. Pat. Nos. 5,637,683, 6,251,666 (L-nucleotide substitutions), and 5,480,980 (7-deaza-2deoxyguanosine nucleotides and nucleic acid analogs thereof).

    [0186] The use of other analogs is specifically contemplated for use in the context of the present invention. Such analogs may be used in synthetic nucleic acid molecules of the invention, both throughout the molecule or at selected nucleotides. They include, but are not limited to, 1) ribose modifications (such as 2F, 2 NH.sub.2, 2N.sub.3, 4thio, or 2 OCH.sub.3) and 2) phosphate modifications (such as those found in phosphorothioates, methyl phosphonates, and phosphoroborates). Such analogs have been created to confer stability on RNAs by reducing or eliminating their capacity to be cleaved by ribonucleases. When these nucleotide analogs are present in RNAs, they can have profoundly positive effects on the stability of the RNAs in animals. It is contemplated that the use of nucleotide analogs can be used alone or in conjunction with any of the design modifications of a synthetic miRNA for any nucleic acid of the invention.

    [0187] 5. Modified Nucleotides

    [0188] Both synthetic miRNAs and miRNA inhibitors of the invention specifically contemplate the use of nucleotides that are modified to enhance their activities. Such nucleotides include those that are at the 5 or 3 terminus of the RNA as well as those that are internal within the molecule. Modified nucleotides used in the complementary strands of synthetic miRNAs either block the 5OH or phosphate of the RNA or introduce internal sugar modifications that enhance uptake of the active strand of the synthetic miRNA. Modifications for the miRNA inhibitors include internal sugar modifications that enhance hybridization as well as stabilize the molecules in cells and terminal modifications that further stabilize the nucleic acids in cells. Further contemplated are modifications that can be detected by microscopy or other methods to identify cells that contain the synthetic miRNAs or miRNA inhibitors.

    [0189] B. Preparation of Nucleic Acids

    [0190] A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production. Though synthetic miRNAs according to the invention could be produced using recombinant methods, it is preferred to produce synthetic miRNAs by chemical synthesis or enzymatic production. Likewise, miRNA inhibitors are preferentially produced by chemical synthesis or enzymatic production. Non-synthetic miRNAs can be produced by a number of methods, including methods involving recombinant DNA technology.

    [0191] Nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980). Additionally, U.S. Pat. No. 4,704,362, U.S. Pat. No. 5,221,619, and U.S. Pat. No. 5,583,013 each describe various methods of preparing synthetic nucleic acids. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and U.S. Pat. No. 5,705,629, each incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

    [0192] A non-limiting example of an enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897, incorporated herein by reference.

    [0193] Oligonucleotide synthesis is well known to those of skill in the art. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.

    [0194] Basically, chemical synthesis can be achieved by the diester method, the triester method polynucleotides phosphorylase method and by solid-phase chemistry. These methods are discussed in further detail below.

    [0195] Diester Method.

    [0196] The diester method was the first to be developed to a usable state, primarily by Khorana and co-workers. (Khorana, 1979). The basic step is the joining of two suitably protected deoxynucleotides to form a dideoxynucleotide containing a phosphodiester bond. The diester method is well established and has been used to synthesize DNA molecules (Khorana, 1979).

    [0197] Triester Method.

    [0198] The main difference between the diester and triester methods is the presence in the latter of an extra protecting group on the phosphate atoms of the reactants and products (Itakura et al., 1975). The phosphate protecting group is usually a chlorophenyl group, which renders the nucleotides and polynucleotide intermediates soluble in organic solvents. Therefore purification's are done in chloroform solutions. Other improvements in the method include (i) the block coupling of trimers and larger oligomers, (ii) the extensive use of high-performance liquid chromatography for the purification of both intermediate and final products, and (iii) solid-phase synthesis.

    [0199] Polynucleotide Phosphorylase Method.

    [0200] This is an enzymatic method of DNA synthesis that can be used to synthesize many useful oligonucleotides (Gillam et al., 1978; Gillam et al., 1979). Under controlled conditions, polynucleotide phosphorylase adds predominantly a single nucleotide to a short oligonucleotide. Chromatographic purification allows the desired single adduct to be obtained. At least a trimer is required to start the procedure, and this primer must be obtained by some other method. The polynucleotide phosphorylase method works and has the advantage that the procedures involved are familiar to most biochemists.

    [0201] Solid-Phase Methods.

    [0202] Drawing on the technology developed for the solid-phase synthesis of polypeptides, it has been possible to attach the initial nucleotide to solid support material and proceed with the stepwise addition of nucleotides. All mixing and washing steps are simplified, and the procedure becomes amenable to automation. These syntheses are now routinely carried out using automatic nucleic acid synthesizers.

    [0203] Phosphoramidite chemistry (Beaucage and Lyer, 1992) has become by far the most widely used coupling chemistry for the synthesis of oligonucleotides. As is well known to those skilled in the art, phosphoramidite synthesis of oligonucleotides involves activation of nucleoside phosphoramidite monomer precursors by reaction with an activating agent to form activated intermediates, followed by sequential addition of the activated intermediates to the growing oligonucleotide chain (generally anchored at one end to a suitable solid support) to form the oligonucleotide product.

    [0204] Recombinant Methods.

    [0205] Recombinant methods for producing nucleic acids in a cell are well known to those of skill in the art. These include the use of vectors, plasmids, cosmids, and other vehicles for delivery a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large quantities of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell free system so long as the reagents for generating the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby incorporated by reference.

    [0206] In certain embodiments, the present invention concerns nucleic acid molecules that are not synthetic. In some embodiments, the nucleic acid molecule has a chemical structure of a naturally occuring nucleic acid and a sequence of a naturally occuring nucleic acid, such as the exact and entire sequence of a single stranded primary miRNA (see Lee 2002), a single-stranded precursor miRNA, or a single-stranded mature miRNA. In addition to the use of recombinant technology, such non-synthetic nucleic acids may be generated chemically, such as by employing technology used for creating oligonucleotides.

    [0207] C. Design of Synthetic miRNAs

    [0208] Synthetic miRNAs typically comprise two strands, an active strand that is identical in sequence to the mature miRNA that is being studied and a complementary strand that is at least partially complementary to the active strand. The active strand is the biologically relevant molecule and should be preferentially taken up by the complex in cells that modulates translation either through mRNA degradation or translational control. Preferential uptake of the active strand has two profound results: (1) the observed activity of the synthetic miRNA increases dramatically and (2) non-intended effects induced by uptake and activation of the complementary strand are essentially eliminated. According to the invention, several synthetic miRNA designs can be used to ensure the preferential uptake of the active strand.

    [0209] 5 Blocking Agent.

    [0210] The introduction of a stable moiety other than phosphate or hydroxyl at the 5 end of the complementary strand impairs its activity in the miRNA pathway. This ensures that only the active strand of the synthetic miRNA will be used to regulate translation in the cell. 5 modifications include, but are not limited to, NH.sub.2, biotin, an amine group, a lower alkylamine group, an acetyl group, 2O-Me, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality.

    [0211] Other Sense Strand Modifications.

    [0212] The introduction of nucleotide modifications like 2-OMe, NH.sub.2, biotin, an amine group, a lower alkylamine group, an acetyl group, DMTO, fluoroscein, a thiol, or acridine or any other group with this type of functionality in the complementary strand of the synthetic miRNA can eliminate the activity of the complementary strand and enhance uptake of the active strand of the miRNA.

    [0213] Base Mismatches in the Sense Strand.

    [0214] As with siRNAs (Schwarz 2003), the relative stability of the 5 and 3 ends of the active strand of the synthetic miRNA apparently determines the uptake and activation of the active by the miRNA pathway. Destabilizing the 5 end of the active strand of the synthetic miRNA by the strategic placement of base mismatches in the 3 end of the complementary strand of the synthetic miRNA enhances the activity of the active strand and essentially eliminates the activity of the complementary strand.

    [0215] D. Host Cells and Target Cells

    [0216] The cells used to understand miRNA function may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus). The plant may be a monocot, dicot or gynmosperm; the animal may be a vertebrate or invertebrate. Preferred microbes are those used in agriculture or by industry, and those that a pathogenic for plants or animals. Fungi include organisms in both the mold and yeast morphologies. Examples of vertebrates include fish and mammals, including cattle, goat, pig, sheep, hamster, mouse, rate and human; invertebrate animals include nematodes, insects, arachnids, and other arthropods. Preferably, the cell is a vertebrate cell. More preferably, the cell is a mammalian cell.

    [0217] The cells used to understand miRNA function may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell can be a gamete or an embryo; if an embryo, it can be a single cell embryo or a constituent cell or cells from a multicellular embryo. The term embryo thus encompasses fetal tissue. The cell used for miRNA functional analysis may be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as from a cell of an organ or tissue, including fetal tissue, or any other cell present in an organism. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells, of the endocrine or exocrine glands. Alternatively, cells may be qualified as germ cells, nurse cells, epithelial cells, endothelial cells, hormone secreting cells, contractile cells, skeletal muscle cells, cardiac muscle cells, blood cells, or cells from the bone, bone marrow, brain, breast, cervix, colon, gastrointestinal tract, heart, kidney, large intestine, liver, lung, lymph nodes, ovary, pancreas, prostate, small intestine, spine or spinal cord, spleen, stomach, testes, thymus, or uterus.

    [0218] As used herein, the terms cell, cell line, and cell culture may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations formed by cell division. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. A host cell may be transfected or transformed, which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny. As used herein, the terms engineered and recombinant cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence, such as, for example, a small, interfering RNA or a template construct encoding a reporter gene has been introduced. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced nucleic acid.

    [0219] A tissue may comprise a host cell or cells to be transformed or contacted with a nucleic acid delivery composition and/or an additional agent. The tissue may be part or separated from an organism. In certain embodiments, a tissue and its constituent cells may comprise, but is not limited to, blood (e.g., hematopoietic cells (such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34.sup.+ cells CD4.sup.+ cells), lymphocytes and other blood lineage cells), bone marrow, brain, stem cells, blood vessel, liver, lung, bone, breast, cartilage, cervix, colon, cornea, embryonic, endometrium, endothelial, epithelial, esophagus, facia, fibroblast, follicular, ganglion cells, glial cells, goblet cells, kidney, lymph node, muscle, neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin, small intestine, spleen, stomach, testes.

    [0220] In certain embodiments, the host cell or tissue may be comprised in at least one organism. In certain embodiments, the organism may be, human, primate or murine. In other embodiments the organism may be any eukaryote or even a prokayrote (e.g., a eubacteria, an archaea), as would be understood by one of ordinary skill in the art (see, for example, webpage http://phylogeny.arizona.edu/tree/phylogeny.html). One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit their division to form progeny.

    [0221] E. Labels and Tags

    [0222] Synthetic miRNAs and miRNA inhibitors may be labeled with a radioactive, enzymatic, colorimetric, or other label or tag for detection or isolation purposes. Nucleic acids may be labeled with fluorescence in some embodiments of the invention. The fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red.

    [0223] It is contemplated that synthetic miRNAs and miRNA inhibitors may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).

    [0224] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. The reference by Stanley T. Crooke, 2000 has a discussion of such techniques (Chapter 6) which is incorporated by reference. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997, spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques. Alternatively, nucleic acids may be labeled or tagged to allow for their efficient isolation. In other embodiments of the invention, nucleic acids are biotinylated.

    [0225] F. Delivery Methods

    [0226] The present invention involves in some embodiments delivering a nucleic acid into a cell. This may be done as part of a screening method, or it may be related to a therapeutic or diagnostic application.

    [0227] RNA molecules may be encoded by a nucleic acid molecule comprised in a vector. The term vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be exogenous, which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al., 1989 and Ausubel et al., 1996, both incorporated herein by reference. In addition to encoding a modified polypeptide such as modified gelonin, a vector may encode non-modified polypeptide sequences such as a tag or targetting molecule. A targetting molecule is one that directs the desired nucleic acid to a particular organ, tissue, cell, or other location in a subject's body.

    [0228] The term expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described

    [0229] There are a number of ways in which expression vectors may be introduced into cells. In certain embodiments of the invention, the expression vector comprises a virus or engineered vector derived from a viral genome. The ability of certain viruses to enter cells via receptor-mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kb of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).

    [0230] The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells; they can also be used as vectors. Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).

    [0231] Other suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.

    II. Screening with Synthetic miRNA and miRNA Inhibitor Libraries

    [0232] As used in the patent application, screening is a process wherein multiple miRNA-specific reagents are delivered separately into individual cell populations or animals. At one or more designated times after delivery, the cell populations or animals are assayed for one or more phenotypes. Those cells or animals that have a significantly different phenotype than cells or animals in the negative control group are classified as positives. The miRNA that was being manipulated in the sample is defined as a hit. Hits represent targets for additional research and potential therapeutic development.

    [0233] In some embodiments, there is a multi-step process for screening. In certain embodiments, there are four general steps:

    (1) Develop Quantitative Assay to Monitor Cellular Process being Studied.

    [0234] Assays that measure the intensity of a cellular phenotype range from microscopic assays that monitor cell size, cell cycle status, or antibody staining to enzymatic assays that assess the turnover of a specific substrate in a cell lysate to direct measurements of biomolecules or small molecules in lysates, on cells, or in medium.

    [0235] Critical to the success of a screen is creating an assay that truly measures the cellular phenotype and maximizing the signal-to-noise ratio of the assay. Maximizing signal-to-noise involves testing variables like assay time, assay components, cell type, and length of time between transfection and assay. The greater the difference in the assay results between a positive phenotype and a negative control phenotype, the greater the spread will be in the screening results and the better the opportunity will be to identify interesting genes.

    (2) Optimize Transfection Conditions for the Desired Cells.

    [0236] The first step in this process is identifying a transfection reagent and plating conditions that maximize the uptake of synthetic miRNAs or miRNA inhibitors while maintaining high cell viability. We find it useful to test 2-5 different transfection reagents when using cell lines or 5-10 electroporation conditions when using primary or suspension cells. Transfection can be optimized for the reagent or electroporation condition that worked best among the conditions tested. Screening miRNA-specific libraries requires conditions for high-throughput transfection. The inventors have developed and used a rapid process that facilitates the transfection of up to 1,000 wells in less than an hour without the need for robotics (see delivery below).

    (3) Screen

    [0237] Once the assay and transfection process have been developed, a library of synthetic miRNAs or miRNA inhibitors can be introduced sequentially into cells in a 24- or 96-well plate. Triplicate transfections for each reagent provide enough data for reasonable statistical analysis.

    (4) Validate Hits

    [0238] Validating a hit involves showing that the observed phenotype is due to the miRNA being targeted. Hits are typically confirmed by delivering a dilution series of the miRNA inhibitor or synthetic miRNA that registered as a hit into the cell that was originally assayed. It has been the experience of the inventors that true hits show a dose response.

    [0239] A. Synthetic miRNA and miRNA Inhibitor Library Preparation

    [0240] The present invention concerns the preparation and use of synthetic miRNA and miRNA inhibitor libraries to induce changes in the activity of specific miRNAs in cells. Preparation of synthetic miRNAs and miRNA inhibitors typically involves the chemical synthesis of the active and complementary strands of the synthetic miRNA and the single-stranded miRNA inhibitor using any of the methods described in this application. If the active and complementary strands of the synthetic miRNAs are two distinct molecules, then the two strands must be hybridized prior to delivery. Hybridization can be achieved by mixing the two nucleic acids together in roughly equimolar amounts and incubating for a time and at a temperature that is appropriate for hybridization. The addition of salt (e.g., NaCl or NaOAC) enhances hybridization as does the inclusion of a heat denaturation step prior to the incubation used for hybridization.

    [0241] B. Delivery of Synthetic miRNAs and miRNA Inhibitors

    [0242] Libraries of the invention can be used to sequentially up- or down-regulate one or more miRNAs in samples. This requires methods for introducing the synthetic miRNAs and miRNA inhibitors into cell types with associated cell assays. Lipid-based transfection is typically employed to introduce the nucleic acids inito immortalized cells and electroporation for primary cells.

    [0243] Suitable methods for nucleic acid delivery according to the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, RNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of nucleic acids such as by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.

    [0244] A variety of compounds have been attached to the ends of oligonucleotides to facilitate their transport across cell membranes. Short signal peptides found in the HIV TAT, HSV VP22, Drosphila antennapedia, and other proteins have been found to enable the rapid transfer of biomolecules across membranes (reviewed by Schwarze 2000). These signal peptides, referred to as Protein Transduction Domains (PTDs), have been attached to oligonucleotides to facilitate their delivery into cultured cells. Cholesterols have been conjugated to oligonucleotides to improve their uptake into cells in animals (MacKellar 1992). The terminal cholesterol groups apparently interact with receptors or lipids on the surfaces of cells and facilitate the internalization of the modified oligonucleotides. Likewise, poly-1-lysine has been conjugated to oligonucleotides to decrease the net negative charge and improve uptake into cells (Leonetti 1990).

    [0245] A variety of compounds have been developed that complex with nucleic acids, deliver them to surfaces of cells, and facilitate their uptake in and release from endosomes. Among these are: (1) a variety of lipids such as DOTAP (or other cationic lipid), DDAB, DHDEAB, and DOPE and (2) non-lipid-based polymers like polyethylenimine, polyamidoamine, and dendrimers of these and other polymers. In certain of these embodiments a combination of lipids is employed such as DOTAP and cholesterol or a cholesterol derivative (U.S. Pat. No. 6,770,291, which is hereby incorporated by reference). Several of these reagents have been shown to facilitate nucleic acid uptake in animals.

    [0246] The cellular components involved in the miRNA pathway are becoming known. Proteins that stabilize and/or transport miRNAs within cells might enhance the stability and activity of miRNAs because they should protect and guide the bound miRNAs once they are in cells. Mixtures of miRNA-transporter proteins and miRNAs could enhance the efficacy of miRNA-based therapeutics.

    [0247] RNAs are hydrophilic molecules by virtue of their anionic phosphate and sugar backbone. Although the nucleobases are hydrophobic, hydrophilicity dominates owing to the extensive hydrogen bonding resulting from the phosphate and sugar residues. The hydrophilic character and anionic backbone reduces cellular permeation. Conjugation of lipophilic groups like cholesterol (Manoharan, 2002) and lauric and lithocholic acid derivatives with C32 functionality (Lorenz et al., 2004), have been shown to improve cellular uptake. Moreover binding of steroid conjugated oligonucleotides to different lipoproteins in the bloodstream, such as LDL, protect their integrity and govern their biodistribution (Rump et al., 2000). Cholesterol attached to anti-sense molecules (Bijsterbosch et al., 2001) and aptamers (Rusconi et al., 2004) has also been shown to stabilize oligonucleotides by allowing binding to lipoproteins. Cholesterol has been demonstrated to enhance uptake and serum stability of siRNAs in vitro (Lorenz et al., 2004) and in vivo (Soutschek et al., 2004). Additionally, a number of small molecules like SB-435495 (Blackie et al., (2002), Isradipine (Oravcova et al., 1994), amlodipine (Oravcova et al., 1994) and 2,2,4,4,5,5-hexachlorobiphenyl (Borlakoglu et al., 1990) could enhance cellular uptake, and improve nuclease resistance by promoting lipoprotein association.

    [0248] The present methods and kits may be employed for high volume screening. A library of synthetic miRNAs and/or miRNA inhibitors can be created using methods of the invention. This library may then be used in high throughput assays, including microarrays. Specifically contemplated by the present inventors are chip-based nucleic acid technologies such as those described by Ziauddin and Sabatini (2001). Briefly, nucleic acids can be immobilized on solid supports. Cells can then be overlaid on the solid support and take up the nucleic acids at the defined locations. The impact on the cells can then be measured to identify cocktails that are having a desirable effect.

    [0249] C. Labeling and Labeling Techniques

    [0250] In some embodiments, the present invention concerns miRNA that are labeled, such as for screening assays to evaluate the therapeutic or diagnostic relevance of a particular miRNA species. It is contemplated that miRNA may first be isolated (either from a cell in which the miRNA is endogenous to the cell or from a cell in which miRNA is exogenous to the cell) and/or purified prior to labeling. This may achieve a reaction that more efficiently labels the miRNA, as opposed to other RNA in a sample in which the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the label is non-radioactive. Generally, nucleic acids may be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling the added nucleotides (two-step process).

    [0251] Moreover, miRNA may be labeled as is described in U.S. Patent Application Ser. No. 60/649,584, which is hereby incorporated by reference. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be acquired commercially or they can be synthesized by reactions known to those of skill in the art.

    [0252] 1. Nucleotides for Labeling

    [0253] Nucleotides for labelling are not naturally occurring nucleotides, but instead, refer to prepared nucleotides that have a reactive moiety on them. Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine, dichlorotriazine, mono- or dihalogen substituted pyridine, mono- or disubstituted diazine, maleimide, epoxide, aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-(2-pyridyl dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p-nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the other such chemical groups. In some embodiments, the reactive functionality may be bonded directly to a nucleotide, or it may be bonded to the nucleotide through a linking group. The functional moiety and any linker cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon containing linking groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon atoms, where the carbon containing linking groups may or may not include one or more heteroatoms, e.g. S, O, N etc., and may or may not include one or more sites of unsaturation. Of particular interest in many embodiments are alkyl linking groups, typically lower alkyl linking groups of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include one or more sites of unsaturation. The functionalized nucleotides (or primers) used in the above methods of functionalized target generation may be fabricated using known protocols or purchased from commercial vendors, e.g., Sigma, Roche, Ambion, and NEN. Functional groups may be prepared according to ways known to those of skill in the art, including the representative information found in U.S. Pat. Nos. 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and Br. Pat. No. 1,529,202, which are all incorporated by reference.

    [0254] Amine-modified nucleotides are used in several embodiments of the invention. The amine-modified nucleotide is a nucleotide that has a reactive amine group for attachment of the label. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G,A,T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl)-UTP; 8-[(4-amino)butyl]-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N.sup.6-(4-amino)butyl-ATP, N.sup.6-(6-amino)butyl-ATP, N.sup.4-[2,2-oxy-bis-(ethylamine)]-CTP; N.sup.6-(6-Amino)hexyl-ATP; 8-[(6-Amino)hexyl]-amino-ATP; 5-prop argylamino-CTP, 5-prop argylamino-UTP; 5-(3-amino allyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6-amino)butyl]-amino-dATP; N.sup.6-(4-amino)butyl-dATP, N.sup.6-(6-amino)butyl-dATP, N.sup.4-[2,2-oxy-bis-(ethylamine)]-dCTP; N.sup.6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP; 5-propargylamino-dCTP, and 5-propargylamino-dUTP. Such nucleotides can be prepared according to methods known to those of skill in the art. Moreover, a person of ordinary skill in the art could prepare other nucleotide entities with the same amine-modification, such as a 5-(3-aminoallyl)-CTP, GTP, ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3-aminoallyl)-UTP.

    [0255] 2. Labeling Techniques

    [0256] In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide or nucleotides. One or more labeled nucleotides can be added to miRNA molecules. See U.S. Pat. No. 6,723,509, which is hereby incorporated by reference.

    [0257] In other embodiments, an unlabeled nucleotide or nucleotides is catalytically added to an miRNA, and the unlabeled nucleotide is modified with a chemical moiety that enables it to be subsequently labeled. In embodiments of the invention, the chemical moiety is a reactive amine such that the nucleotide is an amine-modified nucleotide.

    [0258] Examples of amine-modified nucleotides are well known to those of skill in the art, many being commercially available such as from Ambion, Sigma, Jena Bioscience, and TriLink.

    [0259] In contrast to labeling of cDNA during its synthesis, the issue for labeling miRNA is how to label the already existing molecule. The present invention concerns the use of an enzyme capable of using a di- or tri-phosphate ribonucleotide or deoxyribonucleotide as a substrate for its addition to an miRNA, a small RNA molecule. Moreover, in specific embodiments, it involves using a modified di- or tri-phosphate ribonucleotide, which is added to the 3 end of an miRNA. The source of the enzyme is not limiting. Examples of sources for the enzymes include yeast, gram-negative bacteria such as E. coli, lactococcus lactis, and sheep pox virus.

    [0260] Enzymes capable of adding such nucleotides include, but are not limited to, poly(A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, ligase is contemplated as NOT being the enzyme used to add the label, and instead, a non-ligase enzyme is employed.

    [0261] Poly(A) polymerase has been cloned from a number of organisms from plants to humans. It has been shown to catalyze the addition of homopolymer tracts to RNA (Martin et al., RNA, 4(2):226-30, 1998).

    [0262] Terminal transferase catalyzes the addition of nucleotides to the 3 terminus of a nucleic acid.

    [0263] Polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.

    [0264] 3. Labels

    [0265] Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, enzymatic, or positron emitting (including radioactive). The label may be detected directly or indirectly. Radioactive labels include .sup.125I, .sup.32P, .sup.33P, and .sup.35S. Examples of enzymatic labels include alkaline phosphatase, luciferase, horseradish peroxidase, and -galactosidase. Labels can also be proteins with luminescent properties, e.g., green fluorescent protein and phicoerythrin.

    [0266] The colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methylcoumarin, aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosins; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red; fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer; and, TOTAB.

    [0267] Specific examples of dyes include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY dyes, such as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2,4,5,7-Tetrabromosulfonefluorescein, and TET.

    [0268] Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODIPY FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.

    [0269] Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl (DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa Fluor 532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.

    [0270] It is contemplated that nucleic acids may be labeled with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) may be employed in methods of the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each incorporated by reference).

    [0271] Alternatively, the label may not be detectable per se, but indirectly detectable or allowing for the isolation or separation of the targeted nucleic acid. For example, the label could be biotin, digoxigenin, polyvalent cations, chelator groups and the other ligands, include ligands for an antibody.

    [0272] 4. Visualization Techniques

    [0273] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. The reference by Stanley T. Crooke, 2000 has a discussion of such techniques (Chapter 6), which is incorporated by reference. Such techniques include, microscopy, arrays, Fluorometry, Light cyclers or other real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers, Geiger counters, MRI, CAT, antibody-based detection methods (Westerns, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997, spectroscopy, capillary gel electrophoresis (Cummins et al., 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance techniques.

    [0274] When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize the dsRNA. Furthermore, a person of ordinary skill in the art is well aware of ways of visualizing, identifying, and characterizing labeled nucleic acids, and accordingly, such protocols may be used as part of the invention. Examples of tools that may be used also include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm (Molecular Dynamics), Array Scanner, FACS (fluorescent activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.

    [0275] C. Array Preparation

    [0276] The present invention can be employed with miRNA arrays, which are ordered macroarrays or microarrays of nucleic acid molecules (probes) that are fully or nearly complementary or identical to a plurality of miRNA molecules or precursor miRNA molecules and that are positioned on a support material in a spatially separated organization. Macroarrays are typically sheets of nitrocellulose or nylon upon which probes have been spotted. Microarrays position the nucleic acid probes more densely such that up to 10,000 nucleic acid molecules can be fit into a region typically 1 to 4 square centimeters. Microarrays can be fabricated by spotting nucleic acid molecules, e.g., genes, oligonucleotides, etc., onto substrates or fabricating oligonucleotide sequences in situ on a substrate. Spotted or fabricated nucleic acid molecules can be applied in a high density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as the solid support, in contrast to the nitrocellulose-based material of filter arrays. By having an ordered array of miRNA-complementing nucleic acid samples, the position of each sample can be tracked and linked to the original sample. A variety of different array devices in which a plurality of distinct nucleic acid probes are stably associated with the surface of a solid support are known to those of skill in the art. Useful substrates for arrays include nylon, glass and silicon Such arrays may vary in a number of different ways, including average probe length, sequence or types of probes, nature of bond between the probe and the array surface, e.g. covalent or non-covalent, and the like.

    [0277] Representative methods and apparatus for preparing a microarray have been described, for example, in U.S. Pat. Nos. 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327; 5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980; 5,510,270; 5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501; 5,556,752; 5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672; 5,610,287; 5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547; 5,667,972; 5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196; 5,871,928; 5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO 09923256; WO 09936760; WO0138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426; WO03100012; WO 04020085; WO 04027093; EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which are all herein incorporated by reference.

    [0278] It is contemplated that the arrays can be high density arrays, such that they contain 100 or more different probes. It is contemplated that they may contain 1000, 16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can be directed to targets in one or more different organisms. The oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or 15 to 40 nucleotides in length in some embodiments. In certain embodiments, the oligonucleotide probes are 20 to 25 nucleotides in length.

    [0279] The location and sequence of each different probe sequence in the array are generally known. Moreover, the large number of different probes can occupy a relatively small area providing a high density array having a probe density of generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different oligonucleotide probes per cm.sup.2. The surface area of the array can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9, or 10 cm.sup.2.

    [0280] Moreover, a person of ordinary skill in the art could readily analyze data generated using an array. Such protocols are disclosed above, and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO 03066906; WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically incorporated by reference.

    [0281] D. Sample Preparation

    [0282] It is contemplated that the miRNA of a wide variety of samples can be analyzed using assays described herein. While endogenous miRNA is contemplated for use with some embodiments, recombinant miRNAincluding nucleic acids that are complementary or identical to endogenous miRNA or precursor miRNAcan also be handled and analyzed as described herein. Samples may be biological samples, in which case, they can be from blood, tissue, organs, semen, saliva, tears, other bodily fluid, hair follicles, skin, or any sample containing or constituting biological cells. Alternatively, the sample may not be a biological sample, but be a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).

    [0283] E. Hybridization

    [0284] After the array is prepared and the miRNA in the sample is labeled, the population of target nucleic acids is contacted with the array under hybridization conditions, where such conditions can be adjusted, as desired, to provide for an optimum level of specificity in view of the particular assay being performed. Suitable hybridization conditions are well known to those of skill in the art and reviewed in Sambrook et al., 1989 and WO 95/21944. Of particular interest in many embodiments is the use of stringent conditions during hybridization. Stringent conditions are known to those of skill in the art.

    [0285] It is specifically contemplated that a single array may be contacted with multiple samples. The samples may be labeled with different labels to distinguish the samples. For example, a single array can be contacted with a tumor tissue sample labeled with Cy3, and normal tissue sample labeled with Cy5. Differences between the samples for particular miRNAs corresponding to probes on the array can be readily ascertained and quantified.

    [0286] The small surface area of the array permits uniform hybridization conditions, such as temperature regulation and salt content. Moreover, because of the small area occupied by the high density arrays, hybridization may be carried out in extremely small fluid volumes (e.g., about 250 l or less, including volumes of about or less than about 5, 10, 25, 50, 60, 70, 80,90, 100 l, or any range derivable therein). In small volumes, hybridization may proceed very rapidly.

    [0287] F. Differential Expression Analyses

    [0288] Arrays can be used to detect differences between two samples. This can also be used for diagnostic purposes. Specifically contemplated applications include identifying and/or quantifying differences between miRNA from a sample that is normal and from a sample that is not normal or between two differently treated samples. Also, miRNA may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. A sample that is not normal is one exhibiting phenotypic trait(s) of a disease or condition or one believed to be not normal with respect to that disease or condition. It may be compared to a cell that is normal with respect to that disease or condition. Phenotypic traits include symptoms of, or susceptibility to, a disease or condition of which a component is or may or may not be genetic.

    [0289] G. Cell Assays to Identify miRNAs with Ties to Disease

    [0290] Specifically contemplated applications include identifying miRNAs that contribute to cellular processes that are themselves parts of a disease or might otherwise be associated with a particular disease state. Also, miRNA functions may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition. It is specifically contemplated that RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section or modulate any of the cellular pathways discussed in the previous section.

    [0291] Specifically contemplated applications include identifying miRNAs that contribute to cellular processes that are themselves parts of a disease or might otherwise be associated with a particular disease state. Also, miRNA functions may be compared between a sample believed to be susceptible to a particular disease or condition and one believed to be not susceptible or resistant to that disease or condition.

    [0292] AIDS, autoimmune diseases (rheumatoid arthritis, multiple sclerosis, diabetesinsulin-dependent and non-independent, systemic lupus erythematosus and Graves disease); cancer (e.g., malignant, benign, metastatic, precancer); cardiovascular diseases (heart disease or coronary artery disease, strokeischemic and hemorrhagic, and rheumatic heart disease); diseases of the nervous system; and infection by pathogenic microorganisms (Athlete's Foot, Chickenpox, Common cold, Diarrheal diseases, Flu, Genital herpes, Malaria, Meningitis, Pneumonia, Sinusitis, Skin diseases, Strep throat, Tuberculosis, Urinary tract infections, Vaginal infections, Viral hepatitis); inflammation (allergy, asthma); prion diseases (e.g., CJD, kuru, GSS, FFI).

    [0293] Moreover, miRNA can be evaluated with respect to the following diseases, conditions, and disorders: Abdominal Adhesions; Anal Abscess; Brain Abscess; Peritonsillar Abscess; Absence Seizures; Achalasia; Acne; Acoustic Neuroma; Acquired Immunodeficiency Syndrome (AIDS); Acrochordon; Actinic Keratosis; Adenocarcinoma of the Lung; ADHD; Adult-Onset Diabetes; Aero-Otitis; Age Spots; Age-Related Hearing Loss; Age-Related Macular Degeneration; Age-Related Vision Change (Presbyopia); Agoraphobia; Alcohol Withdrawal; Alcoholism; Allergen Immunotherapy; Allergic Rhinitis; Allergies; Alopecia (Areata, Hereditary-Patterned, and Traumatic); Altitude Sickness; Alzheimer's Disease; Amaurotic Familial Infantile Idiocy; Amblyopia; Amenorrhea; Amyloidosis; Amyotrophic Lateral Sclerosis (ALS); Anaphylaxis; Androgenetic Alopecia; Anemia (Aplastic, Hemolytic, Pernicious, and Sickle Cell); Angina; Angiomas, Spider; Angioplasty; Ankylosing Spondylitis; Anorexia Nervo s a; Anovulatory Bleeding; Antibiotic-Associated Diarrhea; Antiphospholipid Antibody Syndrome; Antisocial Personality Disorder; Anus Fissure, Fistula, Hemorrhoids, Anus Itch, Stricture; Anxiety Disorders (Generalized, Obsessive-Compulsive Disorder, Panic Disorder, Phobia, and Post-Traumatic Stress Disorder); Aortic Aneurysm; Aortic Arch Syndrome; Appendicitis; Arrhythmias, Cardiac; Arteritis, Takayasu's; Arthritic Diseases (Ankylosing Spondylitis, Gout, Infectious, Juvenile, Osteoarthritis, Pseudogout, Psoriatic Arthritis, and Rheumatoid); Asbestosis; Ascending Cholangitis; Asteatotic Eczema; Asthma; Astigmatism; Asymptomatic Bacteriuria; Ataxia, Friedreich's; Atherosclerosis; Athlete's Foot; Atopic Dermatitis; Atrial Fibrillation; Atrophic Vaginitis; Attention-Deficit Hyperactivity Disorder; Autism; Autoimmune Diseases (Celiac Disease, Crohn's Disease, Diabetes Mellitus, Type 1 (Insulin-Dependent; Juvenile-Onset), Diabetes Mellitus, Type 2 (Non-Insulin-Dependent; Adult-Onset), Graves' Disease, Hyperthyroidism, Immune Thrombocytopenic Purpura, Lupus, Myasthenia Gravis, Polyarteritis Nodosa, Rheumatoid Arthritis, Scleroderma, Takayasu's Arteritis, and Ulcerative Colitis); B12 Deficiency; Bacillary Dysentery; Bacterial Gastroenteritis; Bacterial Vaginosis; Balanitis; Baldness, Hereditary-Patterned; Barber's Itch; Barotitis; Barotrauma; Bartholin's Gland Cyst; Basal-Cell Carcinoma; Bed-Wetting; Bedsores; Behcet's Syndrome; Bell's Palsy; Bends; Benign Prostatic Hyperplasia; Bile-Duct Diseases; Biliary Colic; Biopsy; Bipolar Disorder; Bladder conditions (Infection; Interstitial Cystitis; Prolapse; Urethritis; Urinary Incontinence; Urinary Tract Infection); Blepharitis; Blepharoptosis; Blighted Ovum; Friction Blisters; Blood Pressure, High; Boils; Bone diseases and conditions (Osteoporosis; Paget's Disease); Bone Yaws; Borderline Personality Disorder; Bornholm Disease; Botulism; Bowel Obstruction; Bradycardia; Bronchitis; Bulimia Nervosa; Bunion; Bursitis; C. Difficile Colitis; Calcaneal Apophysitis; Calcium Pyrophosphate Deposition Disease; Campylobacteriosis; Cancer; Candidiasis; Carbon-Monoxide Poisoning; Carbuncles; Cardiac Arrhythmias (Atrial Fibrillation, Bradycardia); Cardiomyopathy; Carpal Tunnel Syndrome; Cataracts; Cellulitis; Central Serous Retinopathy; Cerebral Palsy; Cerebromacular Degeneration; Cerumen Impaction; Cervicitis, Nabothian Cysts, Cervical Polyps, Cervical Warts; Chalazion; Chickenpox; Chlamydia; Chloasma; Cholangitis; Cholecystitis; Cholesteatoma; Chondromalacia; Chorea; Choroidal Melanoma; Chronic Bronchitis; Chronic Fatigue Syndrome; Chronic Hepatitis; Chronic Leukemia; Chronic Obstructive Pulmonary Disease; Chronic Otitis Media; Cirrhosis; Cluster Headache; Cogan's Syndrome; Cold, Common; Colic, Biliary; Pseudomembranous Colitis, Ulcerative Colitis, Collapsed Lung; Collarbone Fracture; Coma; Complex Regional Pain Syndrome; Congestive Heart Failure; Conjunctivitis; Constipation; Contact Dermatitis; Conversion Disorder; COPD; Cornea Abrasion, Cornea Keratitis; Corns; Coronary Artery Disease; Creutzfeldt-Jakob Disease; Crossed Eyes; Croup; Cryptorchidism; Cystic Fibrosis; Interstitial Cystitis; Cystocele; Cysts; Cytomegalovirus infection; Dacryocystitis; Dandruff; Decompression Sickness; Decubitus Ulcers; Delirium Tremens; Delusional Disorder; Dementia; Depressive Disorders (Bipolar Disorder, Dysthymia, Major Depression, Manic Depression, Postpartum Depression); Dermatitis; Dermatofibroma; Dermatomyositis; Detached Retina; Developmental Dysplasia of the Hip; Deviated Septum; Devil's Grip; Diabetes (Gestational Diabetes; Type 1 Diabetes (Insulin-Dependent; Juvenile); Type 2 Diabetes (Non-Insulin-Dependent; Adult-Onset); Hypoglycemia, Ketoacidosis, Nephropathy, Neuropathies, Retinopathy) Antibiotic-Associated Diarrhea; Diplopia; Herniated Disk; Dislocated Lens; Hip Dislocation (Developmental); Diverticulitis; Diverticulosis; Dizziness; Doerderland's Vaginitis; Double Vision; Down Syndrome; Drooping Eyelid; Dry Skin; Sun-Damaged Skin; Dry-Eye Syndrome; Duck-Foot; Dysautonomia, Familial; Dysfunctional Uterine Bleeding; Dyslexia; Dyspareunia; Dysthymia; Dysuria; Eating Disorders (Anorexia Nervosa, Bulimia Nervosa); Eclampsia; Eczema; Edema; Emphysema; Encephalitis; Encopresis; End-Stage Renal Disease; Endocarditis; Endometriosis; Endophthalmitis; Endoscopy; Enlarged Prostate; Enuresis; Epidemic Benign Dry Pleurisy; Epididymitis; Epiglottitis; Epilepsy; Epistaxis; Erectile Dysfunction; Erythema Infectiosum; Esophagitis; Esophagus Achalasia; Esophagitis; Essential Hypertension; Essential Tremor; Ewing's Sarcoma; Familial Dysautonomia; Farsightedness; Febrile Seizures; Fecal Incontinence; Fever; Fever-Induced Seizures; Fibroids; Fibromyalgia; Fifth Disease; Filiform Warts; Flat Warts; Flatulence; Flu; Focal Seizures; Food Allergy; Food Poisoning; Forefoot Neuroma; Fragile X Syndrome; Friction Blisters; Friedreich's Ataxia; Frostbite; Fungal Infections (Athlete's Foot, Brain Abscess, Infectious Arthritis, Jock Itch, Onychomycosis, Ringworm, Swimmer's Ear, Tinea Cruris, Tinea Unguium, Tinea Versicolor); Furuncle; Gallstones; Gardnerella Vaginitis; Gastritis; Gastrocnemius Strain; Gastroenteritis; Gastroesophageal Reflux Disease; Gastrointestinal Amebiasis; Generalized Anxiety Disorder; Generalized Barotrauma; Genital Herpes; Genital Warts; GERD; Germ Cell Tumors, Extragonadal; Giant Cell Arteritis; Giardiasis; Glaucoma; Glomerulonephritis; Gluten-Sensitive Enteropathy; GM2 Gangliosidosis; Gonorrhea; Gout; Grand Mal Seizures; Graves' Disease; Graves' Ophthalmopathy; Guillain-Barr Syndrome; Hammertoe; Hay Fever; Headache; Hearing Loss; Heart Attack; Heat Stroke; Heel Spur; Heloma; Spider Hemangiomas; Hematoma; Hematuria; Hemochromatosis; Hemolytic Anemia; Hemophilia; Hemorrhagic Stroke; Subarachnoid Hemorrhagic Stroke; Hemorrhoids; Hepatitis A; Hepatitis B; Hepatitis C; Hereditary-Patterned Baldness; Hernia; Herniated Disk; High Blood Pressure; High Cholesterol; Hirsutism; Histiocytosis X; HIV/AIDS; Hordeolum; Human Papilloma Virus (HPV); Huntington's Disease; Hydatidiform Mole; Hydrocephalus; Hyperactivity; Hypercholesterolemia; Hyperkeratosis; Hyperopia; Hypertension; Ocular Hypertension; Secondary Hypertension; Hypertensive Retinopathy; Hyperthermia; Hyperthyroidism; Hypochondriasis; Hypoglycemia; Hypoparathyroidism; Hypothyroidism; IBS; ICD; Ichthyosis; Immune Thrombocytopenic Purpura; Impetigo; Impotence; Incontinence; Infantile Ganglioside Lipidosis; Infectious Arthritis; Infectious Mononucleosis; Infertility; Inflammatory Bowel Disease; Inguinal Hernia; Insomnia; Intercerebral Hemorrhage; Interdigital Neuroma; Intermetatarsal Neuroma; Intermittent Claudication; Interstitial Cystitis; Intestinal Obstruction; Iron Deficiency; Irritable Bowel Syndrome; Juvenile Arthritis; Kaposi's Sarcoma; Kawasaki Syndrome; Keloids; Keratitis; Actinic Keratosis; Labyrinthitis; Lactose Intolerance; Lacunar Stroke; Langerhans' Cell Histiocytosis; Laryngitis; Laryngotracheitis; Lateral Epicondylitis; Latex Allergy; Lazy Eye; Lead Poisoning; Intermittent Claudication; Restless Legs Syndrome; Shin Splints; Leg Strain; Cataract; Dislocated Lens; Leukemia; Lice; Lichen Simplex Chronicus; Cirrhosis; Hepatitis; Liver Spots; Lockjaw; Lou Gehrig's Disease; Lupus Erythematosus, Systemic; Lyme Disease; Lymphedema; Lymphoma; Macular Degeneration; Malabsorption Syndromes; Malaria; Male Pattern Baldness; Malignant Hyperthermia; Manic Depression; Marfan's Syndrome; Mastoiditis; Measles; Meckel's Diverticulum; Melasma; Meniere's Disease; Meningitis; Menopause; Mental Retardation; Phenylketonuria; Migraine; Miscarriage; Mitral-Valve Prolapse; Mittelschmerz; Molar Pregnancy; Molluscum Contagiosum; Mononucleosis; Morton's Neuroma; Mosaic Warts; Motor Tics; Mucocutaneous Lymph Node Syndrome; Multiple Sclerosis; Mumps; Muscular Dystrophy; Musculo skeletal Disorders (Fibromyalgia, Giant Cell Arteritis, Gout, Infectious Arthritis, Muscular Dystrophy, Myositis, Osteoarthritis, Osteoporosis, Paget's Disease Of Bone, Polymyalgia Rheumatica, Pseudogout, Reflex Sympathetic Dystrophy, Rheumatoid Arthritis, Scleroderma, Systemic Lupus Erythematosus, Tendonitis); Myasthenia Gravis; Myocardial Infarction; Myocarditis; Myopia; Myositis; Nail Felon; Onycholysis; Onychomycosis; Paronychia; Subungual Hematoma; Narcolepsy; Nasal Polyps; Nausea; Nearsightedness; Needle Biopsy; Nephrectomy; Nephroblastoma; Nephrolithiasis; Nephropathy, Diabetic; Neuritis, Retrobulbar; Neuroblastoma; Neuromuscular Disorders; Neuropathies; Guillain-Barre Syndrome; Retrobulbar; Nevi; Nevus Flammeus; Nevus Simplex; Nocturnal Enuresis; Non-Tropical Sprue; Obesity; Obsessive-Compulsive Disorder; Occupational Hearing Loss; Ocular Hypertension; Ocular Rosacea; Onycholysis; Onychomycosis; Glaucoma; Retrobulbar Neuritis; Optic Nerve Swelling; Orbit Fracture; Orchitis; Osgood-Schlatter Disease; Osteoarthritis; Osteoporosis; Osteosarcoma; Otitis Externa; Otitis Media; Chronic Otitis Media; Otosclerosis; Ototoxicity; Pelvic Inflammatory Disease; Polycystic Ovary Syndrome; Painful-Bladder Syndrome; Pancreatitis; Panic Disorder; Papilledema; Paraphimosis; Parkinson's Disease; Paronychia; Partial Seizures; PCL Injuries; Pedunculated Warts; Pelvic Relaxation; Paraphimosis; Peyronie's Disease; Peptic Ulcer; Perforated Eardrum; Pericarditis; Perimenopause; Peripheral Vascular Disease; Peritonsillar Abscess; Persistent Vegetative State; Personality Disorders; Petit Mal Seizures; Peyronie's Disease; Pharyngitis; Pharynx Cancer; Phenylketonuria; Phimosis; Phobia; Photosensitivity; Pigmentation Disorders (Chloasma, Melasma, Vitiligo); Piles; Pinkeye; Pityriasis Rosea; PKU; Plague; Plantar Fasciitis; Plantar Warts; Plantaris Strain; Pleurisy; Pleurodynia; PMS; Pneumoconiosis; Pneumonectomy; Pneumonia; Pneumothorax; Lead Poisoning; Polio; Poliomyelitis; Polyarteritis Nodosa; Polychondritis; Polymyalgia Rheumatica; Polymyositis; Colonic Polyps; Nasal Polyps; Vocal Cord Polyps; Port-Wine Stain; Post-Polio Syndrome; Postinfectious Thrombocytopenia; Postpartum Depression; Preeclampsia; Pregnancy-Induced Hypertension; Premenstrual Syndrome; Pressure Sores; Primary Sclerosing Cholangitis; Prolapse; Enlarged Prostate; Acute Prostatitis; Chronic Prostatitis; Pruritus Ani; Pseudogout; Psoriasis; Psoriatic Arthritis; Ptosis; Pulseless Disease; Pyelonephritis; Quadriceps Strain; Quinsy; Rash; Raynaud's Phenomenon; Rectal Itch; Rectocele; Reflex Sympathetic Dystrophy; Renal Failure; Respiratory Disorders Respiratory Syncytial Virus; Retina Detachment; Retinitis Pigmentosa; Retinopathy; Retrobulbar Neuritis; Reye's Syndrome; Rhabdomyo sarcoma; Rheumatoid Arthritis; Allergic Rhinitis; Viral Rhinitis (Common Cold); Riley-Day Syndrome; Ringworm; Rocky Mountain Spotted Fever; Rosacea; Rubeola; Mumps; Salivary Gland Disorders; Salmon Patch; Sarcoidosis; Scabies; Scarlet Fever; Scars; Schizophrenia; Schizotypal Personality Disorder; Sciatica; Scleritis; Scleroderma; Scoliosis; Sebaceous Cysts; Seborrhea; Seborrheic Keratoses; Secondary Hypertension; Seizures; Sexual Dysfunction; Sexually Transmitted Diseases; Shigellosis; Shingles; Sialadenitis; Sialadenosis; Sialolithiasis; Sickle-Cell Anemia; Siderosis; Silicosis; Sinus Cancer; Sjgren's Syndrome; Sleep Disorders; Smallpox; Social Anxiety Disorder; Solar Lentigo; Somatoform Disorders (Hypochondriasis, Somatization Disorder); Somnambulism; Spastic Colon; Spider Veins; Spina Bifida; Spinal Cord Trauma; Spontaneous Abortion; Stasis Dermatitis; Strabismus; Strep Throat; Streptococcal Toxic Shock Syndrome; Stroke; Subarachnoid Hemorrhage; Transient Ischemic Attack; Stuttering; Subungual Hematoma; Sun Allergy; Sun-Damaged Skin; Sylvest's Disease; Systemic Lupus Erythematosus; Systemic Sclerosis; Tachycardia; Takayasu's Arteritis; Tay-Sachs Disease; Tear-Duct Infection; Telogen Effluvium; Temporal Arteritis; Tendonitis; Tennis Elbow; Tension Headache; Testicular Torsion; Undescended Testicles; Tetanus; Thrombocytopenia; Thrombophlebitis; Thrombotic Stroke; Tinea; Tinnitus; Tonsillitis; Torsional Deformities; Toxemia Of Pregnancy; Toxic Shock Syndrome, Streptococcal; Toxoplasmosis; Trichomoniasis; Trigeminal Neuralgia (Tic Douloureux); Tuberculosis; Tylosis; Ulcer; Urethritis; Urinary Tract disorders and conditions; Uroliniasis; Urticaria; Uterine disorders; Uterine Prolapse; Uveitis; Vaginitis; Bacterial (Gardnerella) Vaginosis; Varicella; Varices, Esophageal; Varicose Veins; Vascular Disorders (Hypertension, Intermittent Claudication, Peripheral Vascular Disease, Polyarteritis Nodosa, Raynaud's Phenomenon, Takayasu's Arteritis, Thrombophlebitis, Vasculitis, Wegener's Granulomatosis); Vein Inflammation; Varicose Veins; Vertigo; Vestibular Schwannoma; Viral Rhinitis; Vitamin B12 Deficiency; Vitiligo; Vocal Tics; Vocal-Cord Disorders; Common Warts; Genital Warts; Plantar Warts; Water On The Brain; Wax Blockage Of Ear Canal; Esophageal Webs; Werlhofs Disease; Wrinkles; Yersinia Pestis Infection. It is contemplated that such diseases can be diagnosed or treated using a nucleic acids of the invention that correspond to miRNAs.

    [0294] Cancers that may be evaluated, diagnosed, and/or treated by methods and compositions of the invention include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangio sarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxo sarcoma; lipo sarcoma; leiomyosarcoma; rhabdomyo sarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangio sarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. Moreover, miRNA can be evaluated in precancers, such as metaplasia, dysplasia, and hyperplasia.

    [0295] It is specifically contemplated that the invention can be used to evaluate or diagnose differences between stages of disease, such as between pre-cancer and cancer, or between a primary tumor and a metastasized tumor.

    [0296] The efficacy of different therapeutic drugs is altered by miRNAs according to the present invention. Such therapeutic drugs include, but are not limited to, chemotherapeutic drugs. A chemotherapeutic agent is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

    [0297] Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammalI and calicheamicin omegaI1; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2,2-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (Ara-C); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

    [0298] Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen, raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene; aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestanie, fadrozole, vorozole, letrozole, and anastrozole; and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those which inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Ralf and H-Ras; ribozymes such as a VEGF expression inhibitor and a HER2 expression inhibitor; vaccines such as gene therapy vaccines and pharmaceutically acceptable salts, acids or derivatives of any of the above. A list of U.S. FDA approved oncology drugs with their approved indications can be found on the World Wide Web at accessdata.fda.gov/scripts/cder/onctools/druglist.cfm. Moreover, it is contemplated that samples that have differences in the activity of certain pathways may also be compared. Such cellular pathways include but are not limited to the following: any adhesion or motility pathway including but not limited to those involving cyclic AMP, protein kinase A, G-protein couple receptors, adenylyl cyclase, L-selectin, E-selectin, PECAM, VCAM-1, -actinin, paxillin, cadherins, AKT, integrin-, integrin-, RAF-1, ERK, PI-3 kinase, vinculin, matrix metalloproteinases, Rho GTPases, p85, trefoil factors, profilin, FAK, MAP kinase, Ras, caveolin, calpain-1, calpain-2, epidermal growth factor receptor, ICAM-1, ICAM-2, cofilin, actin, gelsolin, RhoA, RAC1, myosin light chain kinase, platelet-derived growth factor receptor or ezrin; any apoptosis pathway including but not limited to those involving AKT, Fas ligand, NF.sub.KB, caspase-9, PI3 kinase, caspase-3, caspase-7, ICAD, CAD, EndoG, Granzyme B, Bad, Bax, Bid, Bak, APAF-1, cytochrome C, p53, ATM, Bcl-2, PARP, Chk1, Chk2, p21, c-Jun, p73, Rad51, Mdm2, Rad50, c-Ab1, BRCA-1, perforin, caspase-4, caspase-8, caspase-6, caspase-1, caspase-2, caspase-10, Rho, Jun kinase, Jun kinase kinase, Rip2, lamin-A, lamin-B1, lamin-B2, Fas receptor, H.sub.2O.sub.2, Granzyme A, NADPH oxidase, HMG2, CD4, CD28, CD3, TRADD, IKK, FADD, GADD45, DR3 death receptor, DR4/5 death receptor, FLIPs, APO-3, GRB2, SHC, ERK, MEK, RAF-1, cyclic AMP, protein kinase A, E2F, retinoblastoma protein, Smac/Diablo, ACH receptor, 14-3-3, FAK, SODD, TNF receptor, RIP, cyclin-D1, PCNA, Bcl-XL, PIP2, PIP3, PTEN, ATM, Cdc2, protein kinase C, calcineurin, IKK, IKKr, IKK, SOS-1, c-FOS, Traf-1, Traf-2, I.sub.KB or the proteasome; any cell activation pathway including but not limited to those involving protein kinase A, nitric oxide, caveolin-1, actin, calcium, protein kinase C, Cdc2, cyclin B, Cdc25, GRB2, SRC protein kinase, ADP-ribosylation factors (ARFs), phospholipase D, AKAP95, p68, Aurora B, CDK1, Eg7, histone H3, PKAc, CD80, PI3 kinase, WASP, Arp2, Arp3, p16, p34, p20, PP2A, angiotensin, angiotensin-converting enzyme, protease-activated receptor-1, protease-activated receptor-4, Ras, RAF-1, PLC, PLC, COX-1, G-protein-coupled receptors, phospholipase A2, IP3, SUMO1, SUMO 2/3, ubiquitin, Ran, Ran-GAP, Ran-GEF, p53, glucocorticoids, glucocorticoid receptor, components of the SWI/SNF complex, RanBP1, RanBP2, importins, exportins, RCC1, CD40, CD40 ligand, p38, IKKa, IKKr3, NF.sub.KB, TRAF2, TRAF3, TRAF5, TRAF6, IL-4, IL-4 receptor, CDK5, AP-1 transcription factor, CD45, CD4, T cell receptors, MAP kinase, nerve growth factor, nerve growth factor receptor, c-Jun, c-Fos, Jun kinase, GRB2, SOS-1, ERK-1, ERK, JAK2, STAT4, IL-12, IL-12 receptor, nitric oxide synthase, TYK2, IFN, elastase, IL-8, epithelins, IL-2, IL-2 receptor, CD28, SMAD3, SMAD4, TGF or TGF receptor; any cell cycle regulation, signaling or differentiation pathway including but not limited to those involving TNFs, SRC protein kinase, Cdc2, cyclin B, Grb2, Sos-1, SHC, p68, Aurora kinases, protein kinase A, protein kinase C, Eg7, p53, cyclins, cyclin-dependent kinases, neural growth factor, epidermal growth factor, retinoblastoma protein, ATF-2, ATM, ATR, AKT, CHK1, CHK2, 14-3-3, WEE1, CDC25 CDC6, Origin Recognition Complex proteins, p15, p16, p27, p21, ABL, c-ABL, SMADs, ubiquitin, SUMO, heat shock proteins, Wnt, GSK-3, angiotensin, p73 any PPAR, TGF, TGF, p300, MDM2, GADD45, Notch, cdc34, BRCA-1, BRCA-2, SKP1, the proteasome, CUL1, E2F, p107, steroid hormones, steroid hormone receptors, I.sub.B, I.sub.B, Sin3A, heat shock proteins, Ras, Rho, ERKs, IKKs, PI3 kinase, Bcl-2, Bax, PCNA, MAP kinases, dynein, RhoA, PKAc, cyclin AMP, FAK, PIP2, PIP3, integrins, thrombopoietin, Fas, Fas ligand, PLK3, MEKs, JAKs, STATs, acetylcholine, paxillin calcineurin, p38, importins, exportins, Ran, Rad50, Rad51, DNA polymerase, RNA polymerase, Ran-GAP, Ran-GEF, NuMA, Tpx2, RCC1, Sonic Hedgehog, Crm1, Patched (Ptc-1), MPF, CaM kinases, tubulin, actin, kinetochore-associated proteins, centromere-binding proteins, telomerase, TERT, PP2A, c-MYC, insulin, T cell receptors, B cell receptors, CBP, IKB, NF.sub.KB, RAC1, RAF1, EPO, diacylglycerol, c-Jun, c-Fos, Jun kinase, hypoxia-inducible factors, GATA4, -catenin, -catenin, calcium, arrestin, survivin, caspases, procaspases, CREB, CREM, cadherins, PECAMs, corticosteroids, colony-stimulating factors, calpains, adenylyl cyclase, growth factors, nitric oxide, transmembrane receptors, retinoids, G-proteins, ion channels, transcriptional activators, transcriptional coactivators, transcriptional repressors, interleukins, vitamins, interferons, transcriptional corepressors, the nuclear pore, nitrogen, toxins, proteolysis, or phosphorylation; or any metabolic pathway including but not limited to those involving the biosynthesis of amino acids, oxidation of fatty acids, biosynthesis of neurotransmitters and other cell signaling molecules, biosynthesis of polyamines, biosynthesis of lipids and sphingolipids, catabolism of amino acids and nutrients, nucleotide synthesis, eicosanoids, electron transport reactions, ER-associated degradation, glycolysis, fibrinolysis, formation of ketone bodies, formation of phagosomes, cholesterol metabolism, regulation of food intake, energy homeostasis, prothrombin activation, synthesis of lactose and other sugars, multi-drug resistance, biosynthesis of phosphatidylcholine, the proteasome, amyloid precursor protein, Rab GTPases, starch synthesis, glycosylation, synthesis of phoshoglycerides, vitamins, the citric acid cycle, IGF-1 receptor, the urea cycle, vesicular transport, or salvage pathways. It is further contemplated that nucleic acids molecules of the invention can be employed in diagnostic and therapeutic methods with respect to any of the above pathways or factors. Thus, in some embodiments of the invention, a synthetic miRNA, nonsynthetic nucleic acid, or miRNA inhibitor inhibits, eliminate, activates, induces, increases, or otherwise modulates one or more of the above pathways or factors is contemplated as part of methods of the invention. The nucleic acid can be used to diagnosis a disease or condition based on the relation of that miRNA to any of the pathways described above.

    [0299] Phenotypic traits also include characteristics such as longevity, appearance (e.g., baldness, obesity), strength, speed, endurance, fertility, and susceptibility or receptivity to particular drugs or therapeutic treatments. Synthetic miRNAs or miRNA inhibitors that affect phenotypic traits may provide intervention points for therapeutic development.

    [0300] H. Other Assays

    [0301] In addition to the use of arrays and microarrays, it is contemplated that a number of difference assays could be employed to analyze miRNAs, their activities, and their effects. Such assays include, but are not limited to, RT-PCR, in situ hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies), and Bridge Litigation Assay (Genaco). It is contemplated that such methods may be used in the context of arrays, as well as in the context of diagnostic assays.

    III. Therapeutic and Diagnostic Applications

    [0302] Synthetic miRNAs or miRNA inhibitors that affect phenotypic traits provide intervention points for therapeutic applications as well as diagnostic applications (by screening for the presence or absence of a particular miRNA). It is specifically contemplated that RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the previous section. Moreover, any of the methods described above can also be employed with respect to therapeutic and diagnostic aspects of the invention. For example, methods with respect to detecting miRNAs or screening for them can also be employed in a diagnostic context.

    [0303] In therapeutic applications, an effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to a cell, which may or may not be in an animal. In some embodiments, a therapeutically effective amount of the synthetic miRNAs or miRNA inhibitors of the present invention is administered to an individual for the treatment of disease or condition. The term effective amount as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered. The term therapeutically effective amount as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to a disease or condition. A skilled artisan readily recognizes that in many cases the molecules may not provide a cure but may provide a partial benefit, such as alleviation or improvement of at least one symptom. In some embodiments, a physiological change having some benefit is also considered therapeutically beneficial. Thus, in some embodiments, an amount of molecules that provides a physiological change is considered an effective amount or a therapeutically effective amount.

    [0304] In some embodiments the molecule has a sequence that corresponds to the miRNA sequence from that particular animal, as opposed to from another animal. Thus, in some embodiments, a human sequence is utilized in the RNA molecules of the present invention.

    [0305] A. Modes of Administration and Formulations

    [0306] The nucleic acid molecules of the invention may be administered to a subject alone or in the form of a pharmaceutical composition for the treatment of a condition or disease. Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the proteins into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

    [0307] For topical administration the proteins of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art. Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration. For injection, the nucleic acids of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the nucleic acid molecules may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For oral administration, the nucleic acids can be readily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers enable the nucleic acids of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, e.g. lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents. If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. If desired, solid dosage forms may be sugar-coated or enteric-coated using standard techniques. For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added. For buccal administration, the molecules may take the form of tablets, lozenges, etc. formulated in conventional manner. For administration by inhalation, the molecules for use according to the present invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the nucleic acids and a suitable powder base such as lactose or starch. The RNA molecules may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

    [0308] In addition to the formulations described previously, the molecules may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the molecules may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

    [0309] Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well-known examples of delivery vehicles that may be used to deliver nucleic acids of the invention.

    [0310] A nucleic acid of the invention may be administered in combination with a carrier or lipid to increase cellular uptake. For example, the oligonucleotide may be administered in combination with a cationic lipid. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The publication of WO0071096, which is specifically incorporated by reference, describes different formulations, such as a DOTAP:cholesterol or cholesterol derivative formulation that can effectively be used for gene therapy. Other disclosures also discuss different lipid or liposomal formulations including nanoparticles and methods of administration; these include, but are not limited to, U.S. Patent Publication 20030203865, 20020150626, 20030032615, and 20040048787, which are specifically incorporated by reference to the extent they disclose formulations and other related aspects of administration and delivery of nucleic acids. Methods used for forming particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900, which are incorporated by reference for those aspects.

    [0311] The nucleic acids may also be administered in combination with a cationic amine such as poly (L-lysine). Nucleic acids may also be conjugated to a chemical moiety, such as transferrin and cholesteryls. In addition, oligonucleotides may be targeted to certain organelles by linking specific chemical groups to the oligonucleotide. For example, linking the oligonucleotide to a suitable array of mannose residues will target the oligonucleotide to the liver.

    [0312] Additionally, the molecules may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the chimeric molecules, additional strategies for molecule stabilization may be employed.

    [0313] Nucleic acids may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts that substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.

    [0314] Pharmaceutical compositions of the present invention comprise an effective amount of one or more synthetic miRNA molecules or miRNA inhibitors dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases pharmaceutical or pharmacologically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one chimeric polypeptide or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.

    [0315] As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

    [0316] The chimeric molecules may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g. aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).

    [0317] The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

    [0318] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.

    [0319] In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.

    [0320] The molecules may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.

    [0321] In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.

    [0322] In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in preferred embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.

    [0323] In certain embodiments, the molecules are prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incorporated directly with the food of the diet. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.

    [0324] In certain preferred embodiments an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.

    [0325] The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.

    [0326] In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.

    [0327] Any embodiment discussed above with respect to delivery or transport to cells can also be employed with respect to implementing delivery of medicinal compounds discussed in this section.

    [0328] B. Effective Dosages

    [0329] The molecules of the invention will generally be used in an amount effective to achieve the intended purpose. For use to treat or prevent a disease condition, the molecules of the invention, or pharmaceutical compositions thereof, are administered or applied in a therapeutically effective amount. A therapeutically effective amount is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.

    [0330] For systemic administration, a therapeutically effective dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC.sub.5 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.

    [0331] Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.

    [0332] Dosage amount and interval may be adjusted individually to provide plasma levels of the molecules which are sufficient to maintain therapeutic effect. Usual patient dosages for administration by injection range from about 0.1 to 5 mg/kg/day, preferably from about 0.5 to 1 mg/kg/day. Therapeutically effective serum levels may be achieved by administering multiple doses each day.

    [0333] In cases of local administration or selective uptake, the effective local concentration of the proteins may not be related to plasma concentration. One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.

    [0334] The amount of molecules administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.

    [0335] The therapy may be repeated intermittently while symptoms detectable or even when they are not detectable. The therapy may be provided alone or in combination with other drugs or treatment (including surgery).

    [0336] C. Toxicity

    [0337] Preferably, a therapeutically effective dose of the molecules described herein will provide therapeutic benefit without causing substantial toxicity.

    [0338] Toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD.sub.100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. Proteins which exhibit high therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human. The dosage of the proteins described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl et al., 1975, In: The Pharmacological Basis of Therapeutics, Ch. 1, p. 1).

    [0339] D. Pendant Groups

    [0340] A pendant group may be attached or conjugated to the nucleic acid. Pendant groups may increase cellular uptake of the nucleic acid. Pendant groups can be linked to any portion of the nucleic acid but are commonly linked to the end(s) of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e. 2-methoxy-6-chloro-9-aminoacridine); cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II), o-phenanthroline-Cu(I), and porphyrin-Fe(II); alkylating moieties; nucleases such as amino-1-hexanolstaphylococcal nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; amino; mercapto groups; radioactive markers; nonradioactive markers such as dyes; and polylysine or other polyamines. In one example, the nucleic acid is conjugated to a carbohydrate, sulfated carbohydrate, or glycan.

    IV. Kits

    [0341] Any of the compositions described herein may be comprised in a kit. In a non-limiting example, individual synthetic miRNAs are included in a kit. The kit may further include one or more negative control synthetic miRNAs that can be used to control for the effects of synthetic miRNA delivery. The kit may further include water and hybridization buffer to facilitate hybridization of the two strands of the synthetic miRNAs. The kit may also include one or more transfection reagent(s) to facilitate delivery of the synthetic miRNA to cells.

    [0342] In another non-limiting example, multiple synthetic miRNAs and/or multiple miRNA inhibitors are included in a kit. The kit may further include one or more negative control synthetic miRNAs and/or miRNA inhibitors that can be used to control for the effects of synthetic miRNA and/or miRNA inhibitor delivery. The kit may also include one or more transfection reagents to facilitate delivery into cells.

    [0343] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.

    [0344] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.

    [0345] However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.

    [0346] The container means will generally include at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the nucleic acid formulations are placed, preferably, suitably allocated. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.

    [0347] The kits of the present invention will also typically include a means for containing the vials in close confinement for commercial sale, such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained.

    [0348] Such kits may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.

    [0349] A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

    [0350] Kits of the invention may also include one or more of the following: synthetic miRNA, nonsynthetic miRNA, library of synthetic miRNAs, library of miRNA inhibitors, library of nonsynthetic miRNA, combination library of synthetic miRNA, miRNA inhibitors, and/or nonsynthetic miRNAs, negative control synthetic miRNA, negative control miRNA inhibitor, negative control nonsynthetic miRNA, nuclease-free water; RNase-free containers, such as 1.5 ml tubes; hybridization buffer; and transfection reagent(s).

    [0351] It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.

    EXAMPLES

    [0352] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

    [0353] Unless otherwise designated, catalog numbers refer to products available by that number from Ambion, Inc., The RNA Company.

    Example 1

    Assay for Measuring Activity of Precursor miRNAs (Reporter)

    [0354] A series of luciferase reporter vectors was created to measure the activities of synthetic miRNAs in cells. The reporter vectors were based on plasmids that had been used to monitor the activity of endogenous miRNAs (Tuschl paper). Briefly, a mammalian expression vector with the luciferase gene under the control of the CMV early promoter was created. Down-stream of the luciferase coding sequence, in the 3 UTR of the gene, sequences complementary to mature miR-1-2, miR-10, miR-124, miR-19a, and miR-130 were added. The reporter vectors were co-transfected into HeLa cells along with synthetic miRNAs designed to introduce one of the five miRNAs listed above. The transfections involved mixing 200 ng of reporter vector with 0.3, 1, and 3 pmoles of each corresponding synthetic miRNA. The reporter/miRNA mixture was mixed with 0.3 l of Lipofectamine 2000 (Invitrogen) and incubated for 5-15 minutes. Approximately 8,000 cells were added to each miRNA/reporter/transfection reagent complex in individual wells of a 96-well plate. HeLa cells were grown in D-MEM (GIBCO) supplemented with 10% fetal bovine serum (GIBCO) at 37 C. and 5% CO.sub.2. 24-48 hrs post transfection, the cells were harvested and assayed using the Luciferase assay as described by the manufacturer (Promega). The level of luciferase expression in the cell populations was compared to cells transfected with the same reporter but a synthetic miRNA with a sequence that does not correspond to the vector. This non-targeting miRNA was referred to as the negative control miRNA.

    [0355] Final analysis of the synthetic miRNA designs involved measuring the activity of both the active and complementary strands of our synthetic miRNAs. For these studies, reporter vectors with luciferase 3 UTR sequences were created that included regions complementary to both the active and the complementary strands of our synthetic miR-33 and let-7b miRNA designs. When co-transfected with malfunctioning synthetic miRNAs, the reporters with a sequence targeted by the complementary strand exhibit reduced luciferase expression because the complementary strand of the synthetic miRNAs are entering the miRNA pathway in addition to or even instead of the active strand that is desired. For these experiments, the co-transfection and reporter analysis protocols are identical to what is described above.

    Example 2

    Assay for Measuring Activity of Precursor miRNAs (Endogenous Gene)

    [0356] While the luciferase reporter constructs were extremely valuable in evaluating the synthetic miRNA designs, it was important to verify the findings of the reporter constructs by measuring the effects of the synthetic miRNAs on endogenous gene targets. For these studies, the expression of RAS and MYC in cells transfected with let-7 miRNAs was chosen for monitoring. Both RAS and MYC are down-regulated by the various members of the let-7 family in humans and C. elegans (publication pending). Using a microarray system specific to miRNAs, the inventors have found that HepG2 cells express undetectable levels of let-7. To test the activities of our various designs of our synthetic miRNAs, synthetic let-7 miRNAs were created and used to transfect HepG2 cells in 24-well plates using siPORT NeoFX (Ambion) according to the manufacturer's suggestions. Three days post-transfection, the cells were fixed with 4% paraformaldehyde, stained with DAPI to localize cell nuclei, and stained with FITC-conjugated antibodies specific to MYC or RAS (US Biological) according to the manufacturer's suggestions. The relative reduction in target protein expression in synthetic let-7 transfected cells was determined by comparing the staining intensity of MYC and RAS to cells transfected with a negative control miRNA using MetaMorph software.

    [0357] To ensure that the results of our let-7 assays could be verified by additional miRNA interactions that are observed naturally in cells, we created assays for two additional miRNAs with verified targets. In the first, a real-time PCR assay was developed to measure the level of the HOXB8 mRNA in cells transfected with synthetic miR-196. It has been shown that miR-196 induces degradation of the HOXB8 mRNA in cells. When transfected into cultured cells using siPORT NeoFX according to the manufacturer's instructions, effective miR-196 synthetic miRNA designs reduce the levels of the HOXB8 mRNA.

    [0358] To monitor the effectiveness of synthetic miR-1-2 miRNAs, a reporter vector was created wherein the 3 UTR of the G6PD gene was placed immediately down-stream of the luciferase coding region. An interaction between miR-1-2 and the G6PD 3 UTR has been published (Lewis, 2003). Synthetic miR-1-2 designs were co-transfected with the reporter vector and assayed as described in Example 1.

    Example 3

    Effectiveness of Partially Complementary miRNAs

    [0359] Three general sequence designs were compared for miRNA activity. The first, referred to as the miRNA design, featured an active strand identical to the mature miRNA found in animals and a complementary strand that was identical to the hairpin sequence that is predicted to exist in cells during the processing of the miRNA prior to activation of the miRNA (see below). The second design, referred to as the mismatch design, was a hybrid of the same active strand as above with a complementary strand with a di-nucleotide, 3 overhang and two mismatches in the final five nucleotides that preceded the 3 overhang (see below). The third design, referred to as the siRNA design, comprised the same active strand as above hybridized to a second RNA that was fully complementary except that it left 3 di-nucleotide overhangs at either end of the double-stranded molecule (two polynucleotides) (see below). The examples below involve or correspond to human miRNAs.

    TABLE-US-00004 miR-1-2 maturemiR-1-2sequence- (53-73ofSEQIDNO:1) UGGAAUGUAAAGAAGUAUGUA miRNAdesign= (SEQIDNO:594) CAUACUUCUUUAUAUGCCCAUA+ (SEQIDNO:595) UGGAAUGUAAAGAAGUAUGUA mismatchdesign= (SEQIDNO:596) CAUACUUCUUUACAUUCUGTT+ (SEQIDNO:597) UGGAAUGUAAAGAAGUAUGUA siRNAdesign= (SEQIDNO:598) CAUACUUCUUUACAUUCCATT+ (SEQIDNO:599) UGGAAUGUAAAGAAGUAUGUA mir-124a-1 maturemiR-124sequence- (52-73ofSEQIDNO:80) UUAAGGCACGCGGUGAAUGCCA miRNAdesign= (SEQIDNO:600) GUGUUCACAGCGGACCUUGAUU+ (SEQIDNO:601) UUAAGGCACGCGGUGAAUGCCA mismatchdesign= (SEQIDNO:602) GCAUUCACCGCGUGCCUUGGTT+ (SEQIDNO:603) UUAAGGCACGCGGUGAAUGCCA siRNAdesign= (SEQIDNO:604) GCAUUCACCGCGUGCCUUAATT+ (SEQIDNO:605) UUAAGGCACGCGGUGAAUGCCA miR-130a maturemiR-130sequence- (55-74ofSEQIDNO:91) CAGUGCAAUGUUAAAAGGGC miRNAdesign= (SEQIDNO:606) UCUUUUCACAUUGUGCUAC+ (SEQIDNO:607) CAGUGCAAUGUUAAAAGGGC mismatchdesign= (SEQIDNO:608) UAUUUUAACAUUGCACUGTT+ (SEQIDNO:609) CAGUGCAAUGUUAAAAGGGC siRNAdesign= (SEQIDNO:610) CCUUUUAACAUUGCACUGTT+ (SEQIDNO:611) CAGUGCAAUGUUAAAAGGGC miR-19a maturemiR-19asequence- (49-71ofSEQIDNO:28) UGUGCAAAUCUAUGCAAAACUGA miRNAdesign= (SEQIDNO:612) AGUUUUGCAUAGUUGCACUA+ (SEQIDNO:613) UGUGCAAAUCUAUGCAAAACUGA mismatchdesign= (SEQIDNO:614) ACAUUUGCAUAGAUUUGCACATT+ (SEQIDNO:615) UGUGCAAAUCUAUGCAAAACUGA siRNAdesign= (SEQIDNO:616) AGUUUUGCAUAGAUUUGCACATT+ (SEQIDNO:617) UGUGCAAAUCUAUGCAAAACUGA mmu-miR-10a-1(mouse) maturemiR-10sequence- (22-44ofSEQIDNO:212) UACCCUGUAGAUCCGAAUUUGUG miRNAdesign= (SEQIDNO:618) CAAAUUCGUAUCUAGGGGAAUA+ (SEQIDNO:619) UACCCUGUAGAUCCGAAUUUGUG mismatchdesign= (SEQIDNO:620) AGAAUUCGGAUCUACAGGGUATT+ (SEQIDNO:621) UACCCUGUAGAUCCGAAUUUGUG siRNAdesign= (SEQIDNO:622) CAAAUUCGGAUCUACAGGGUATT+ (SEQIDNO:623) UACCCUGUAGAUCCGAAUUUGUG miR-33 maturemiR-33sequence- (6-24ofSEQIDNO:57) GUGCAUUGUAGUUGCAUUG miRNA= (SEQIDNO:624) AUGUUUCCACAGUGCAUCA+ (SEQIDNO:625) GUGCAUUGUAGUUGCAUUG mismatchdesign= (SEQIDNO:626) GUCCAACUACAAUGCACTT+ (SEQIDNO:627) GUGCAUUGUAGUUGCAUUG siRNAdesign= (SEQIDNO:628) AUGCAACUACAAUGCACTT+ (SEQIDNO:629) GUGCAUUGUAGUUGCAUUG let-7b maturelet-7bsequence- (6-27ofSEQIDNO:6) UGAGGUAGUAGGUUGUGUGGUU miRNAdesign= (SEQIDNO:630) CUAUACAACCUACUGCCUUCC+ (SEQIDNO:631) UGAGGUAGUAGGUUGUGUGGUU mismatchdesign= (SEQIDNO:632) CCACACAACCUACUAUCUUATT+ (SEQIDNO:633) UGAGGUAGUAGGUUGUGUGGUU siRNAdesign= (SEQIDNO:634) CCACACAACCUACUACCUCATT+ (SEQIDNO:635) UGAGGUAGUAGGUUGUGUGGUU miR-196-2 maturemiR-196sequence- (7-27ofSEQIDNO:143) UAGGUAGUUUCAUGUUGUUGG siRNAdesign= (SEQIDNO:636) AACAACAUGAAACUACCUATT+ (SEQIDNO:637) UAGGUAGUUUCAUGUUGUUGG miRNAdesign= (SEQIDNO:638) CAAAUUCGUAUCUAGGGGAAUA+ (SEQIDNO:639) UAGGUAGUUUCAUGUUGUUGG mismatchdesign= (SEQIDNO:640) AAUAACAUGAAACUACCUATT+ (SEQIDNO:641) UAGGUAGUUUCAUGUUGUUGG
    The assorted mir-1-2, mmu-miR-10a-1, miR-19a, mir-124a-1, and mir-130a synthetic miRNAs were tested for their capacity to reduce the expression of the reporter gene in vectors with appropriate miRNA target sites using the assay described in Example 1. All three designs were similarly capable of down-regulating the appropriate reporter vectors.

    [0360] To assess whether there were differences between the various miRNA designs ini their ability to affect the expression of endogenous genes, the following cells were transfected: HepG2 cells with three designs of the let-7 synthetic miRNAs, A549 with three designs of the miR-196 synthetic miRNAs, and HeLa with the G6PD reporter vector and three designs of the miR-1-2 synthetic miRNA. As with the reporter vectors, all three synthetic miRNA designs proved capable of reducing the expression of the target genes, though it is notable that the siRNA design performed most poorly.

    [0361] As a final comparison of the three synthetic miRNA designs, synthetic miRNAs were co-transfected with reporter vectors that included target sites for the complementary strands of the synthetic miRNAs according to the procedure described in Example 1. In this assay, it was apparent that the siRNA design significantly affected the reporter vectors, indicating that the wrong strand of the miRNA was entering the miRNA pathway (FIG. 3). Because the complementary strand might impact the expression of genes that are not natural targets of the miRNA that is being studied, the siRNA design is inappropriate for effective synthetic miRNAs.

    Example 4

    Effectiveness of Chemically 5 End-Modified Synthetic miRNAs

    [0362] Although the siRNA design proved problematic in that it exhibited a high rate of complementary strand uptake by the miRNA pathway, it did have the advantage that it was easy to hybridize and easy to deliver to cells. For these reasons, ways to overcome the problems with complementary strand uptake were explored. The siRNA design was used to test the effects of chemical modifications at the 5 ends of the synthetic miRNAs. For these studies, several different complementary strands were synthesized with unique 5 ends. One featured four deoxyribose nucleotides at the 5 end; one was a combination of four deoxyribose nucleotides at the 5 end and a 5 NH.sub.2; one had a 5 NH.sub.2; one had a 5 NHCOCH.sub.3 (see below).

    TABLE-US-00005 miR-33 maturemiR-33sequence- (6-24ofSEQIDNO:57) GUGCAUUGUAGUUGCAUUG siRNAdesign= (SEQIDNO:642) AUGCAACUACAAUGCACTT+ (SEQIDNO:643) GUGCAUUGUAGUUGCAUUG 5 aminodesign= (SEQIDNO:644) (NH.sub.2)AUGCAACUACAAUGCACTT+ (SEQIDNO:645) GUGCAUUGUAGUUGCAUUG 5 acetyldesign= (SEQIDNO:646) (CH.sub.3OCNH)AUGCAACUACAAUGCACTT+ (SEQIDNO:647) GUGCAUUGUAGUUGCAUUG 5 DNAdesign= (SEQIDNO:648) dAdUdGdCAACUACAAUGCACTT+ (SEQIDNO:649) GUGCAUUGUAGUUGCAUUG 5 aminoDNAdesign= (SEQIDNO:650) (NH.sub.2)dAdUdGdCAACUACAAUGCACTT+ (SEQIDNO:651) GUGCAUUGUAGUUGCAUUG let-7b maturelet-7bsequence- (6-27ofSEQIDNO:6) UGAGGUAGUAGGUUGUGUGGUU siRNAdesign= (SEQIDNO:652) CCACACAACCUACUACCUCATT+ (SEQIDNO:653) UGAGGUAGUAGGUUGUGUGGUU 5 aminodesign= (SEQIDNO:654) NH.sub.2CCACACAACCUACUACCUCATT+ (SEQIDNO:655) UGAGGUAGUAGGUUGUGUGGUU 5 DNAdesign= (SEQIDNO:656) dCdCdAdCACAACCUACUACCUCATT+ (SEQIDNO:657) UGAGGUAGUAGGUUGUGUGGUU 5 aminoDNAdesign= (SEQIDNO:658) NH.sub.2dCdCdAdCACAACCUACUACCUCATT+ (SEQIDNO:659) UGAGGUAGUAGGUUGUGUGGUU miR-1-2 maturemiR-1-2sequence- (53-73ofSEQIDNO:1) UGGAAUGUAAAGAAGUAUGUA siRNAdesign= (SEQIDNO:660) CAUACUUCUUUACAUUCCATT+ (SEQIDNO:661) UGGAAUGUAAAGAAGUAUGUA 5 aminodesign= (SEQIDNO:662) NH.sub.2CAUACUUCUUUACAUUCCATT+ (SEQIDNO:663) UGGAAUGUAAAGAAGUAUGUA miR-124a-1 maturemiR-124sequence- (52-73ofSEQIDNO:80) UUAAGGCACGCGGUGAAUGCCA siRNAdesign= (SEQIDNO:664) GCAUUCACCGCGUGCCUUAATT+ (SEQIDNO:665) UUAAGGCACGCGGUGAAUGCCA 5 aminodesign= (SEQIDNO:666) NH.sub.2GCAUUCACCGCGUGCCUUAATT+ (SEQIDNO:667) UUAAGGCACGCGGUGAAUGCCA miR-130a maturemiR-130sequence- (55-74ofSEQIDNO:91) CAGUGCAAUGUUAAAAGGGC siRNAdesign= (SEQIDNO:668) CCUUUUAACAUUGCACUGTT+ (SEQIDNO:669) CAGUGCAAUGUUAAAAGGGC 5 aminodesign= (SEQIDNO:670) NH.sub.2CCUUUUAACAUUGCACUGTT+ (SEQIDNO:671) CAGUGCAAUGUUAAAAGGGC miR-10a-1 maturemiR-10sequence- (22-44ofSEQIDNO:212) UACCCUGUAGAUCCGAAUUUGUG siRNAdesign= (SEQIDNO:672) CAAAUUCGGAUCUACAGGGUATT+ (SEQIDNO:673) UACCCUGUAGAUCCGAAUUUGUG 5aminodesign= (SEQIDNO:674) NH.sub.2CAAAUUCGGAUCUACAGGGUATT+ (SEQIDNO:675) UACCCUGUAGAUCCGAAUUUGUG
    The miR-33 and let-7b synthetic miRNAs were co-transfected into HeLa and HepG2 cells, respectively, with reporter vectors bearing target sites for the active and complementary strands of miR-33 and let-7b as described in Example 1. Luciferase expression from the active and complementary strand-specific reporter vectors was measured according to the manufacturer's (Promega) protocol. As shown in FIG. 3, the synthetic miRNA designs with the 5 NH.sub.2 and 5 NHCOCH.sub.3 provided higher active strand activity and significantly reduced complementary strand activity relative to the unmodified, synthetic miRNAs. This is ideal for synthetic miRNAs since the effects seen following transfection will be specific to the activity of the active strand of the synthetic miRNA. Furthermore, the high efficacy of the 5 modified designs will allow lower concentrations to be used for transfections and reduce toxicity that is often observed when transfecting cells with higher amounts of nucleic acid.

    [0363] To confirm that the 5 amino modification is superior to the standard siRNA design for a broad set of synthetic miRNAs, the effectiveness of both synthetic miRNA designs was measured in cells co-transfected with reporter vectors with miRNA target sites. As seen in FIG. 4, the 5 NH.sub.2 is reproducibly superior to the unmodified siRNA design.

    Example 5

    Effectiveness of Chemically Internally Modified Synthetic miRNAs

    [0364] The siRNA design was also used to test the effects of chemical modifications at internal domains within the complementary strand. For these studies, 2O-Me modifications were placed at various locations along the length of the complementary strand. Below is provided an example of a series of synthetic miRNAs with chemically modified complementary strands.

    TABLE-US-00006 miRNAStrand- (SEQIDNO:676) 5-UAUACAAGAGAUGAAAUCCUC-3 ComplementaryStrands- Position1- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Position2- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Position3- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Position4- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Position5- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Position6- (SEQIDNO:806) 5-GGAUUUCAUCUCUUGUAUAUt-3 Note- Positionsthatare2-O-Mearedenotedinbold.

    [0365] Synthetic miRNAs with the designs described above were tested for miRNA and complementary strand activity. Interestingly, complementary strand modifications at positions 1 and 5 significantly reduced complementary strand activity without altering the activity of the miRNA strand (FIG. 3).

    Example 6

    Synthetic miRNA Library Screen for miRNAs that Influence Cell Proliferation

    [0366] A hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.

    [0367] The inventors transfected HeLa cells in triplicate with fifteen different synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions (FIG. 6). Transfected HeLa cells were analyzed using Alamar Blue (BioSource International, Inc., CA) at 24 hr intervals. Alamar Blue is a compound, that when reduced by cellular metabolism, changes from a non-fluorescent blue color to a fluorescent red form that is easily quantified. The amount of Alamar Blue reduced is directly proportional to the cell number, providing a rapid method for assessing cell proliferation. To perform the assay, the Alamar Blue reagent was added into the tissue culture media at a 10% final concentration. The mixture was incubated for 3-6 hr in growth conditions after which fluorescence was quantified using a Spectra Max GeminiXS (Molecular Devices, Sunnyvale, Calif.). Cells transfected with synthetic miR-124 and miR-106 exhibited significantly lower proliferation than negative control-transfected samples, as well as samples transfected with the other synthetic miRNAs.

    Example 7

    MiRNA Inhibitor Library Screen for miRNAs that Influence Cell Proliferation

    [0368] A hallmark of cancer is uncontrolled cell proliferation. Cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with our miRNA inhibitor library to identify miRNAs that influence cell proliferation.

    [0369] Cells were transfected with a library of over 90 miRNA inhibitors to identify miRNAs that are involved in cell growth. HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with 5 pmoles of miRNA inhibitors using siPORT NeoFX (Ambion). The media was changed 24 hrs after transfection. 72 hours post-transfection, we fixed cells with 4% paraformaldehyde, permiabilized with 0.1% TritonX 100, and stained with propidium iodide to look at total cell number. The plates were scanned using the TTP labtech Acumen Explorer. Cell number was plotted relative to cells transfected with a negative control miRNA inhibitor (FIG. 7). The red horizontal bars bracket normal variation in cell proliferation (20% variation). Insets: Specific miRNA inhibitors that either increased cell proliferation (left arrow) or did not affect cell proliferation (right arrow) were used in a second round of screening. HeLa cells were transfected with these miRNA inhibitors and cells were fixed and stained with anti b-actin antibody and DAPI to visualize cell morphology changes in response to specific miRNA function. Cells transfected with the miRNA inhibitor that increased cell proliferation show marked alteration in cell morphology (left inset) vs. normal morphology (right inset).

    [0370] A group of nine miRNA inhibitors were identified that caused significant decreases (miR 31, 150, 187, 125a, 190, 191, 193, 204 and 218) in cell growth and two miRNA inhibitors that caused a significant increase (miR 24 and miR 21) in cell growth following transfection into HeLa cells (Table 4). MiRNA-31 inhibition also caused a distinct cellular morphology. A relative cut off of 20% above and below 100% was chosen as genes that were considered significantly changed. These results demonstrate the ability of individual human miRNAs to regulate important cellular processes. Furthermore, the diversity of the observed effects demonstrates the potential complexity of cellular outcomes of miRNA-mediated regulation of gene expression.

    TABLE-US-00007 TABLE 4 MiRNAs that affect cell proliferation Relative Impact on Cell miRNA Proliferation miR-31 Up regulation miR-150 Up regulation miR-187 Up regulation miR-125a Up regulation miR-190 Up regulation miR-191 Up regulation miR-193 Up regulation miR-204 Up regulation miR218 Up regulation miR-21 Down regulation miR-24 Down regulation

    Example 8

    Synthetic miRNA Library Screen for miRNAs that Influence Apoptosis

    [0371] Many diseases including cancer are characterized by an inability to institute programmed cell death, or apoptosis. A caspase 3/7 activity assay was used in conjunction with a library of synthetic miRNAs to identify miRNAs that are involved in regulating apoptosis.

    [0372] A library of eighteen synthetic miRNAs was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORT NeoFX (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at 80 C. 2) Cells were lysed by adding 40 l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4 C. 3) Add 160 l ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 M DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.

    [0373] Cells transfected with miR-1-2 and miR-33 synthetic miRNAs exhibited reduced caspase 3/7 activity and cells transfected with miR-20 exhibited much higher levels of apoptosis. These three miRNAs likely regulate genes that are involved in controlling apoptosis.

    Example 9

    Screen for miRNAs that Influence Cell Viability

    [0374] miRNA inhibitors were also used to identify miRNAs that influence cell viability. A library of over 90 miRNA inhibitors was used to transfect A549 cells (8000 cells/well of 96 well plate) in triplicate using siPORT NeoFX (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. Cells were trypsinized and stained with ViaCount Flex Reagent, which distinguishes between viable and non-viable cells based on permeability of the DNA binding dyes in the reagent. Cells were analyzed using the Guava PCA-96 (Personal Cell Analysis).

    [0375] Twenty-one miRNA inhibitors induced a significantly different ratio of live to dead cells than did the negative control miRNA inhibitor (FIG. 8). Twelve reduced cell viability and nine increased cell viability (Table 5). Interestingly, there was littleoverlap in the miRNAs that affected cell viability in A549 cells and those that affected cell proliferation in HeLa cells, suggesting that different cells respond differently to have reduced miRNA activities or cell viability and cell proliferation are not affected by the same cellular pathways.

    TABLE-US-00008 TABLE 5 MiRNAs that affect cell viability Relative Impact on Cell miRNA Viability miR-7 Down miR-19a Down miR-23 Down miR-24 Down miR-27a Down miR-31 Down miR-32 Down miR-134 Down miR-140 Down miR-150 Down miR-192 Down miR-193 Down miR-107 Up miR-133 Up miR-137 Up miR-152 Up miR-155 Up miR-181a Up miR-191 Up miR-203 Up miR-215 Up

    Example 10

    Screen for miRNAs that Influence Apoptosis

    [0376] Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis. To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.

    [0377] Using a library of over 90 miRNA inhibitors, we screened for miRNAs that affect apoptosis. HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with miRNA inhibitors (5 pmoles) using Ambion siPORT NeoFX. The media was changed 24 hrs after transfection and processed cells 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at 80 C. 2) Cells were lysed by adding 40 l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4 C. 3) Add 160 l ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 M DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.

    [0378] Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 l buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 l of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 C. (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.

    [0379] Normalized screening data are displayed in FIG. 9. miRNAs that affect apoptosis are listed in Table 5 and 6.

    TABLE-US-00009 TABLE 6 MiRNAs that affect apoptosis Relative Impact on Cell miRNA Proliferation miR-31 Down miR-214 Down miR-7 Up miR-1-2 Up miR-148 Up miR-195 Up miR-196 Up miR-199a Up miR-204 Up miR-210 Up miR-211 Up miR-212 Up miR-215 Up miR-216 Up miR-218 Up miR-296 Up miR-321 Up

    Example 11

    Expression Analyses Using Synthetic RNAs

    [0380] In addition to using phenotypic assays to identify miRNAs that influence gross cellular processes or cellular pathways, collections of synthetic miRNAs and/or miRNA inhibitors can be used to identify miRNAs that directly regulate the expression of a gene. A plasmid was created that had a luciferase gene immediately upstream of the 3UTR of the G6PD gene. A549 cells were co-transfected with the reporter vector and eighteen different synthetic miRNAs. 24 hours post-transfection, luciferase activity in the various cell populations was measured. Interestingly, the miR-1-2 significantly reduced the expression of the luciferase/G6PD gene, indicating that this family of miRNAs regulates the expression of the G6PD gene. Similar experiments can be used to identify miRNAs that regulate the expression of such important genes as p53, BRCA1 and BRCA2, RAS, MYC, BCL-2, and others.

    Example 12

    Oncogeneic miRNAsDifferential Expression and Cancer Regulation

    [0381] As noted in previous examples, a number of miRNAs have been identified that are differentially expressed between tumor and normal adjacent tissue samples from the same cancer patients. Interestingly, there is significant overlap in the miRNAs that are differentially expressed between different cancers, suggesting there is a core set of miRNAs that influence cellular processes that when altered, lead to cancer. The following describes experiments aimed at developing a link between miRNA mis-regulation and cancer.

    [0382] miRNA Expression in Lung Cancer

    [0383] Twenty-two tumor and normal adjacent tissue (NAT) samples from lung cancer patients were analyzed using the miRNA array system described above. The arrays were analyzed and the relative expression of each miRNA was compared between the tumor and normal adjacent tissues from each patient. The various miRNAs were clustered based on their relative expression in tumors across different patients (FIG. 14). Six miRNAs (miR-126, 30a, 143, 145, 188, and 331) were expressed at significantly lower levels in the tumors of more than 70% of the patients. Two miRNAs (miR-21 and 200b) were expressed at significantly higher levels in the tumors of more than 70% of the patients. The differential expression of a number of these miRNAs was verified by Northern analysis (FIG. 15).

    [0384] miRNA Expression in Colon Cancer

    [0385] Twenty-five tumor and NAT samples from colon cancer patients were analyzed using our miRNA array process. Like the lung cancer comparisons, the various miRNAs were clustered based on their relative expression in tumors across the different colon cancer patients (FIG. 14). Five miRNAs (miR-143, 145, 195, 130a, and miR-331) were expressed at significantly lower levels in the tumors of more than 70% of the patients. Five miRNAs (miR-223, 21, 31, 17, and 106) were expressed at significantly higher levels in the tumors of more than 70% of the patients.

    [0386] miRNAs as Cancer Markers

    [0387] It is interesting that eight different miRNAs were differentially expressed between the tumor and normal adjacent samples for most of the lung and colon patient samples that we analyzed (FIG. 16). These same miRNAs were also found to be differentially expressed in the breast, thymus, bladder, pancreatic, and prostate cancer patients that we analyzed, suggesting that these miRNAs might control cellular processes that when altered lead to cancer.

    [0388] miRNAs as Regulators of Oncogene Expression

    [0389] To address whether specific miRNAs might be participating in cancer through the mis-regulation of oncogenes, we scanned the 3 untranslated regions (UTRs) of 150 well-known oncogenes for sequences with significant homology to the miRNAs identified in our microarray analysis. Potential target sites were selected based on two criteria: [0390] (1) Perfect complementarity between positions 2-9 of the miRNA and the oncogene. This miRNA core sequence has been identified as critical to the activities of miRNAs and the known miRNA target sites have essentially 100% complementarity at this site (Doench et al. 2004). [0391] (2) Overall T.sub.m of the miRNA/mRNA interaction. In addition to the core sequence, overall binding stability between miRNAs and mRNAs has been shown to be an important indicator of miRNA activity (Doench et al., 2004).

    [0392] As seen in Table 8, potential target sites in the 3UTRs of known oncogenes were identified for all of the miRNAs that were observed to be routinely differentially expressed in tumor samples. Interestingly, KRAS2, MYCL1, and CBL have multiple predicted miRNA binding sites which could provide the cooperative miRNA binding that has been implicated as an important factor in miRNA regulation (Doench et al. 2003); Zeng et al., 2003). Many of the genes listed in Table 8 become oncogenic when they are over-expressed, thus it is conceivable that reduced expression of a miRNA could lead to up-regulation of one or more oncogenes and subsequently lead to oncogenesis.

    TABLE-US-00010 TABLE 7 Cancer-related miRNAs and their putative oncogene targets miRNA Predicted Gene Target let-7 RAS let-7 C-MYC miR-21 mutS homolog 2 (MSH2) miR-21 v-ski sarcoma viral oncogene homolog (avian) (SKI) miR-143 breakpoint cluster region (BCR) miR-143 MCF.2 cell line derived transforming sequence (MCF2) miR-143 von Hippel-Lindau tumor suppressor (VHL) miR-143 v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2) miR-143 v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog (KRAS2) miR-143 Cas-Br-M (murine) ecotropic retroviral transforming sequence (CBL) miR-143 Cas-Br-M (murine) ecotropic retroviral transforming sequence (CBL) miR-145 v-myc myelocytomatosis viral related oncogene (MYCN) miR-145 fibroblast growth factor receptor 2 (FGFR2) miR-145 Cas-Br-M (murine) ecotropic retroviral transforming sequence (CBL) miR-188 v-myc myelocytomatosis viral oncogene homolog 1 (MYCL1) miR-200b cadherin 13 (CDH13) miR-200b v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT) miR-219 v-myc myelocytomatosis viral oncogene homolog 1 (MYCL1) miR-219 B-cell CLL/lymphoma 2 (BCL2) miR-219 cadherin 1, type 1, E-cadherin (epithelial) (CDH1) miR-331 vav 1 oncogene (VAV1) miR-331 fibroblast growth factor receptor 1 (FGFR1) miR-331 BCL2-antagonist/killer 1 (BAK1) miR-331 retinoic acid receptor, alpha (RARA) miR-331 v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (SRC)

    Example 13

    Measuring the Effect of miRNAs on Oncogene Expression

    [0393] Confirming miRNA target site predictions can be done in a variety of ways. In Drosophila and C. elegans, genetic approaches have been applied wherein mutations in the miRNA and the putative miRNA target site(s) are made and shown to result in similar phenotypes (Ha et al., 1996; Vella et al., 2004). In mammalian cells, where genetic approaches are far more difficult, reporter constructs have been used to show that the 3 UTRs of putative target genes are regulated in cells at levels that are disproportionate to reporter vector controls that contain mutations in the putative miRNA binding sites (Lewis et al. 2003). In addition, vectors and oligonucleotides have been used to introduce or inhibit miRNAs in cells to determine the effects on endogenous levels of putative target genes (Lewis et al., 2003; Kiriakidou et al. 2004). The latter approach has been undertaken to validate the miRNA target site predictions.

    [0394] Synthetic miRNAs and miRNA inhibitors have been developed that can be transfected into mammalian cells to either introduce miRNAs into cells or inhibit the activity of miRNAs in cells, respectively. See USN 60/627,171, which is hereby incorporated by reference. A synthetic miRNA and a miRNA inhibitor corresponding to let-7b were used to determine if the target site predictions were correct. In these experiments, cultured cells that express undetectable levels of the miRNA were transfected with the synthetic miRNA using siPORT NeoFX Transfection Agent (Ambion). Immunofluorescence assays were used to RAS and C-MYC in the transfected cells. The proteins from both oncogenes were expressed at almost three-fold lower levels in cells transfected with the synthetic miRNA than cells transfected with a Negative Control miRNA (Ambion). In a reciprocal experiment, cells that naturally express high levels of the miRNA were transfected with the let-7 miRNA inhibitor. As expected, the proteins from both oncogenes were higher in cells transfected with the miRNA inhibitor than in cells transfected with the Negative Control inhibitor (Ambion). These results are consistent with the model that the miRNA regulates the expression of the two oncogenes. These data suggest that mis-regulation of a key miRNA could participate in cancer progression by failing to regulate the expression of one or more oncogenes.

    Example 14 miRNAs in Lupus

    [0395] Systemic lupus erythematosus (SLE; Lupus) is a chronic inflammatory auto-immune disease that ultimately leads to immune complex-mediated end-organ failure. It is characterized by an over activation of CD4+ T helper cells and repression of CD8+ T cytotoxic activity, leading to an overproduction of natural antibodies and pathogenic autoantibodies. Recently several histone modifications were reported in peripheral blood mononuclear cells (PBMCs) isolated from lupus patients. Diagnosis of lupus is still frequently incorrect mainly because the symptoms vary so widely and they come and go frequently, and because the disease mimics so many other disorders. Furthermore, diagnosis does not indicate the particular therapy to be used. In the absence of a cure, present-day treatment of lupus is still primarily tailored to symptomatic relief and not to the diagnosis. A diagnostic assay with high specificity and sensitivity would be very important.

    [0396] Samples were analyzed from 16 individuals, 8 with clinically verified lupus and 8 non-lupus patients that were age- and gender-matched with the lupus patients. Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the lupus and normal sample signals were compared to identify differentially expressed miRNAs. Each array experiment included duplicate arrays.

    [0397] Fourteen miRNAs were differentially expressed in all of the lupus samples relative to the matched samples. miR-301, miR-199, miR-95, miR-105, mu-miR-290, miR-215, miR-188, miR-186, miR-211, miR-331, and miR-137 were expressed at 50% or less in the lupus samples than the corresponding normal samples. miR-21, miR-223, and miR-342 were expressed at 50% or greater in the lupus samples than the corresponding normal samples. Several of the miRNAs were differentially expressed by as much as ten-fold between the lupus and normal samples. These miRNAs represent targets for diagnostic assay of therapeutic development.

    Example 15 miRNAs and Prion Diseases

    [0398] Novel infectious particles, termed prions, composed largely and perhaps solely of a single protein, are the likely causative agents of a group of transmissible spongiform encephalopathies that produce lethal decline of cognitive and motor function. Evidence indicates that the responsible protein arrives at a pathogenic state by misfolding from a normal form that has ubiquitous tissue distribution.

    [0399] Using two cell-based prion model systems, the identification of miRNAs that might be associated with the process was pursued. One model system comprises two cell lines, one of which is susceptible to prion formation and one that is not. The second model system involves cells before and after they have been infected with prions. Total RNA from prion-sensitive cells, prion-insensitive cells, and prion-infected cells was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the signal from each of the samples was compared to identify differentially expressed miRNAs.

    [0400] As seen in FIG. 13, ten miRNAs were significantly up- or down-regulated in both prion-sensitive and prion-infected cells relative to prion resistant, uninfected cells. Arrays on multiple biological replicates for both model systems have confirmed these results. Based on their expression profiles, miR-95, 135a, 7, 9, 27a, 130a, 16, 26a, and 24 likely are involved directly or indirectly in prion infection and might represent diagnostic or therapeutic targets for prion disease.

    Example 16

    Stroke-Associated miRNAs

    [0401] Stroke is a major cause of death and permanent disability in humans. They occur when blood flow to a region of the brain is obstructed and may result in death of brain tissue. There are two main types of stroke: ischemic and hemorrhagic. Ischemic stroke is caused by blockage in an artery that supplies blood to the brain, resulting in a deficiency in blood flow (ischemia). Hemorrhagic stroke is caused by the bleeding of ruptured blood vessels (hemorrhage) in the brain. Understanding miRNAs involved in stroke might enhance detection and/or treatment.

    [0402] A stroke model system was used wherein mice are preconditioned by reducing oxygen flow to the brain (Kitagawa 1991). An equivalent set of six mice were used; three were preconditioned and three were untreated. 24 hours after pre-conditioning, the mice were sacrificed. Total RNA from these samples was isolated using the glass fiber filter method described above. The total RNA was fractionated by tube electrophoresis to recover the miRNAs. The miRNAs were fluorescently labeled with Cy3 or Cy5 using the two-step fluorescent labeling process described above. The labeled miRNAs were hybridized to miRNA probes arrayed on glass slides as described above. The signal from the hybridized miRNAs was quantified using a GenePix 4000B Scanner (Axon) and the preconditioned and normal sample signals were compared to identify differentially expressed miRNAs.

    [0403] Analysis of the miRNA profiles of the preconditioned animals (labeled P1, P2, and P4) revealed 10 miRNAs that were expressed at significantly different levels in all three pre-conditioned animals relative to the three non-treated animals (FIG. 14). These miRNAs resulted from ischemic pre-conditioning and represent potential targets for stroke diagnosis, prevention, or treatment.

    Example 17

    Synthetic miRNA Library Screens for miRNAs that Influence Cell Proliferation and Cell Viability in Various Cell Types

    [0404] A hallmark of cancer is uncontrolled cell proliferation; cell proliferation assays are commonly used by researchers to study the influence of genes in oncogenesis. A cell proliferation assay was used in conjunction with the miRNA inhibitor library to identify miRNAs that influence cell proliferation.

    HeLa (human ovarian cancer) and A549 (human lung cancer) cells were transfected in triplicate with 150 synthetic miRNAs using siPORT NeoFX (Ambion) according to the manufacturer's instructions. The 150 are as follows: Let-7a, Let-7b, Let-7c, Let-7d, Let-7g, mir-1, mir-7, mir-9, mir-10a, mir-10b, mir-15a, mir-16, mir-18, mir-19a, mir-17-3p, mir-20, mir-21, mir-22, mir-23a, mir-23b, mir-24, mir-25, mir-26a, mir-27a, mir-28, mir-29a, mir-31, mir-32, mir-30a-3p, mir-34a, mir-92, mir-95, mir-96, mir-98, mir-99a, mir-100, mir-101, mir-103, mir-105, mir-107, mir-108, mir-122, mir-124, mir-125a, mir-125b, mir-126, mir-128, mir-129, mir-132, mir-133A, mir-133B, mir-134, mir-135, mir-136, mir-137, mir-139, mir-140, mir-141, mir-142, mir-143, mir-144, mir-145, mir-146, mir-147, mir-148, mir-149, mir-150, mir-151, mir-152, mir-153, mir-155, mir-181a, mir-182, mir-183, mir-184, mir-186, mir-187, mir-188, mir-190, mir-191, mir-192, mir-193, mir-194, mir-195, mir-196, mir-197, mir-198, mir-199, mir-201, mir-203, mir-204, mir-205, mir-206, mir-207, mir-208, mir-210, mir-211, mir-212, mir-214, mir-215, mir-216, mir-217, mir-218, mir-219, mir-220, mir-221, mir-223, mir-224, mir-299, mir-301, mir-302, mir-320, mir-322, mir-323, mir-325, mir-324-3p, mir-328, mir-330, mir-331, mir-335, mir-337, mir-338, mir-339, mir-340, mir-345, mir-346, mir-367, mir-368, mir-369, mir-370, mir-371, mir-372, mir-373, mir-374, mu-mir-290, mu-mir-291, mu-mir-292-3p, mu-mir-293, mu-mir-294, mu-mir-295, mu-mir-297, mu-mir-298, mu-mir-329, mu-mir-341, mu-mir-344, mu-mir-351, mu-mir-376b, mu-mir-380-3p, mu-mir-409, mu-mir-411, mu-mir-412

    [0405] The synthetic miRNAs were double stranded nucleic acid molecules composed of an active strand and a complementary strand. The active strand contained a sequence that was identical to the corresponding mature miRNA. The complementary strand contained a sequence that was 100% complementary to the relevant region of the mature miRNA sequence, but 1) lacking two nucleotides on its 3 end that were complementary to the mature miRNA sequence (at the 5 end of the active strand) and 2) having a dinucleotide overhang on its 5 end with respect to the active strand. In other words, the two strands were fully complementary to the other's sequence except that each strand has a dinucleotide 5 overhang with respect to the other strand. The same kind of synthetic miRNAs were used for Examples 18-21 as well. Any exceptions are described below. The miRNAs indicated in the tables identify the miRNA that corresponds to the provided synthetic sequence.

    [0406] Jurkat cells (human leukemia cell) and primary human T-cells in triplicate were electroporated with the same set of synthetic miRNAs using siPorter-96 (Ambion) according to the manufacturer's instruction. All cells were analyzed for viable and non-viable cells 72 hours post-transfection using the PCA-96 (Guava) with the Viacount Assay. Viable cell number is the number of live cells in a well at the point of the assay. The numbers provided in the tables below are equal to the average number of viable cells in wells transfected with a particular miRNA divided by the number of viable cells in wells transfected with negative control synthetic miRNAs multiplied by 100 to yield the % Cell Viability of miRNA-transfected cells relative to negative control transfected cells.

    [0407] Significance was assigned based on the average values of the negative control transfecetd samples. miRNAs that were significantly different than the negative controls were qualified as significant based on being at least two standard deviations above or below the negative control data.

    [0408] The sequence of miRNA-325 is 5-ccuaguagguguccaguaagugu-3 (SEQ ID NO:807).

    TABLE-US-00011 TABLE 8 miRNAs That Significantly Reduce Cell Viability of HeLa Cells % Viability std dev mir-345 75 5.9 mir-346 77.8 8.2 mir-193 79.6 14.7 mir-206 79.6 6.5 mir-337 80.8 3.1 mmu-mir-293 82.6 1.7 mir-299 84.0 4.0 mmu-mir-329 84.5 4.5 mmu-mir-409 86 2.8 mmu-mir-292-3p 86.2 2.8 mir-210 86.4 5.1 mmu-mir-344 86.4 5.3 mmu-mir-298 86.7 4.2 mir-208 87.4 4.5 mir-197 87.6 7.5 mir-217 87.9 3.5 mir-1 88.2 9.0 mir-124 88.8 4.2

    TABLE-US-00012 TABLE 9 miRNAs That Significantly Reduce Viable Cell Number of HeLa Cells Total Cell std dev Let-7b 16.2 8.1 Let-7g 22.7 8.2 Let-7c 24.1 7.2 mir-124 24.5 3.4 Let-7a 25.4 1.2 Let-7d 37.3 2.3 mir-337 37.5 16.9 mir-1 38.7 2.2 miR-299 38.9 4.2 mir-34a 40.5 13.3 mmu-mir-292 41.2 8.3 mir-122 41.2 6.5 mir-346 41.9 4.3 mir-101 43.4 6.4 mir-210 47.1 8.4 mir-147 47.7 8.2 mir-98 50.6 2.6 mir-345 51.8 6.8 miR-92 52.4 6.8 miR-96 53.2 0.9 mir-7 54.0 5.3 mir-133b 55.9 3.1 mir-206 56.0 12.4 mmu-mir-297 56.0 5.7 mir-19a 57.2 20.6 mmu-mir-344 57.5 14.1 mir-205 58.9 18.7 mir-208 60.5 11.1

    TABLE-US-00013 TABLE 10 miRNAs That Significantly Increase Viable Cell Number of HeLa Cells Std Total Cell dev mir-32 142.9 25.4 mu-miR-290 143.5 17.6 mir-212 143.5 10.4 mir-92 144.7 16.8 mir-323 147.3 25.9 mir-145 148.1 22.2 mir-324 148.2 9.0 mir-198 152.1 67.8 mir-27a 156.2 13.4 mir-369 158.4 27.3 mir-31 159.3 16.1 mir-335 161.7 20.8 mmu-mir-351 162.3 6.9 mir-370 164.3 4.5 mir-325 169.6 19.8 mir-331 172.5 24.0 mir-139 181.3 11.2

    TABLE-US-00014 TABLE 11 miRNAs That Significantly Reduce Cell Viability of A549 Cells % Viability St dev mir-193 92.4 2.5 mir-224 92.5 1.4 mir-96 92.6 0.1 mir-346 93.9 1.6 mmu-mir-293 94.9 0.7 mir-34a 95 0.2 mir-216 95.1 1.0 mmu-mir-380 95.2 0.8 mir-182 95.6 0.8 mir-301 95.6 1.0 mmu-mir-344 95.8 0.2 mmu-mir-409 95.8 0.6 mir-369 95.9 0.7

    TABLE-US-00015 TABLE 12 miRNAs That Significantly Reduce Viable Cell Number in A549 Cells Cell Number St Dev mir-124 44.3 2.2 mir-16 52.9 1.3 mir-337 54.7 7.0 mir-195 59.3 6.7 mir-34a 60.8 2.1 mir-15a 60.9 3.7 mir-28 61.3 0.8 Let-7g 61.9 0.8 mmu-mir-292 62.2 2.3 mmu-mir-344 62.6 9.1 mir-7 62.9 4.6 mir-193 63.7 3.3 mir-137 63.9 1.3 mir-147 64.8 0.5 mir-29a 67.0 3.8 mir-129 67.2 3.3 mir-22 67.5 3.4 mir-126 68.0 2.6 mir-345 69.2 7.4 mir-192 69.5 5.9 Let-7b 70.2 2.2 Let-7d 70.5 2.7 mir-346 70.9 7.1

    TABLE-US-00016 TABLE 13 miRNAs That Significantly Increase Viable Cell Number in A549 Std Total cell dev mir-373 110.4 7.9 mir-25 111.8 6.0 mmu-mir-294 112.1 5.9 mir-32 120.8 4.3 mir-92 122.4 4.0

    TABLE-US-00017 TABLE 14 miRNAs That Significantly Reduce Cell Viability of Jurkats Cells % Viability St Dev let-7a 20.54 0.70 miR-10b 35.98 2.92 let-7b 48.79 5.08 miR-17-3p 61.55 15.63 miR-30a-3p 64.36 26.60 miR-34a 65.45 20.44 miR-122 65.63 17.80 miR-29a 66.44 7.14 miR-101 67.44 29.56 miR-133a 71.51 17.82 miR-19a 71.77 23.79 miR-32 75.59 11.69 miR-1 75.74 12.92 miR-132 76.32 16.22 miR-28 77.07 16.58 miR-20 77.60 15.23 miR-134 78.96 1.75

    TABLE-US-00018 TABLE 15 miRNAs That Significantly Increase Cell Viability in Jurkat Cells Total cell Std dev miR-181-a 122.77 22.40 miR-9 124.63 9.98 miR-141 126.08 24.03 miR-98 126.24 11.90 miR-10a 126.86 8.93 miR-125b 128.71 3.50 miR-126 130.69 18.20 miR-100 130.77 14.60 miR-23b 132.18 3.50 miR-140 135.73 4.08 miR-155 142.57 22.40 miR-15a 143.01 11.29 miR-129 146.94 9.92 miR-25 150.25 17.85 miR-143 158.74 1.86 miR-26a 166.09 13.65

    TABLE-US-00019 TABLE 16 miRNAs that Significantly Reduce Cell Viability in Primary T-Cells % Viability St Dev miR-184 61.04 12.16 miR-145 68.98 11.23 miR-186 69.64 6.99 miR-139 69.85 0.29 miR-134 71.90 22.42 miR-190 75.59 2.43 miR-144 77.13 4.18 miR-183 77.71 2.86 miR-147 78.09 0.33 miR-140 78.70 5.81 miR-155 79.26 10.68

    TABLE-US-00020 TABLE 17 miRNAs that Significantly Increase Cell Viability of Primary T-Cells % Viability St Dev miR-126 120.81 40.08 miR-10b 121.28 18.86 miR-17 122.46 3.71 miR-10a 124.11 9.46 miR-20 124.75 13.60 let-7c 124.81 4.00 miR-125a 125.66 5.13 miR-15a 129.07 10.96 let-7b 130.11 13.48 let-7a 130.88 16.16 miR-18 131.73 1.75

    [0409] It is interesting to note that the miRNAs that affect one cell type often fail to affect other cell types. This is likely due to the fact that the cellular processes that are active vary between different cell types. This can be vitally important when considering the potential of miRNA-based therapeutics. Abnormal (disease) cells are different from normal cells owing to the fact that different cellular processes are active in the two cell types. Identifying miRNAs that have differential effects on normal and abnormal cells would be ideal since they could be delivered globally and expected to have an effect on only disease cells. When the cell viability data were compared for the leukemia (cancerous T-cell) cells and primary T-cells, it was noted that let-7a, let-7b, and miR-10b all significantly reduce the percentage of viable cells in the leukemia cells while essentially having no effect on the corresponding normal T-cells. These miRNAs are candidates for leukemia drugs.

    Example 18

    Synthetic miRNA Library Screen for miRNAs that Influence ERK Activation

    [0410] In order for cancer cells to proliferate they must subvert both the machinery that controls the cell division cycle and the process of programmed cell death (apoptosis). This is frequently achieved by mutation of specific proto-oncogenes such as Ras or tumor suppressors such as p53. The Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway. Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (Meijer).

    [0411] To identify miRNAs that affect ERK activation, HeLa cells were transfected in a 96-well plate format with 150 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 10.sup.5 cells/mL. 0.5 l of siPort NeoFX in 9.5 l of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 L for each sample). miRNAs were rehydrated with 10 l of diluted siPORT NeoFX. The samples were incubated at 37 C. and then the transfected samples were evaluated 72 hours after transfection.

    [0412] The controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 l of serum-free media (DMEM) to 37 C. was added per well and the cells were incubated for 4 hours at 37 C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 L of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37 C.

    [0413] Media from all wells was removed by aspiration and the cells were immediately fixed in 150 L of 3.7% Formaldehyde in 1PBS for 20 minutes at room temp with no shaking. Fixing solution was removed to an appropriate waste container. The fixed cells were washed three times with 1PBS. The wells were then washed three times with 200 L of 1PBS containing 0.1% Triton X-100 for 5 minutes per wash, with shaking at room temp.

    [0414] Cells were blocked by adding 150 L of Li-COR Odyssey Blocking Buffer to each well. The solution was moved carefully by pipetting down the sides of the wells to avoid detaching the cells. Blocking was for 90 minutes at room temp with moderate shaking on a rotator and the two primary antibodies were added to a tube containing Odyssey Blocking Buffer. The primary antibody was incubated for 2 hours with gentle shaking at room temp (Phosho-ERK (Rabbit, 1:100 dilution; Cell Signaling Technology 9101). Total ERK2 (Mouse; 1:75 dilution; Santa Cruz Biotechnology SC-1647)). The wells were washed three times with 1PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. The fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)). The antibody solutions were mixed well and 50 L of the secondary antibody solution was added to each well. The antibody solution was incubated for 60 minutes with gentle shaking at room temp. The plate was washed three times with 1PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. After a final wash, wash solution was completely removed from wells. The plates were scanned with the Odyssey Infrared Imaging System (700 nm detection for Alexa Fluor 680 antibody and 800 nm detection for IRDye 800CW antibody). Negative control transfected cells yield 100% erk activation (meaning background levels of active erk). Transfecting cells with some of our miRNAs alters the level of active erk.

    TABLE-US-00021 TABLE 18 miRNAs That Activate ERK miR % Activation Std Dev mir-218 312.96 22.91 mir-210 291.74 38.23 mir-217 273.49 26.84 mir-152 265.54 35.82 mir-148 264.38 43.55 mir-223 264.15 39.72 mir-301 261.36 61.77 mir-328 259.48 45.87 mir-206 255.51 55.53 mir-125a 252.46 27.34 mmu-mir-329 243.38 5.43 mir-19a 241.52 31.33 mir-25 238.90 44.94 mmu-mir-294 235.51 24.60 mir-212 231.36 23.61 mmu-mir-295 221.47 14.05 mir-370 220.60 22.88 mir-216 219.17 25.98 mir-96 213.93 57.07 mir-339 213.9 42.25 mir-134 211.15 12.84 mir-372 211.13 5.67 Positive 245.36 10.76 Control

    Example 19

    Screen for miRNAs that Influence Apoptosis

    [0415] Apoptosis is a natural cellular process that helps control cancer by inducing death in cells with oncogenic potential. Many oncogenes function by altering induction of apoptosis. To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.

    [0416] HeLa cells (8000 cells/well of 96 well plate) were transfected in triplicate with more than 150 synthetic miRNAs (described above) (3 pmoles) using Ambion siPORT NeoFX. The media was changed 24 hrs after transfection and cells were processed 72 hrs after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at 80 C. 2) Cells were lysed by adding 40 l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4 C. 3) Add 160 ul ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 uM DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em.

    [0417] Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 l buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 ul of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.

    [0418] miRNAs that affect apoptosis are listed in the table below. These miRNAs apparently regulate pathways that lead to apoptosis. Mis-regulation of these miRNAs could induce cells to undergo apoptosis or might keep the cells from undergoing apoptosis. Introducing or inhibiting these miRNAs in cancer (or other disease) cells that have overcome apoptotic signaling pathways or Parkinson's (or other disease) cells that have prematurely induced apoptosis could be used to treat the diseases.

    TABLE-US-00022 TABLE 19 miRNAs that Significantly Increase the Percentage of Apoptotic Cells Relative change in apoptotic cells St Dev mir-338 773.46 69.82 mir-27a 607.24 150.08 mir-128 594.42 260.06 mir-23a 473.44 208.82 mir-324 442.99 101.03 mir-22 439.13 62.59 mir-181a 409.97 65.14 mmu-mir-293 403.86 53.41 mmu-mir-412 402.27 42.04 mir-196 378.13 28.15 mir-31 373.90 61.39 Let-7d 369.10 88.94 mir-23b 360.68 81.97 mu-miR-290 354.90 46.63 mir-217 347.38 56.49 mir-199 345.75 67.55 mir-24 317.43 62.85 mir-214 312.25 7.38 mir-198 303.24 44.25

    TABLE-US-00023 TABLE 20 miRNAs that Significantly Decrease the Percentage of Apoptotic Cells Relative change in St apoptotic cells Dev mir-105 39.97 8.91 mir-34a 37.75 8.41 mir-96 31.89 13.40 mmu-mir-292 30.72 4.27 mir-126 28.71 4.24 mir-137 12.69 11.80 mir-101 7.50 6.91

    Example 20

    Synthetic miRNA Library Screen for miRNAs that Influence hTert Expression

    [0419] Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al. 2005). The hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity. An RT-PCR based assay for monitoring hTert mRNA expression in telomerase negative cells has been developed and used to identify miRNAs that participate in the regulation of telomerase. The miRNAs that regulate telomerase activity represent intervention points for cancer therapeutics.

    [0420] BJ cells are normal human foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 l of lipofectamine 2000 agent was diluted into 40 l of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 150 synthetic miRNAs (as described above) as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 l (2,600 cells) were added on top of the lipid/miRNA complex. Cells were placed in an incubator and RNA was isolated 72 hours later. RNA was isolated from the cells in each well using RNAqueous-MagMAX96 Total RNA Isolation kit (Cat#1830) standard protocol (lyse cells in wells). Reverse transcription was done using the RETROscript reaction by adding 11 l of total RNA (20-100 ng/l) to 1 ul of random decamers and incubated in 70 C. water bath for 3 minutes then place on ice. Next, 8 ul of the cocktail containing Nuc-free water 3.8 l, 10 Reverse Transcription buffer 2.0 ul, 2.5 mM dNTPs 2.0 ul, RNase Inhibitor Protein (40 U/ul), 0.1 ul MMLV-RT (100 U/l), and incubated at 42 C. for 1 hour, then 92 C. for 10 minutes.

    [0421] Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples. Nuclease-free water, 10 Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50ROX, 18S- or hTert-specific primers (for & rev mix 3 uM), cDNA from the various samples, and Super taq polymerase into a PCR tube. The reaction was heated to 95 C. for 5 minutes and then subjected to 40 cycles of 95 C. for 15 seconds, 60 C. for 30 seconds, 72 C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems). BJ cells ordinarily fail to yield amplification products with the hTert primers. Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA levels to ensure that there were not significantly more cells in the samples that might have contributed to the amount of hTert in the samples.

    [0422] The hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.

    TABLE-US-00024 TABLE 21 hTert Activators mmu- mir-295 mir-92 mir-337 mir-26a mir-224 mir-21 mir-195 mir-16 mir-15a mir-128 mir-125b mir-125a mir-105

    Example 21

    Synthetic miRNA Library Screens for miRNAs that Influence Cell Cycle

    [0423] The adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.

    [0424] The inventors transfected 4,000 BJ cells/well in triplicate with 46 synthetic miRNAs using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

    TABLE-US-00025 TABLE 22 46 Synthetic miRNAs let7a let7a mir1 mir1 mir105 mir125a mir128 mir142 mir145 mir146 mir147 mir150 mir15a mir16 mir186 mir187 mir188 mir191 mir195 mir20 mir206 mir21 mir211 mir223 mir224 mir26a mir320 mir324-3p mir325 mir335 mir337 mir338 mir345 mir371 mir373 mir92 mmu201 mmu207 mmu290 mmu291- 3p mmu294 mmu295 mmu297 mmu322 mmu376b mmu409

    [0425] The 24 hours post-transfection, half of the BJ cells from each well were removed to fresh medium. 72 hrs post-transfection, the cells were fixed with 4% paraformaldehyde at a final concentration of 2%. The fixed cells were stained with propidium iodide (TTP LabTech protocol) and assessed using the TTP LabTech cell scanner. Propidium iodide stains DNA and the relative DNA content in a cell corresponds with its position in the cell cycle. The cell scanner measured propidium iodide staining in each cell and assigned its position in the cell cycle. The percentage of cells in each stage of cell cycle was calculated and compared to cells transfected with negative control synthetic miRNAs. The relative change in cells in each stage was calculated for each miRNA that was used. Those synthetic miRNAs that induced a significant shift toward or away from a specific stage of cell cycle are listed below. These represent miRNAs that regulate key points in the cell cycle and offer key intervention points for cancer-related therapeutic development.

    TABLE-US-00026 TABLE 23 miRNAs that significantly reduce the percentage of BJ cells in G1 phase of the cell cycle % Diff in Cells St. miRNA in G1 Dev. mir-21 54.4 4.2 mir-20 63.6 9.3 mir-1 65.3 9.5 mir-206 66.8 9.0 mir-373 72.6 5.7 mir-26a 78.0 4.0

    TABLE-US-00027 TABLE 24 miRNAs that significantly increase the percentage of BJ cells in G1 phase of the cell cycle % Diff in Cells St. miRNA in G1 Dev. rno-mir-325 121.7 5.3 mmu-409 123.2 13.7 mir-324 123.7 4.9 mir-195 125.1 2.5 mmu-376b 126.5 3.1 mir-142 127.0 13.0 mir-371 128.9 2.8 let-7a 131.5 4.5 mir-146 141.5 7.7 mir-128 143.0 2.4

    TABLE-US-00028 TABLE 25 miRNAs that significantly reduce the percentage of BJ cells in S phase of the cell cycle % Diff in St. miRNA Cells in S Dev. mir-128 55.5 3.8 let-7a 57.6 8.7 mir-142 59.5 24.7 mir-146 63.5 16.8 mmu-297 65.0 14.1 mir-337 65.3 11.3 mir-195 65.6 0.1 mmu-376b 69.1 11.6 mir-324 72.2 9.4 mir-187 72.3 10.9 mir-186 72.8 6.1

    TABLE-US-00029 TABLE 26 miRNAs that significantly increase the percentage of BJ cells in S phase of the cell cycle % Diff in Cells St. miRNA in S Dev. mir-92 132.0 14.7 mir-15a 134.8 13.9 mir-191 135.9 29.1 mir-26a 136.0 7.6 mir-20 139.7 17.6 mmu-290 141.0 11.7 let-7a 141.1 19.9 mir-345 143.3 45.8 mir-16 150.1 24.8 mir-224 150.6 9.8

    TABLE-US-00030 TABLE 27 miRNAs that significantly reduce the percentage of BJ cells in G2/M phase of the cell cycle % Diff in Cells St. miRNA in G2/M Dev. mir-147 51.2 6.1 mir-371 52.8 2.7 mir-146 57.2 5.3 mir-195 58.9 4.4 mir-128 65.4 2.7 mir-15a 67.4 13.7 let-7a 69.1 2.8

    TABLE-US-00031 TABLE 28 miRNAs that significantly increase the percentage of BJ cells in G2/M phase of the cell cycle % Diff in Cells St. miRNA in G2/M Dev. mir-26a 130.2 5.8 mir-187 132.0 4.3 mir-145 136.8 13.7 mir-373 137.9 5.2 mir-20 143.0 10.6 mir-21 160.3 7.1

    TABLE-US-00032 TABLE 29 miRNAs that significantly increase the percentage of BJ cells with greater than 2X amount of DNA % Diff in Cells St. miRNA w/>2X DNA Dev. mir-20 157.9 23.4 mir-1 161.9 13.6 mir-345 176.1 17.4 mir-373 177.9 32.7 mir-337 195.0 52.1 mir-21 209.4 45.7

    Example 22

    Synthetic miRNA Library Screen for miRNAs that Influence Cell Proliferation

    [0426] Cell proliferation assays were used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.

    [0427] Cervical (HeLa), lung (A549, CRL-5826, and HTB-57), breast (MCF12A and BT549), prostate (22Rv1), T-cells (Jurkat and primary normal), and skin (TE354T, TE353SK, and BJ) cells were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. With the exceptions of Jurkats and Primary T-cells, each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORT NeoFX (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. The Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs. The media was changed 24 hrs after transfection. 72 hours post-transfection, cell number was estimated by one of three methods: [0428] (1) Alamar blue was added to each well and the 96-well plates were analyzed using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well. [0429] (2) ViaCount Flex Reagent (Guava), a dye that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions. [0430] (3) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well and the total number of cells in the well was estimated by counting unique sites of stained DNA using the TTP LabTech Cell Scanner according to the manufacturer's instructions.
    The impact of each miRNA on cell proliferation was assessed by dividing the cell number reading of each well by the average cell number reading for wells transfected with a negative control (NC) miRNA.

    [0431] Presented in FIG. 15A-C are synthetic miRNAs that significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.

    [0432] Approximately 10% of the miRNAs significantly reduced cell proliferation for at least four different cell types. These miRNAs (presented in ranked order in the table below) are provided below and can be implemented in methods and compositions of the invention.

    TABLE-US-00033 TABLE 30 Common Anti-Proliferation miRNAs miRNA # Positives miR-124 7 miR-16 6 miR-101 6 miR-126 6 miR-147 6 miR-15a 5 miR-96 5 miR-105 5 miR-142 5 miR-215 5 miR-346 4 miR-206 4 miR-192 4 miR-194 4

    [0433] Among the cells that were used in the synthetic miRNA library screens are matched pairs of cancer and non-cancer cells from breast, skin, and T-cell. Interestingly, many synthetic miRNAs differentially affected proliferation in the cell pairs (see table below).

    TABLE-US-00034 TABLE 31 Breast Cancer Non-Cancer % St % St miRNA % NC Dev % NC Dev mir-201 79 14 103 17 mir-192 81 3 95 17 mir-92 85 11 104 24 Skin Cancer Normal % St % St miRNA % NC Dev % NC Dev mir-154 51 5 93 10 mir-195 58 3 87 5 mu-mir-376b 65 3 99 8 mir-201 67 8 106 4 mir-26a 69 12 97 17 mir-193 69 4 105 10 T-Cell Leukemia Normal % St % St % NC Dev % NC Dev let-7a 21 1 137 15 let-7b 50 5 136 13 miR-101 69 30 95 5 miR-10b 37 3 115 18 miR-122 67 18 104 18 miR-17-3p 63 16 116 4 miR-29a 68 7 111 8 miR-30a-3p 66 27 97 18 miR-34a 67 21 100 1
    Presented in FIG. 16 are synthetic miRNAs that significantly increase the proliferation of the various cell types that were analyzed.

    Example 23

    miRNA Inhibitor Library Screens Identify miRNAs that Influence Cell Proliferation

    [0434] A cell proliferation assay was used in conjunction with our synthetic miRNA library to identify miRNAs that influence cell proliferation in a broad range of cells, including those from lung, breast, prostate, skin, cervix, T-cell, and foreskin tissues.

    [0435] Breast (MCF12A), prostate (22Rv1), lung (A549), and skin (TE354T) cells were transfected in triplicate with each of the more than 150 miRNA inhibitors in our library. Each cell type was transfected with 10 picomoles of each of the miRNA inhibitors in the library using siPORT NeoFX (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. 72 hours post-transfection, cell number was estimated by one of three methods: [0436] (1) Alamar blue was added to each well and the 96-well plates were analyzed using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well. [0437] (2) ViaCount Flex Reagent (Guava), a dye that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions. [0438] (3) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well and the total number of cells in the well was estimated by counting unique sites of stained DNA using the TTP LabTech Cell Scanner according to the manufacturer's instructions.

    [0439] The impact of each miRNA inhibitor on cell proliferation was assessed by dividing the cell number reading of each well by the average cell number reading for wells transfected with a negative control (NC) miRNA.

    [0440] Presented in FIG. 17 are miRNAs whose inhibition significantly reduced the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.

    [0441] Presented in FIG. 18 are miRNA inhibitors that significantly increase the proliferation of the various cell types that were analyzed. These miRNAs represent molecules that could be used for therapeutics, diagnostics, creating cell lines with interesting research properties, and inducing differentiation.

    Example 24

    Synthetic miRNA Library Screen for miRNAs that Influence Cell Viability

    [0442] The basis for most human diseases is the subversion of one or more cells to function in ways that are outside what they normally do. For instance, cancer initiates with the immortalization and transformation of a single cell which then divides repeatedly to form a tumor. Compounds that reduce the viability of disease cells are used routinely to treat patients with cancer and other diseases.

    [0443] Cervical (HeLa), lung (A549), and T-cells (Jurkat and primary normal) were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. With the exceptions of Jurkats and Primary T-cells, each cell type was transfected with 5 picomoles of each of the miRNAs in the synthetic miRNA library using siPORT NeoFX (Ambion) at a plating density of approximately 8000 cells/well of 96 well plate. The Jurkats and primary T-cells were mixed at a rate of approximately 50,000 cells/well with 500 picomoles of each of the synthetic miRNAs. For the HeLa and A549 cells, the media was changed 24 hrs after transfection. 72 hours post-transfection, cell viability was estimated by one of two methods: [0444] (1) ViaCount Flex Reagent (Guava), which includes a dye that can only enter dead cells and that fluoresces when it interacts with DNA, was added to each well and fluorescence was quantified using the Guava PCA-96 according to the manufacturer's instructions. The percentage of viable cells was measured by dividing the number of non-dead and non-apoptotic cells in the sample by the total number of cells in the well and multiplying by 100. [0445] (2) Propidium iodide, a dye that fluoresces when it interacts with DNA, was added to each well. Each cell was analyzed using the TTP LabTech Cell Scanner according to the manufacturer's instructions to detect cells with staining patterns consistent with cell death or apoptosis. The percentage of viable cells was measured by dividing the number of non-dead and non-apoptotic cells in the sample by the total number of cells in the well and multiplying by 100.

    [0446] Presented in FIG. 19 are synthetic miRNAs that significantly decrease or increase viability in the various cell types that were analyzed. A comparison of the viability of jurkat and primary T-cells, which represent the leukemic and normal forms of T-cells, let-7, miR-10, miR-101, miR-17-3p, miR-19, and miR-34a severely reduced the viability of the leukemia cells without adversely affecting the normal T-cells.

    Example 25

    Synthetic miRNA Library Screen for miRNAs that Influence Apoptosis

    [0447] To identify miRNAs that participate in apoptosis, an apoptosis assay was used with the miRNA inhibitor library.

    [0448] Approximately 8000 cervical (HeLa), prostate (22Rv1), T-cell (Jurkat), and skin (TE354T) cells per well were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library using siPORT NeoFX (Ambion). Media was changed after 24 hrs and cells were visually inspected under a microscope to qualitatively inspect cell death 72 hours after transfection. The cells were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at 80 C. 2) Cells were lysed by adding 40 l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4 C. 3) Add 160 l ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 M DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em. Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 l buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 l of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.

    [0449] The impact of each miRNA on apoptosis was assessed by dividing the caspase 3 reading of each well by the average caspase 3 reading for wells transfected with a negative control (NC) miRNA.

    [0450] As seen in FIG. 20, many different miRNAs were able to increase or decrease apoptosis in the four cell types that were analyzed. A few miRNAs (miR-126, miR-26a, miR-1, miR-149, and let-7g) affected apoptosis in multiple cell types suggesting that they regulate apoptosis via genes that are common in multiple cell types.

    Example 26

    Synthetic miRNA Library Screen for miRNAs that Induce Transformation

    [0451] Transformation is necessary for tumor formation as it overcomes the cell's natural response to stop dividing when placed in a crowded environment. To identify miRNAs that participate in transformation, a transformation assay featuring NIH3T3 cells was used with the synthetic miRNA library. NIH 3T3 cells are used in transformation assays as they lack the capacity to form colonies when plated in soft agar. Modulation of cell processes that inhibit transformation can be readily detected because they induce NIH3T3 cells to begin forming colonies when plated in soft agar.

    [0452] Approximately 8000 NIH 3T3 cells were transfected in duplicate with each of the more than 150 synthetic miRNAs in our library using siPORT NeoFX (Ambion). Media was changed after 24 hrs and the cells were transferred to 24-well dishes containing soft agar. The soft agar limits mobility and ensures that sister cells must remain in contact following cell division. Close contact with other cells typically induces the NIH 3T3 cells to stop dividing. The total number of cells in each well was measured by taking an absorbance reading at 495 nm. The absorbance reading for each well was divided by the average absorbance reading for cells transfected with negative control miRNAs and multiplied by 100 to get the percent change in transformation. An initial screen revealed miR-10, miR-23, miR-24, miR-198, miR-192, and miR-199 as miRNAs that increased transformation relative to cells transfected with negative control. A repeat of the experiment with the initial candidates yielded the following hit as shown below:

    TABLE-US-00035 TABLE 32 miRNA % NC % SD 198 103 2.07 192 108 5.7 199 113 5.59

    Example 27

    MiRNAs that Affect the Efficacy of Therapeutic Compounds

    [0453] Many compounds have been tested in clinical trials for their capacity to positively affect the outcome of patients. In some cases, these compounds meet the standards set for by the FDA and they become therapeutics. Unfortunately, very few therapeutics are 100% effective. Enhancing the activities of therapeutic compounds provides a significant opportunity within the medical industry. The two most common methods that are used to enhance therapeutics are modifying the chemical structure of the compounds or using multiple therapeutic compounds simultaneously. Whether it would be beneficial to introduce miRNAs in advance of adding compounds that are known to significantly reduce the viability of cancer cells was evaluated. One of the anti-cancer compounds that was introduced was TRAIL, a compound that binds at least two different receptors and activates the apoptosis pathway to induce cell death primarily in cancer cells. The second compound that was tested in combination with synthetic miRNAs was etoposide, a topoisomerase II inhibitor that activates the apoptosis pathway of cancer and normal cells alike by reducing the repair of DNA damage within the cells.

    [0454] Approximately 8000 cervical (HeLa) and lung (A549, HTB-57, and CRL-5826) cells per well were transfected in triplicate with synthetic miRNAs from our library using siPORT NeoFX (Ambion). Media was changed after 24 hrs and etoposide and TRAIL were introduced at a final concentration of approximately 25 M after 48 hours. The cells were visually inspected under a microscope to qualitatively inspect cell death 64 hours after transfection.

    [0455] The cells treated with etoposide were measured for apoptosis by measuring caspase 3 activity as follows: 1) Cells were washed once with PBS and frozen at 80 C. 2) Cells were lysed by adding 40 l of cold lysis buffer (50 mM HEPES pH 7.2, 40 mM NaCl, 0.5% NP40, 0.5 mM EDTA) to the wells and incubated for 20 min at 4 C. 3) Add 160 l ICE buffer (50 mM HEPES pH 7.4, 0.1% CHAPS, 0.1 mM EDTA, 10% sucrose)+5 mM DTT containing 20 M DEVDafc substrate. 4) Measure fluorescence increase in one hour at 400 ex, 505 em. Samples were also analyzed for cell number using a general esterase assay to normalize the caspase 3 results. FDA substrate (0.4 mg/ml fluorescein diacetate (FDA) in acetonitrile) was diluted 1:19 into dilution buffer (40 mM TrisCl pH 7.5, 20 mM NaCl, 0.5% NP-40, 0.02 mg/ml final conc). 40 l buffer (40 mM TrisCl pH 7.5, 0.5% NP-40) was added to each sample well. Samples were incubated 10 min on ice. 160 l of diluted FDA substrate was added to each well. Fluorescence was measured for 30 min at 37 deg (ex=488, em=529). The slope of fluorescence increase over time is a function of the cell number in the plate.

    [0456] The cells treated with TRAIL were assessed for cell viability by adding alamar blue each well and analyzing fluorescence using a plate reader. Alamar blue is a substrate for a metabolic enzyme in cells and the reaction product is fluorescent. The fluorescence in each well correlates with the total number of cells in each well.

    [0457] The effect of each miRNA on the treatments was measured by dividing the caspase 3 or alamar blue reading of the cells transfected with miRNAs and treated with TRAIL or etoposide by the same readings for cells that were only transfected with the miRNAs. The change in caspase 3 activity or alamar blue staining for each miRNA was then divided by the differences observed for two negative control miRNAs and multiplied by 100 to calculate the relative effect induced by the combination of each miRNA and the therapeutic compound. These values are listed as % NC in Figure G.

    [0458] As shown in FIG. 21, a number of miRNAs significantly increased the capacity of the two therapeutic compounds to induce cell death in the cancer cells that were treated. Interestingly, mir-292-3p, mir-132, mir-124, and mir-28 all worked extremely well in combination with both TRAIL and etoposide.

    Example 28

    Synthetic miRNA Library Screen for miRNAs that Affect Cell Cycle

    [0459] The adult human body consists of about 50-100 trillion cells. Each day, several billion of these cells divide in two to replace the billions of cells that die and are removed. In the course of an average lifetime, this adds up to an astronomical number of cell divisions, most of which go perfectly well. Errors do occur, however, and if they are not corrected they may lead to cancer. Cell growth and division are normally controlled by an intricate system of checks and balances. But occasionally a cell will start to proliferate wildly, dividing again and again and defying all normal restraints on its growth. That is the beginning of most common forms of cancer.

    [0460] Approximately 8000 cervical (HeLa) and 4000 skin (BJ) cells per well were transfected in triplicate with each of the more than 150 synthetic miRNAs in our library. HeLa cells were transfected using siPORT NeoFX (Ambion) and BJ cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 24 hours post-transfection, half of the cells from each well were removed to fresh medium. 72 hrs post-transfection, the cells were fixed with 4% paraformaldehyde at a final concentration of 2%. The fixed cells were stained with propidium iodide (TTP LabTech protocol) and assessed using the TTP LabTech cell scanner. Propidium iodide stains DNA and the relative DNA content in a cell corresponds with its position in the cell cycle. The cell scanner measured propidium iodide staining in each cell and assigned its position in the cell cycle. The percentage of cells in each stage of cell cycle was calculated and compared to cells transfected with negative control synthetic miRNAs. The relative change in cells in each stage was calculated for each miRNA that was used. Those synthetic miRNAs that induced a significant shift toward or away from a specific stage of cell cycle are listed below. These represent miRNAs that regulate key points in the cell cycle and offer key intervention points for cancer-related therapeutic development.

    [0461] As seen in FIG. 22, many different miRNAs significantly altered the percentage of cells in the various stages of cell cycle in the two cell types that were analyzed.

    Example 29

    Synthetic miRNA Library Screen for miRNAs that Influence ERK Activity

    [0462] In order for cancer cells to proliferate they must subvert both the machinery that controls the cell division cycle and the process of programmed cell death (apoptosis). This is frequently achieved by mutation of specific proto-oncogenes such as Ras or tumor suppressors such as p53. The Ras-family of membrane associated GTPases transmit signals into the interior of the cell by the activation of a number of cytosolic signal transduction pathways such as the Raf>MEK>ERK MAP kinase signaling pathway. Disregulation of the Ras/Raf/MEK/ERK pathway plays a major role in cancer pathogenesis (reviewed in Meijer et al.).

    [0463] To identify miRNAs that affect ERK activation, HeLa cells were transfected in a 96-well plate format with 160 different synthetic miRNAs. Prior to transfection, the HeLa cells were trypsinized to remove adherent cells and diluted in normal growth medium to 10.sup.5 cells/mL. 0.5 l of siPort NeoFX in 9.5 l of Optimem I medium was added to the cells and incubated for 10 minutes at room temp (10 L for each sample). miRNAs were rehydrated with 10 l of diluted siPORT NeoFX. The samples were incubated at 37 C. and then the transfected samples were evaluated 72 hours after transfection.

    [0464] The controls for ERK activation were performed by depriving the wells of a phosphate source for detection of ERK phosphorylation. 100 l of serum-free media (DMEM) to 37 C. was added per well and the cells were incubated for 4 hours at 37 C. to attain basal phosphorylation levels. For the positive control wells, serum-free media was aspirated from wells and 100 L of 100 ng/mL EGF was added before incubating the cells for 7.5 minutes at 37 C.

    [0465] Media from all wells was removed by aspiration and the cells were immediately fixed in 150 L of 3.7% Formaldehyde in 1PBS for 20 minutes at room temp with no shaking. Fixing solution was removed to an appropriate waste container. The fixed cells were washed three times with 1PBS. The wells were then washed three times with 200 L of 1PBS containing 0.1% Triton X-100 for 5 minutes per wash, with shaking at room temp.

    [0466] Cells were blocked by adding 150 L of Li-COR Odyssey Blocking Buffer to each well. The solution was moved carefully by pipetting down the sides of the wells to avoid detaching the cells. Blocking was for 90 minutes at room temp with moderate shaking on a rotator and the two primary antibodies were added to a tube containing Odyssey Blocking Buffer. The primary antibody was incubated for 2 hours with gentle shaking at room temp (Phosho-ERK (Rabbit, 1:100 dilution; Cell Signaling Technology 9101). Total ERK2 (Mouse; 1:75 dilution; Santa Cruz Biotechnology SC-1647)). The wells were washed three times with 1PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. The fluorescently labeled secondary antibody was diluted in Odyssey Blocking Buffer (Goat anti-rabbit Alexa Fluor 680 (1:200 dilution; Molecular Probes) Goat anti-mouse IRDye 800CW (1:800 diution; Rockland Immunochemicals)). The antibody solutions were mixed well and 50 L of the secondary antibody solution was added to each well. The antibody solution was incubated for 60 minutes with gentle shaking at room temp. The plate was washed three times with 1PBS+0.1% Tween-20 for 5 minutes at room temp with gentle shaking, using a generous amount of buffer. After a final wash, wash solution was completely removed from wells. The plates were scanned with the Odyssey Infrared Imaging System (700 nm detection for Alexa Fluor 680 antibody and 800 nm detection for IRDye 800CW antibody).

    TABLE-US-00036 TABLE 33 miRNAs That Activate ERK miRNA % NC % StDev let-7 250 25 mir-125a 252 27 mir-134 211 13 mir-148 264 44 mir-152 266 36 mir-19a 242 31 mir-206 256 56 mir-207 224 3 mir-210 292 38 mir-212 231 24 mir-216 219 26 mir-217 273 27 mir-218 313 23 mir-223 264 40 mir-25 239 45 mir-294 236 25 mir-295 221 14 mir-301 261 62 mir-328 259 46 mir-329 243 5 mir-339 214 42 mir-370 221 23 mir-372 211 6 mir-96 214 57 Positive Control 245 11

    Example 30

    Synthetic miRNA Library Screen for miRNAs that Influence hTert Expression

    [0467] Telomerase is a complex of proteins and RNA that maintains the ends of chromosomes by appending telomeres. With rare exceptions, terminally differentiated cells lack active telomerase. One of the exceptions is cancer cells. More than 90% of human cancer samples have active telomerase (reviewed in Dong et al., 2005). The hTert gene encodes the catalytic domain of telomerase. The expression of hTert correlates with telomerase activity in cells making it a good surrogate for telomerase activity. We have developed and used an RT-PCR based assay for monitoring hTert mRNA expression in telomerase negative cells to identify miRNAs that participate in the regulation of telomerase. The miRNAs that regulate telomerase activity represent intervention points for cancer therapeutics.

    [0468] BJ cells are normal foreskin fibroblasts that lack hTert mRNA and telomerase activity. BJ cells were trypsinized and diluted to 13,000 cells/ml in normal growth media. 0.3 l of lipofectamine 2000 agent was diluted into 40 l of OPTI-MEM and incubated for five minutes. The diluted transfection reagent was added to the wells of 96-well plates that contained 151 synthetic miRNAs as well as two different negative control synthetic miRNAs. Each well housed a different synthetic miRNA. The synthetic miRNAs and transfection agent were incubated for 15 minutes at room temperature and then 200 l (2,600 cells) were added on top of the lipid/miRNA complex. Cells were placed in an incubator and RNA was isolated 72 hours later. RNA was isolated from the cells in each well using RNAqueous-MagMAX96 Total RNA Isolation kit (Cat#1830) standard protocol (lyse cells in wells). Reverse transcription was done using the RETROscript reaction by adding 11 ul of total RNA (20-100 ng/l) to 1 l of random decamers and incubated in 70 C. water bath for 3 minutes then place on ice. Next, 8 l of the cocktail containing Nuc-free water 3.8 l, 10 Reverse Transcription buffer 2.0 l, 2.5 mM dNTPs 2.0 l, RNase Inhibitor Protein (40 U/l), 0.1 l MMLV-RT (100 U/l), and incubated at 42 C. for 1 hour, then 92 C. for 10 minutes.

    [0469] Real time PCR reactions were assembled to quantify hTert mRNA and 18S rRNA in each of the samples. Nuclease-free water, 10 Complete PCR buffer/SYBR, 25 mM MgCl2, 2.5 mM dNTPs, 50ROX, 18S- or hTert-specific primers (for & rev mix 3 M), cDNA from the various samples, and Super taq polymerase were placed into a PCR tube. The reaction was heated to 95 C. for 5 minutes and then subjected to 40 cycles of 95 C. for 15 seconds, 60 C. for 30 seconds, 72 C. for 30 seconds. The amplification products were monitored using the ABI 7600 (Applied Biosystems). BJ cells ordinarily fail to yield amplification products with the hTert primers. Those miRNA-transfected samples that yielded a hTert PCR product were also analyzed for 18S rRNA levels to ensure that there were not significantly more cells in the samples that might have contributed to the amount of hTert in the samples.

    [0470] The hTert mRNA was detected in duplicate transfections of each of the miRNAs listed below. These miRNAs presumably affect pathways that regulate the expression of the hTert gene. Over-expression of any of these miRNAs might contribute to cancer by activating telomerase. Regulating the activities of these miRNAs in cancer cells could limit their transformation and overcome oncogenesis.

    TABLE-US-00037 TABLE 34 hTert miRNA Activators Log(2) hTert miRNA Expression mir-147 3.14 mir-195 4.25 miR-21 1.55 mir-24 4.68 mir-26a 4.35 mir-301 4.14 mir-368 5.30 mir-371 2.43

    [0471] The telomerase activity screen was repeated using a series of siRNAs targeting kinases, phosphatases, GPCRs, transcription factors, and assorted other genes. Targeting the genes below with siRNAs resulted in increased hTert expression. Interestingly, many of these genes are predicted to be targets for the miRNAs that we found to be hTert regulators (see table below).

    TABLE-US-00038 TABLE 35 hTert Gene Activators Log(2) hTert Gene Expression ACOX1 3.44 AKT1 1.80 APAF1 3.40 COX-5B 2.78 COX6 2.28 COX7B 3.95 CPOX 4.66 DUOX2 3.80 GPX1 1.85 GPX2 2.56 GPX4 3.17 LPO 3.37 MAPK1 3.07 MAPK4 3.61 MTCO1 1.58 NOX3 2.30 NOX5 2.54 PAOX 1.72 PPOX 2.09 PRKCA 2.24 PRKCD 4.39 TNFRSF6 2.25

    Example 31

    Effect of miRNA Primary Sequence on Function

    [0472] Many miRNAs appear to be very closely related to others based on their primary sequences. For instance, let-7a is a member of the let-7 gene family, which includes 7 unique genes within the human genome. The let-7 genes encode miRNAs that vary by as little as a single nucleotide and as many as four nucleotides. In our synthetic miRNA and miRNA inhibitor libraries, we have five different human let-7 miRNAs. These miRNAs have been used in many different cell types in screens designed to identify miRNAs involved in a variety of different cellular processes. In many of the screens, the various let-7 miRNAs generate similar phenotypes. In some screens, all of the let-7 family members yield similar responses. In contrast, there are some screens wherein the various let-7 family miRNAs yield significantly different results (FIG. 23).

    Example 32

    Synthetic miRNA Library Screen for miRNAs that Influence Inflammation

    [0473] Inflammation is the body's natural protective response to an injury or infection. It is designed to hyper-stimulate biological pathways that initiate tissue repair or attack invading pathogens. This response is a delicate balance of both pro- and anti-inflammatory genes and their proteins. If the inflammatory response is maintained too long it can lead to tissue destruction, organ failure or inflammatory diseases such as Rheumatoid arthritis, Psoriasis, Asthma, Inflammatory bowel disease (Crohn's disease and related conditions), Multiple Sclerosis, coronary obstructive pulmonary disease (COPD), Allergic rhinitis (hay fever), and Cardiovascular disease.

    [0474] Stat3 is the subject of intense scientific investigation, because it's known to be an important transcription factor that turns on genes required for the cell division, induction and suppression of apoptosis, and cell motility. Many STAT3 target genes are known, including those encoding the anti-apoptotic proteins Bcl-xl, Mcl-1, and Bcl-2, the proliferation-associated proteins Cyclin D1 and Myc, and the pro-angiogenic factor VEGF. The inflammatory disease psoriasis is characterized by lesions, which contain epidermal keratinocytes that express high levels of activated Stat3. Stat3 has also recently been discovered to play an important role as an anti-inflammatory regulator. In normal mice, the immune system is initially upregulated in response to bacterial protein challenge creating systemic inflammation followed by down regulation of the initiating factors. Mice with a deletional mutation for Stat3-beta lacked the ability to down regulate the initial inflammatory reaction after bacterial protein challenge which lead to irreversible damage to the animals' own tissues and finally to animal death.

    [0475] A stat3 response assay was used to identify miRNAs that regulate cellular inflammatory response. The stable Stat3-luciferase reporter cell line from Panomics, which contains a chromosomal integration of a luciferase reporter construct regulated by 3 copies of the Stat1 response element was used for this purpose. The chemical agent Phorbol-12-myristate 13 acetate (PMA) is known to induce an inflammatory response in exposed cells and was used to stimulate inflammation in this experiment. These cells were transfected in triplicate with each of the more than 206 synthetic miRNAs in our library using siPORT NeoFX (Ambion) at a plating density of approximately 6000 cells/well of 96 well plate. The media was changed 24 h post transfection and exposed to 100 nM PMA for 6 hours starting at 67 hours post transfection. The cells were assayed for changes in total cell number by alamarBlue as previously described and finally harvested at 72 hours post initial transfection. A luciferase assay was performed on all sample lysates to measure Stat3 responsiveness to the procedure. The data was normalized to total cell number using the alamar Blue data and compared to cells transfected with a negative control miRNA that underwent the same procedure.

    TABLE-US-00039 TABLE 36 The following miRNA were able to reduce the ability of PMA to stimulate Stat3. % of NC % STDEV mir-93 34 74 mir-100 13 10 mir-134 50 18 mir-99a 38 96 mir-103 38 40 mir-128 49 115 mir-129 44 112 mir-181b 11 21 mir-193 42 92 mir-197 36 78 mir-212 42 92 mir-218 38 84 mir-219 39 86 mir-302 40 87 mir-323 22 49 mir-324-3p 29 63 mir-325 29 63 mir-330 21 47 mir-331 39 86 mir-340 34 75 mmu-mir-350 11 22 mir-425 24 49 mir-491 25 49 mir-518f 26 52 mir-520a* 28 55

    [0476] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods, described herein without departing from the concept, spirit, and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

    REFERENCES

    [0477] The following references are specifically incorporated by reference to the extent they relate to topics and subject matter discussed herein. [0478] U.S. Pat. No. 4,337,063 [0479] U.S. Pat. No. 4,404,289 [0480] U.S. Pat. No. 4,405,711 [0481] U.S. Pat. No. 4,659,774 [0482] U.S. Pat. No. 4,682,195 [0483] U.S. Pat. No. 4,683,202 [0484] U.S. Pat. No. 4,684,611 [0485] U.S. Pat. No. 4,704,362 [0486] U.S. Pat. No. 4,816,571 [0487] U.S. Pat. No. 4,828,979 [0488] U.S. Pat. No. 4,849,513 [0489] U.S. Pat. No. 4,910,300 [0490] U.S. Pat. No. 4,952,500 [0491] U.S. Pat. No. 4,959,463 [0492] U.S. Pat. No. 5,141,813 [0493] U.S. Pat. No. 5,143,854 [0494] U.S. Pat. No. 5,202,231 [0495] U.S. Pat. No. 5,214,136 [0496] U.S. Pat. No. 5,221,619 [0497] U.S. Pat. No. 5,223,618 [0498] U.S. Pat. No. 5,242,974 [0499] U.S. Pat. No. 5,264,566 [0500] U.S. Pat. No. 5,268,486 [0501] U.S. Pat. No. 5,288,644 [0502] U.S. Pat. No. 5,302,523 [0503] U.S. Pat. No. 5,322,783 [0504] U.S. Pat. No. 5,324,633 [0505] U.S. Pat. No. 5,378,825 [0506] U.S. Pat. No. 5,384,253 [0507] U.S. Pat. No. 5,384,261 [0508] U.S. Pat. No. 5,405,783 [0509] U.S. Pat. No. 5,412,087 [0510] U.S. Pat. No. 5,424,186 [0511] U.S. Pat. No. 5,428,148 [0512] U.S. Pat. No. 5,429,807 [0513] U.S. Pat. No. 5,432,049 [0514] U.S. Pat. No. 5,436,327 [0515] U.S. Pat. No. 5,445,934 [0516] U.S. Pat. No. 5,446,137 [0517] U.S. Pat. No. 5,464,765 [0518] U.S. Pat. No. 5,466,786 [0519] U.S. Pat. No. 5,468,613 [0520] U.S. Pat. No. 5,470,710 [0521] U.S. Pat. No. 5,470,967 [0522] U.S. Pat. No. 5,472,672 [0523] U.S. Pat. No. 5,480,980 [0524] U.S. Pat. No. 5,492,806 [0525] U.S. Pat. No. 5,503,980 [0526] U.S. Pat. No. 5,510,270 [0527] U.S. Pat. No. 5,525,464 [0528] U.S. Pat. No. 5,525,464 [0529] U.S. Pat. No. 5,527,681 [0530] U.S. Pat. No. 5,529,756 [0531] U.S. Pat. No. 5,532,128 [0532] U.S. Pat. No. 5,538,877 [0533] U.S. Pat. No. 5,538,880 [0534] U.S. Pat. No. 5,545,531 [0535] U.S. Pat. No. 5,547,839 [0536] U.S. Pat. No. 5,550,318 [0537] U.S. Pat. No. 5,554,501 [0538] U.S. Pat. No. 5,554,744 [0539] U.S. Pat. No. 5,556,752 [0540] U.S. Pat. No. 5,561,071 [0541] U.S. Pat. No. 5,563,055 [0542] U.S. Pat. No. 5,563,055 [0543] U.S. Pat. No. 5,571,639 [0544] U.S. Pat. No. 5,573,913 [0545] U.S. Pat. No. 5,574,146 [0546] U.S. Pat. No. 5,580,726 [0547] U.S. Pat. No. 5,580,732 [0548] U.S. Pat. No. 5,580,859 [0549] U.S. Pat. No. 5,583,013 [0550] U.S. Pat. No. 5,589,466 [0551] U.S. Pat. No. 5,591,616 [0552] U.S. Pat. No. 5,593,839 [0553] U.S. Pat. No. 5,599,672 [0554] U.S. Pat. No. 5,599,695 [0555] U.S. Pat. No. 5,602,240 [0556] U.S. Pat. No. 5,602,244 [0557] U.S. Pat. No. 5,610,042 [0558] U.S. Pat. No. 5,610,287 [0559] U.S. Pat. No. 5,610,289 [0560] U.S. Pat. No. 5,614,617 [0561] U.S. Pat. No. 5,623,070 [0562] U.S. Pat. No. 5,624,711 [0563] U.S. Pat. No. 5,631,134 [0564] U.S. Pat. No. 5,637,683 [0565] U.S. Pat. No. 5,639,603 [0566] U.S. Pat. No. 5,645,897 [0567] U.S. Pat. No. 5,652,099 [0568] U.S. Pat. No. 5,654,413 [0569] U.S. Pat. No. 5,656,610 [0570] U.S. Pat. No. 5,658,734 [0571] U.S. Pat. No. 5,661,028 [0572] U.S. Pat. No. 5,665,547 [0573] U.S. Pat. No. 5,667,972 [0574] U.S. Pat. No. 5,670,663 [0575] U.S. Pat. No. 5,672,697 [0576] U.S. Pat. No. 5,681,947 [0577] U.S. Pat. No. 5,695,940 [0578] U.S. Pat. No. 5,700,637 [0579] U.S. Pat. No. 5,700,922 [0580] U.S. Pat. No. 5,702,932 [0581] U.S. Pat. No. 5,705,629 [0582] U.S. Pat. No. 5,708,154 [0583] U.S. Pat. No. 5,714,606 [0584] U.S. Pat. No. 5,728,525 [0585] U.S. Pat. No. 5,736,524 [0586] U.S. Pat. No. 5,744,305 [0587] U.S. Pat. No. 5,763,167 [0588] U.S. Pat. No. 5,777,092 [0589] U.S. Pat. No. 5,780,448 [0590] U.S. Pat. No. 5,789,215 [0591] U.S. Pat. No. 5,792,847 [0592] U.S. Pat. No. 5,800,992 [0593] U.S. Pat. No. 5,807,522 [0594] U.S. Pat. No. 5,830,645 [0595] U.S. Pat. No. 5,837,196 [0596] U.S. Pat. No. 5,847,219 [0597] U.S. Pat. No. 5,858,988 [0598] U.S. Pat. No. 5,859,221 [0599] U.S. Pat. No. 5,871,928 [0600] U.S. Pat. No. 5,872,232 [0601] U.S. Pat. No. 5,876,932 [0602] U.S. Pat. No. 5,886,165 [0603] U.S. Pat. No. 5,919,626 [0604] U.S. Pat. No. 5,945,100 [0605] U.S. Pat. No. 5,981,274 [0606] U.S. Pat. No. 5,994,624 [0607] U.S. Pat. No. 6,004,755 [0608] U.S. Pat. No. 6,087,102 [0609] U.S. Pat. No. 6,251,666 [0610] U.S. Pat. No. 6,262,252 [0611] U.S. Pat. No. 6,368,799 [0612] U.S. Pat. No. 6,376,179 [0613] U.S. Pat. No. 6,383,749 [0614] U.S. Pat. No. 6,617,112 [0615] U.S. Pat. No. 6,638,717 [0616] U.S. Pat. No. 6,720,138 [0617] U.S. Pat. No. 6,723,509 [0618] U.S. patent Ser. 60/649,584 [0619] U.S. patent Ser. 60/575,743 [0620] British Appln. 1,529,202 [0621] European Appl. 266,032 [0622] European Appl. 373 203 [0623] European Appl. 785 280 [0624] European Appl. 799 897 [0625] PCT Appln. WO 94/09699 [0626] PCT Appln. WO 95/06128 [0627] PCT Appln. WO 0138580 [0628] PCT Appln. WO 0168255 [0629] PCT Appln. WO 03020898 [0630] PCT Appln. WO 03022421 [0631] PCT Appln. WO 03023058 [0632] PCT Appln. WO 03029485 [0633] PCT Appln. WO 03040410 [0634] PCT Appln. WO 03053586 [0635] PCT Appln. WO 03066906 [0636] PCT Appln. WO 03067217 [0637] PCT Appln. WO 03076928 [0638] PCT Appln. WO 03087297 [0639] PCT Appln. WO 03091426 [0640] PCT Appln. WO 03093810 [0641] PCT Appln. WO 03100448A1 [0642] PCT Appln. WO 04020085 [0643] PCT Appln. WO 04027093 [0644] PCT Appln. WO 09923256 [0645] PCT Appln. WO 09936760 [0646] PCT Appln. WO 93/17126 [0647] PCT Appln. WO 95/11995 [0648] PCT Appln. WO 95/21265 [0649] PCT Appln. WO 95/21944 [0650] PCT Appln. WO 95/21944 [0651] PCT Appln. WO 95/35505 [0652] PCT Appln. WO 96/31622 [0653] PCT Appln. WO 97/10365 [0654] PCT Appln. WO 97/27317 [0655] PCT Appln. WO 9743450 [0656] PCT Appln. WO 99/35505 [0657] PCT Appln. WO03100012 [0658] UK 8 803 000; [0659] Agrawal and Zamecnik, Nucleic Acids Research, 18(18):5419-5423, 1990. [0660] Allen et al., Biochemistry, 28:4601-4607, 1989. [0661] Ambros, Cell, 107(7):823-826, 2001. [0662] Baglioni and Nilson, Interferon, 5:23-42, 1983. [0663] Bayer and Wilchek, Methods of Biochemical Analysis, 26:1-45, 1980. [0664] Bayer et al, Analytical Biochemistry, 149:529-536, 1985. [0665] Beaucage, and Lyer, Tetrahedron, 48:2223-2311, 1992. [0666] Bernstein et al., Nature, 409: 363-366, 2001. [0667] Bijsterbosch et al., Biochem. Pharmacol., 62(5):627-633, 2001. [0668] Blackie et al., Bioorg. Med. Chem. Lett., 12(18):2603-2606, 2002. [0669] Bobo et al., In: Diagnosis of Chlamydia trachomatis Cervical Infection by Detection of Amplified DNA with an Enzyme Immunoassay, 1990. [0670] Borlakoglu et al., Biochem. Pharmacol., 40(2):265-272, 1990. [0671] Bosher and Labouesse, Nat. Cell Biol., 2:E31-E36, 2000. [0672] Brennecke et al., Cell, 113:25-36, 2003. [0673] Brumbaugh et al., Proc Natl Acad Sci USA, 85(15):5610-5614, 1988. [0674] Brummelkamp et al., Science, 296(5567):550-553, 2002 [0675] Calin et al., Proc. Natl. Acad. Sci. USA, 99:15524-15529, 2002. [0676] Caplen et al., Proc Natl Acad Sci USA, 98: 9742-9747, 2001. [0677] Cardullo et al., Proc Natl Acad Sci USA, 85(23):8790-8794, 1988 [0678] Carrington et al. Science, 301(5631):336-338, 2003. [0679] Chang et al., Nature, 430(7001):785-789, 2004. [0680] Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987. [0681] Chen et al., Science, 303(5654):83-86, 2004. [0682] Cogoni, C., and Macino, Science, 286:342-2344, 1999. [0683] Cogoni. and Macino, Natur,e 399:166-169, 1999. [0684] Conway et al., Nucleic Acids Res. Symposium Series, 21:43-44, 1989. [0685] Crooke, In: Antisense Drug Technology, Marcel Dekker and Co, Basel, Switzerland, Chapter 6, 2001. [0686] Cummins et al., In: IRT: Nucleosides and nucleosides, La Jolla Calif., 72, 1996. [0687] Dalmay et al. EMBO J, 20:2069-2078, 2001. [0688] Dalmay et al., Cell, 101:543-553, 2000. [0689] Denli et al., Trends Biochem. Sci., 28:196, 2003. [0690] Dewanjee et al., Biotechniques, 5: 844-846, 1994. [0691] Didenko, Biotechniques, 31(5):1106-16, 1118, 1120-1, 2001. [0692] Doench et al., Genes & Dev. 17: 438-442, 2003. [0693] Doench et al., Genes Dev. 18(5):504-11, 2004. [0694] Dong et al., Crit Rev Oncol Hematol. 54(2):85-93, 2005. [0695] Dostie et al., RNA, 9:180-186, 2003. [0696] Draper and Gold, Biochemistry, 19:1774-1781, 1980. [0697] Elbashir et al., Nature, 411:494-498, 2001. [0698] Emptage et al., Neuron, 2001 January; 29(1):197-208, 2001. [0699] Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987. [0700] Fire et al., Nature, 391:806-811, 1998. [0701] Forster et al. Nucleic Acids Res., 13(3):745-761, 1985. [0702] Fraley et A, Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. [0703] Froehler et al., Nucleic Acids Res., 14(13):5399-5407, 1986. [0704] Gillam et al., J. Biol. Chem., 253:2532, 1978. [0705] Gillam et al., Nucleic Acids Res., 6:2973, 1979. [0706] Gopal, Mol. Cell Biol., 5:1188-1190, 1985. [0707] Graham and Van Der Eb, Virology, 52:456-467, 1973. [0708] Griffey et al., J Mass Spectrom, 32(3):305-13, 1997. [0709] Grishok et al., Cell, 106: 23-34, 2001. [0710] Ha et al., Genes Dev., 10, 3041-3050, 1996. [0711] Hamilton and Baulcombe, Science, 286:950-952, 1999. [0712] Hammond et al., Nat. Rev. Genet., 2(2):110-9, 2001. [0713] Haralambidis et al., Nucleic Acids Res., 18(3):493-9, 1990. [0714] Harland and Weintraub, J. Cell Biol., 101:1094-1099, 1985. [0715] Holtke and Kessler, Nucleic Acids Res., 18(19):5843-51, 1990. [0716] Hutvagner and Zamore, Science, 297(5589):2056-2060, 2002. [0717] Hutvagner et al., PLoS Biol. 2(4):E98, 2004. [0718] Hutvagner et al., Science, 293:834-838, 2001. [0719] Itakura and Riggs, Science, 209:1401-1405, 1980. [0720] Itakura et al., J. Biol. Chem., 250:4592, 1975. [0721] Jablonski et al., Nucleic Acids Res., 14(15):6115-6128, 1986. [0722] Kaeppler et al., Plant Cell Reports, 9: 415-418, 1990. [0723] Kaneda et al., Science, 243:375-378, 1989. [0724] Kato et al, J. Biol. Chem., 266:3361-3364, 1991. [0725] Keller et al., Analytical Biochemistry, 170:441-450, 1988. [0726] Ketting et al., Cell, 99:133-141, 1999. [0727] Khorana, Science, 203, 614 1979. [0728] Kimura et al., Cancer Research, 55:1379-1384, 1995. [0729] Kiriakidou et al. Genes Dev. 18(10):1165-78, 2004. [0730] Kitagawa et al., Brain Res., 561:203-11, 1991. [0731] Klostermeier and Millar, Biopolymers, 61(3):159-79, 2001-2002 [0732] Knight et al., Science, 2:2, 2001. [0733] Kornberg and Baker, In: DNA Replication, 2d Ed., Freeman, San Francisco, 1992. [0734] Kuhnast et al., Bioconjug Chem, 5:627-636, 2000. [0735] Lagos-Quintana et al., Science, 294(5543):853-858, 2001. [0736] Langer et al., Proc. Natl. Acad. Sci. USA, 78(11):663-6637, 1981. [0737] Lau et al., Science, 294(5543):858-862, 2001. [0738] Lee and Ambros, Science, 294(5543):862-864, 2001. [0739] Lee et al., Nature, 425(6956):415-419 2003. [0740] Lee, EMBO J., 21(17):4663-4670 2002. [0741] Leonetti et al., Bioconjugate Chem., 1:149-153, 1990. [0742] Lewis, Cell, 115(7):787-798 2003. [0743] Lin and Avery, Nature, 402:128-129, 1999. [0744] Liu et al., Anal. Biochem., 289:239-245, 2001. [0745] Lorenz et al., Bioorg. Med. Chem. Lett. 14(19):4975-4977, 2004. [0746] MacKellar et al., Nucl. Acids Res., 20:3411-3417, 1992. [0747] Manoharan, Antisense Nucleic Acid Drug Dev., 12(2):103-128, 2002. [0748] Martin et al., RNA, 4(2):226-20, 1998. [0749] Meijer et al., Progress in Cell cycle research Vol 5, 219-224. (Meijer, L., Jezequel, A., and Roberge, M. eds), Chapter 22. [0750] Meister et al., RNA, 10(3):544-50, 2004. [0751] Montgomery et al., Proc. Natl. Acad. Sci. USA, 95:155-2-15507, 1998. [0752] Mourrain et al., Cell, 101:533, 2000. [0753] Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982. [0754] Nicolau et al., Methods Enzymol., 149:157-176, 1987. [0755] Nykanen et al., Cell, 107(3):309-321, 2001. [0756] Olsen et al., Dev. Biol., 216:671, 1999. [0757] Omirulleh et al., Plant Mol. Biol., 21(3):415-428, 1993. [0758] Oravcova et al., Blood Press Suppl., 1:61-64, 1994. [0759] Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495-513, 2002. [0760] Piutlle et al., Gene, 112(1):101-5, 1992. [0761] Plasterk and Ketting, Curr. Opin. Genet. Dev., 10:562-567, 2000. [0762] Potrykus et al., Mol. Gen. Genet., 199(2):169-77, 1985. [0763] Regnier and Preat, Pharm Res, 10:1596-602, 1998. [0764] Reinhart et al., Nature, 403:901-906, 2000. [0765] Reisfeld et al. Biochem Biophysic Res Comm, 142(2):519-526, 1987. [0766] Richardson and Gumport, Nucleic Acids Res, 11(18):6167-84, 1983. [0767] Richardson and Macy, Biochemistry, 20(5):1133-9, 1981. [0768] Rippe et al., Mol. Cell Biol., 10:689-695, 1990. [0769] Roychoudhury and Kossel, Eur Biochem, 22(3):310-20, 1971. [0770] Rump et al., Biochem Pharmacol 59(11): 1407-16, 2000. [0771] Rusckowski et al., Antisense Nucleic Acid Drug Dev., 5:333-345, 2000. [0772] Rusconi et al., Nat. Biotechnol., 22(11):1423-1428, 2004. [0773] Saiki et al. Science, 230:1350-1354, 1985 [0774] Sambrook et al., In: DNA microaarays: a molecular cloning manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2003. [0775] Sambrook et al., In: Molecular cloning: a laboratory manual, 2 Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. [0776] Sambrook et al., In: Molecular cloning: a laboratory manual, 3.sup.rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001. [0777] Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York, 171-172, 1980. [0778] Schwarze et al., Trends in Cell Biol., 10:290-295, 2000. [0779] Sedelnikova et al., Antisense Nucleic Acid Drug Dev., 6:443-452, 2000. [0780] Seggerson et al., Dev. Biol., 243:215, 2002. [0781] Sharp and Zamore, Science, 287:2431-2433, 2000. [0782] Smardon et al., Curr. Biol., 10:169-178, 2000. [0783] Sodja et al., Nucleic Acids Res., 5(2):385-401, 1978. [0784] Soutschek et al., Nature, 432(7014):173-178, 2004. [0785] Sproat et al., Nucleic Acids Res., 17(9):3373-3386, 1989. [0786] Stalnacke et al., Eur. J. Nucl. Med., 5:166-170, 1985. [0787] Sui et al., Proc. Natl. Acad. Sci. USA, 99(8):5515-5520, 2002. [0788] Tabara et al., Cell, 99:123-132, 1999. [0789] Takeda and Ikeda, Nucl. Acids Res., 15:101-104, 1984. [0790] Tuschl, Chembiochem, 2:239-245, 2001. [0791] Uhlenbeck et al., Nucleic Acids Res., 10(11):3341-52, 1982. [0792] Urdea et al., Clinical Chemistry, 35(8):1571-1575, 1989. [0793] Vella et al., Genes Dev. 18(2):132-7, 2004. [0794] Viscidi et al., J. Clinical Microbiology, 23(2):311-317, 1986. [0795] Vyas et al., Crit. Rev. Ther. Drug Carrier Syst., 18:1-76, 2001. [0796] Waterhouse et al., Nature, 411:834-842, 2001. [0797] Weeks et al., Clin. Chem., 29(8):1474-1479, 1983. [0798] Williams et al., Int. J. Dev. Biol., 41(2):359-364, 1997. [0799] Winter and Brownlee, Nucleic Acids Res., 5(9):3129-39, 1978. [0800] Wong et al., Gene, 10:87-94, 1980. [0801] Wu et al., Eur. J. Pharm. Sci., 3:179-186, 2000. [0802] Wu-Scharf et al., Science, 290:1159-1162, 2000. [0803] Xu et al., Curr. Biol., 13:790-795, 2003. [0804] Yoo et al., Nucleic Acids Res., 21:4225-4231, 2000. [0805] Zamore et al., Cell, 101:25-33, 2000. [0806] Zamore, Nat. Struct. Biol., 8:746-750, 2001. [0807] Zeng et al., Mol Cell. 9, 1327-33, 2002. [0808] Zeng et al., Proc. Natl. Acad. Sci. 100: 9779-9784, 2003. [0809] Zhang et al., Eur. J. Nucl. Med., 11:1700-1707, 2000. [0810] Zhang et al., J. Mol. Neurosci., 1:13-28, 1996. [0811] Zhang et al., J. Nucl. Med., 11:1660-1669, 2001. [0812] Ziauddin and Sabatini, Nature, 411(6833):107-110, 2001.