Compositions and methods for enhanced protein production in bacillus licheniformis
12534716 ยท 2026-01-27
Assignee
Inventors
- Steven D. Doig (Wilmington, DE, US)
- RYAN L FRISCH (NEWARK, DE, US)
- Hongxian He (Wilmington, DE)
- Chris LEEFLANG (OEGSTGEEST, NL)
- Zhen Ma (Garnet Valley, PA, US)
- Brian James Paul (Wilmington, DE)
Cpc classification
International classification
Abstract
The present disclosure is generally related to compositions and methods for constructing and/or obtaining B. licheniformis cells (e.g., protein production hosts) comprising enhanced protein production capabilities. Thus, certain embodiments are related to genetically modified Bacillus licheniformis strains derived from parental B. licheniformis strains producing increased amounts of one or more proteins of interest.
Claims
1. A method for producing an increased amount of a protein of interest (POI) in a modified Bacillus licheniformis cell comprising: (a) modifying a parental B. licheniformis cell expressing a POI by introducing therein a polynucleotide comprising a native B. licheniformis prsA promoter operably linked to a native B. licheniformis prsA open reading frame (ORF), and (b) fermenting the modified cell under suitable conditions for the production of the POI, wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions, wherein the POI is a secreted protein.
2. The method of claim 1, wherein the introduced polynucleotide comprises a native B. licheniformis prsA promoter sequence comprising at least 95% sequence identity to SEQ ID NO: 100.
3. The method of claim 1, wherein the introduced polynucleotide comprises a native B. licheniformis prsA ORF sequence comprising at least 90% sequence identity to SEQ ID NO: 101.
4. The method of claim 1, wherein the parental cell comprises an endogenous B. lichenformis prsA gene encoding a native B. licheniformis prsA protein.
5. The method of claim 1, wherein the introduced polynucleotide is integrated into the genome of the modified cell.
6. The method of claim 1, wherein the modified cell does not comprise a functional dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and/or a functional rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
7. The method of claim 1, wherein the POI is a secreted enzyme.
8. A modified Bacillus licheniformis cell derived from a parental B. licheniformis cell comprising an endogenous B. licheniformis prsA gene encoding a native B. licheniformis prsA protein, wherein the modified cell further comprises an introduced polynucleotide comprising a native B. licheniformis prsA promoter operably linked to a native B. licheniformis prsA open reading frame (ORF), wherein the modified cell produces an increased amount of a secreted protein of interest relative to the parental cell when fermented under the same conditions.
9. The modified cell of claim 8, wherein the introduced polynucleotide comprises a native B. licheniformis prsA promoter comprising at least 95% sequence identity to SEQ ID NO: 100.
10. The modified cell of claim 8, wherein the introduced polynucleotide comprises a native B. licheniformis prsA ORF comprises at least 90% sequence identity to SEQ ID NO: 101.
11. The modified cell of claim 8, wherein the introduced polynucleotide encodes a native B. licheniformis prsA protein comprising at least 90% sequence identity to SEQ ID NO: 155.
12. The modified cell of claim 8, which does not comprise a functional dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and/or a functional rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
13. The modified cell of claim 8, comprising an introduced expression construct encoding a heterologous protein of interest (POI), wherein the POI is a secreted protein.
14. The modified cell of claim 13, wherein the POI is a secreted enzyme.
Description
DETAILED DESCRIPTION
(1) The present disclosure is generally related to compositions and methods for obtaining B. licheniformis cells (e.g., protein production hosts) comprising enhanced protein production capabilities. Certain embodiments of the disclosure are related to genetically modified Bacillus licheniformis cells/strains derived from parental B. licheniformis cells/strains. Thus, certain other embodiments of the disclosure are directed to methods for constructing such modified B. licheniformis cells/strains producing increased amounts of one or more proteins of interest.
(2) For example, certain embodiments of the disclosure are directed to methods for producing an increased amount of a protein of interest (POT) in a modified Bacillus licheniformis cell comprising (a) modifying a parental B. licheniformis cell expressing a POI by introducing therein a polynucleotide comprising a native prsA promoter operably linked to a native prsA open reading frame (ORF) and (b) fermenting the modified cell under suitable conditions for the production of the POT, wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions. In certain embodiments, the modified cell further comprises a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and/or a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121. In certain embodiments, the protein of interest (POI) is an enzyme. In certain embodiments, the enzyme is a protease or an amylase.
(3) Other embodiments of the disclosure are directed to modified Bacillus licheniformis cells/strains derived from parental B. licheniformis cells/strains comprising an endogenous prsA gene encoding a native prsA protein. Thus, in certain embodiments, a modified B. licheniformis cell of the disclosure comprises an introduced polynucleotide comprising a native prsA promoter operably linked to a native prsA open reading frame (ORF). In particular embodiments, the introduced polynucleotide encodes a native prsA protein comprising about 90% sequence identity to SEQ ID NO: 155. In other embodiments, the modified cell comprises a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and/or a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(4) Certain embodiments of the disclosure are therefore directed to obtaining, isolating, purifying and like a protein of interest produced by a modified B. licheniformis cell of the disclosure.
I. Definitions
(5) In view of the modified B. licheniformis cells of the disclosure and methods thereof described herein, the following terms and phrases are defined. Terms not defined herein should be accorded their ordinary meaning as used in the art.
(6) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present compositions and methods apply. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present compositions and methods, representative illustrative methods and materials are now described. All publications and patents cited herein are incorporated by reference in their entirety.
(7) It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only, excluding, not including and the like, in connection with the recitation of claim elements, or use of a negative limitation or proviso thereof.
(8) As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present compositions and methods described herein. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
(9) As used herein. the genus Bacillus includes all species within the genus Bacillus as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named Geobacillus stearothermophilus.
(10) As used herein, a parental cell refers to an unmodified cell (e.g., such as an unmodified B. licheniformis parental cell).
(11) As used herein, a modified cell or a daughter cell may be used interchangeably and refer to recombinant B. licheniformis cells that comprise at least one genetic modification which is not present in the parental cell from which the modified (daughter) cell is derived.
(12) In certain embodiments, the unmodified B. licheniformis (parental) cell may be referred to as a control cell, particularly when being compared with, or relative to, a modified B. licheniformis (daughter) cell.
(13) As used herein, when the expression and/or production of a protein of interest (POI) in an unmodified (parental) cell is being compared to the expression and/or production of the same POI in a modified (daughter) cell, it will be understood that the modified and unmodified cells are grown/cultivated/fermented under the same conditions (e.g., the same conditions such as media, temperature. pH and the like).
(14) As used herein, a host cell refers to a cell that has the capacity to act as a host or expression vehicle for a newly introduced DNA sequence. This, in certain embodiments of the disclosure, the host cells are Bacillus sp. or E. coli cells.
(15) As used herein, a native B. licheniformis prsA promoter of the disclosure comprises about 95% sequence identity to SEQ ID NO: 100. In certain embodiments, a native B. licheniformis prsA promoter comprises about 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 100.
(16) As used herein, a native B. licheniformis prsA open reading frame (ORF) comprises about 90% or greater sequence identity to SEQ ID NO: 101. In certain embodiments, a native B. licheniformis prsA ORF comprises about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 101.
(17) The prsA gene of Bacillus subtilis has been described in Kontinen and Sarvas (1993) and PCT Publication No. WO1994/019471, which publications suggest that the prsA gene is involved in protein secretion (i.e., encoding a component of the cellular secretion machinery), wherein the prsA gene product is a membrane-associated lipoprotein.
(18) As used herein, a native B. licheniformis prsA protein comprises about 90% or greater sequence identity to SEQ ID NO: 155 and comprises peptidyl-prolyl cis-trans isomerase activity (EC 5.2.1.8). In certain embodiments, a native B. licheniformis prsA protein comprises about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 155.
(19) As used herein, a parental B. licheniformis cell comprises an endogenous (wild-type) prsA gene encoding a native prsA protein, and as such, when a polynucleotide encoding a prsA protein comprising about 90% sequence identity to SEQ ID NO: 155 is introduced into a modified B. licheniformis cell of the disclosure, the introduced polynucleotide may be referred to herein as a second (2.sup.nd) prsA copy. For example, a modified B. licheniformis cell of the disclosure comprising an introduced polynucleotide encoding a prsA protein comprising about 90% sequence identity to SEQ ID NO: 155, may be referred to herein as a two (2) copy prsA (modified) B. licheniformis cell, which comprises a first (1.sup.st) endogenous (wild-type) prsA gene encoding a native prsA protein, and a second (2.sup.nd) introduced polynucleotide encoding a prsA protein.
(20) In B. subtilis, the dlt operon comprises five (5) ORFs (dltA, dltB, dltC, dltD and dltE) encoding the proteins named DltA, DltB, DltC, DltD and DltE, respectively (May et al., 2005). For example, as described in by May et al. (2005), the DltA protein is a D-alanine:D-alanyl carrier protein ligase involved in the incorporation of D-Ala into the lipoteichoic acid of the cell wall.
(21) As used herein, a dltA gene comprises about 90% sequence identity to SEQ ID NO: 122. In certain embodiments, a dltA gene comprises about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 155.
(22) The B. subtilis rghR gene encodes a transcriptional regulatory protein named RghR, which has been described in the art as a repressor of rapG, rapH (Hayashi et al., 2006) and rapD (Ogura and Fujita, 2007). In contrast, as recently described in PCT Publication No. WO2018/156705, B. licheniformis encodes two (2) homologues of the RghR transcriptional regulatory protein, named RghR1 and RghR2. As set forth hereinafter, certain embodiments of the disclosure are related to B. licheniformis cells comprising a modified (e.g., deleted or disrupted) rghr2 gene.
(23) As used herein, a B. licheniformis rghR2 gene suitable for genetic modifications described herein can be a wild-type B. licheniformis rghR2 gene (SEQ ID NO: 121) encoding a native RhgR2 protein comprising about 90% sequence identity to SEQ ID NO: 156 (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 156), or it can be a variant B. licheniformis rghR2 gene (SEQ ID NO: 158) encoding a variant RhgR2 protein comprising about 90% sequence identity to SEQ ID NO: 157 (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 156). For example, as presented in SEQ ID NO: 157, the variant RhgR2 protein comprises a six (6) amino acid residue repeat of Ala-Ala-Ala-Ile-Ser-Arg at amino acid residues 36-41 of SEQ ID NO: 157, which six (6) amino acid repeat is not present in the native RghR2 protein (i.e., amino acid residues 1-134 of SEQ ID NO: 156).
(24) Thus, in certain other embodiments, a rghR2 gene, or open reading frame thereof, comprises about 90% sequence identity to a native rghR2 gene (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 121); or comprises about 901% sequence identity to a variant rghR2 gene (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 158).
(25) As used herein, a parental B. licheniformis strain named BF140 or BF140 (serA_lysA) comprises a serA gene deletion (serA) and lysA gene deletion (lysA).
(26) As used herein, a modified B. licheniformis strain named BF561 or BF561 (2.sup.nd copy prsA) was derived from the parental strain BF140, wherein the modified BF561 strain comprises an introduced 2.sup.nd copy of a wild-type B. licheniformis prsA gene encoding a native prsA protein.
(27) As used herein, a modified B. licheniformis strain named BF598 or BF598 (dltA_2.sup.nd copy prsA) was derived from the BF561 strain, wherein the modified BF598 further comprises a deletion of the B. licheniformis dltA gene.
(28) As used herein, a modified B. licheniformis strain named BF602 or BF602 (rghR2_2.sup.nd copy prsA) was derived from the BF561 strain, wherein the modified BF602 further comprises a deletion of the B. licheniformis rghR2 gene.
(29) As used herein, a modified B. licheniformis strain named BF613 or BF613 (rghR2_dltA_2.sup.nd copy prsA) was derived from the BF598 (dltA_2.sup.nd copy prsA) strain, wherein the modified BF613 further comprises a deletion of the B. licheniformis rghR2 gene.
(30) As used herein, amylase 1 is a native B. licheniformis -amylase commonly referred to in the art as AmyL and comprises an amino acid sequence of SEQ ID NO: 126.
(31) As used herein, amylase 2 is a variant Bacillus sp. -amylase comprising SEQ ID NO: 136, as generally described in International PCT Publication No. WO2018/184004 (incorporated herein by reference in its entirety).
(32) As used herein, amylase 3 is a variant Cytophaga sp. -amylase comprising SEQ ID NO: 143, as generally described in International PCT Publication Nos. WO2014/164777; WO2012/164800 and WO2014/164834 (each incorporated herein by reference in its entirety).
(33) As used herein, amylase 4 is a variant Cytophaga sp. -amylase comprising SEQ ID NO: 147, as generally described in International PCT Publication Nos. WO2014/164777; WO2012/164800 and WO2014/164834 (each incorporated herein by reference in its entirety).
(34) As used herein, amylase 5 is a variant Bacillus sp. 707 alkaline -amylase comprising SEQ ID NO: 151, as generally described in International PCT Publication No. WO2008/153805 and US Patent Publication No. US2014/0057324 (each incorporated herein by reference in its entirety).
(35) As used herein, a variant Cas9 protein herein named Cas9 Y155H has been described in PCT Publication No. WO2019/118463 (incorporated herein by reference in its entirety).
(36) As used herein, the terms modification and genetic modification are used interchangeably and include: (a) the introduction, substitution, or removal of one or more nucleotides in a gene (or an ORF thereof), or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the gene or ORF thereof. (b) a gene disruption. (c) a gene conversion, (d) a gene deletion, (e) the down-regulation of a gene, (f) specific mutagenesis and/or (g) random mutagenesis of any one or more the genes disclosed herein.
(37) As used herein, an increased amount, when used in phrases such as a modified host cell expresses/produces an increased amount of one or more proteins of interest relative to the (unmodified) parental host cell, particularly refers to an increased amount of any protein of interest (POI) expressed/produced in the modified host cell, which increased amount is always relative to the (unmodified) parental B. licheniformis cells expressing/producing the same POI, wherein the modified and unmodified cells are grown/cultured/fermented under the same conditions (e.g., the same conditions such as media, temperature, pH and the like). For example, an increased amount of a POI may be an endogenous Bacillus sp. POT, or a heterologous POI expressed in a modified Bacillus sp. cell of the disclosure.
(38) As used herein, increasing protein production or increased protein production is meant an increased amount of protein produced (e.g., a protein of interest). The protein may be produced inside the host cell, or secreted (or transported) into the culture medium. In certain embodiments, the protein of interest is produced (secreted) into the culture medium. Increased protein production may be detected for example, as higher maximal level of protein or enzymatic activity (e.g., such as protease activity, amylase activity, cellulase activity, hemicellulase activity and the like), or total extracellular protein produced as compared to the parental host cell.
(39) As used herein, the term expression refers to the transcription and stable accumulation of sense (mRNA) or anti-sense RNA, derived from a nucleic acid molecule of the disclosure. Expression may also refer to translation of mRNA into a polypeptide. Thus, the term expression includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, secretion and the like.
(40) As used herein, nucleic acid refers to a nucleotide or poly nucleotide sequence, and fragments or portions thereof, as well as to DNA, cDNA, and RNA of genomic or synthetic origin, which may be double-stranded or single-stranded, whether representing the sense or antisense strand. It will be understood that as a result of the degeneracy of the genetic code, a multitude of nucleotide sequences may encode a given protein.
(41) It is understood that the polynucleotides (or nucleic acid molecules) described herein include genes, vectors and plasmids.
(42) Accordingly, the term gene, refers to a polynucleotide that codes for a particular sequence of amino acids, which comprise all, or part of a protein coding sequence, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions (UTRs), including introns, 5-untranslated regions (UTRs), and 3-UTRs, as well as the coding sequence.
(43) As used herein, the term coding sequence refers to a nucleotide sequence, which directly specifies the amino acid sequence of its (encoded) protein product. The boundaries of the coding sequence are generally determined by an open reading frame (hereinafter, ORF), which usually begins with an ATG start codon. The coding sequence typically includes DNA, cDNA, and recombinant nucleotide sequences.
(44) The term promoter as used herein refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 (downstream) to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined. DNA fragments of different lengths may have identical promoter activity.
(45) The term operably linked as used herein refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence (e.g., an ORF) when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
(46) A nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA encoding a secretory leader (i.e., a signal peptide), is operably linked to DNA for a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
(47) As used herein, a functional promoter sequence controlling the expression of a gene of interest (or open reading frame thereof) linked to the gene of interest's protein coding sequence refers to a promoter sequence which controls the transcription and translation of the coding sequence in Bacillus. For example, in certain embodiments, the present disclosure is directed to a polynucleotide comprising a 5 promoter (or 5 promoter region, or tandem 5 promoters and the like), wherein the promoter region is operably linked to a nucleic acid sequence (e.g., an ORF) encoding a protein.
(48) As used herein, suitable regulatory sequences refer to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences. RNA processing site, effector binding site and stem-loop structure.
(49) As used herein, the term introducing, as used in phrases such as introducing into a bacterial cell or introducing into a B. licheniformis cell at least one polynucleotide open reading frame (ORF), or a gene thereof, or a vector thereof, includes methods known in the art for introducing polynucleotides into a cell, including, but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, conjugation and the like (e.g., see Ferrari et al., 1989).
(50) As used herein, transformed or transformation mean a cell has been transformed by use of recombinant DNA techniques. Transformation typically occurs by insertion of one or more nucleotide sequences (e.g., a polynucleotide, an ORF or gene) into a cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e., a sequence that is not naturally occurring in cell that is to be transformed). Transformation therefore generally refers to introducing an exogenous DNA into a host cell so that the DNA is maintained as a chromosomal integrant or a self-replicating extrachromosomal vector.
(51) As used herein, transforming DNA, transforming sequence, and DNA construct refer to DNA that is used to introduce sequences into a host cell or organism. Transforming DNA is DNA used to introduce sequences into a host cell or organism. The DNA may be generated in vitro by PCR or any other suitable techniques. In some embodiments, the transforming DNA comprises an incoming sequence, while in other embodiments it further comprises an incoming sequence flanked by homology boxes. In yet a further embodiment, the transforming DNA comprises other non-homologous sequences, added to the ends (i.e., stuffer sequences or flanks). The ends can be closed such that the transforming DNA forms a closed circle, such as, for example, insertion into a vector.
(52) As used herein, disruption of a gene or a gene disruption, are used interchangeably and refer broadly to any genetic modification that substantially prevents a host cell from producing a functional gene product (e.g., a protein). Thus, as used herein, a gene disruption includes, but is not limited to, frameshift mutations, premature stop codons (i.e., such that a functional protein is not made), substitutions eliminating or reducing activity of the protein internal deletions (such that a functional protein is not made), insertions disrupting the coding sequence, mutations removing the operable link between a native promoter required for transcription and the open reading frame, and the like.
(53) As used herein an incoming sequence refers to a DNA sequence that is introduced into the Bacillus sp. chromosome. In some embodiments, the incoming sequence is part of a DNA construct. In other embodiments, the incoming sequence encodes one or more proteins of interest. In some embodiments, the incoming sequence comprises a sequence that may or may not already be present in the genome of the cell to be transformed (i.e., it may be either a homologous or heterologous sequence). In some embodiments, the incoming sequence encodes one or more proteins of interest, a gene, and/or a mutated or modified gene. In alternative embodiments, the incoming sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a nonfunctional gene or operon. In some embodiments, the non-functional sequence may be inserted into a gene to disrupt function of the gene. In another embodiment, the incoming sequence includes a selective marker. In a further embodiment the incoming sequence includes two homology boxes.
(54) As used herein, homology box refers to a nucleic acid sequence, which is homologous to a sequence in the Bacillus chromosome. More specifically, a homology box is an upstream or downstream region having between about 80 and 100% sequence identity, between about 90 and 100% sequence identity, or between about 95 and 100% sequence identity with the immediate flanking coding region of a gene or part of a gene to be deleted, disrupted, inactivated, down-regulated and the like, according to the invention. These sequences direct where in the Bacillus chromosome a DNA construct is integrated and directs what part of the Bacillus chromosome is replaced by the incoming sequence. While not meant to limit the present disclosure, a homology box may include about between 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology box includes about between 1 bp and 10.0 kb; between 1 bp and 5.0 kb; between 1 bp and 2.5 kb; between 1 bp and 1.0 kb, and between 0.25 kb and 2.5 kb. A homology box may also include about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb and 0.1 kb. In some embodiments, the 5 and 3 ends of a selective marker are flanked by a homology box wherein the homology box comprises nucleic acid sequences immediately flanking the coding region of the gene.
(55) As used herein, the term selectable marker-encoding nucleotide sequence refers to a nucleotide sequence which is capable of expression in the host cells and where expression of the selectable marker confers to cells containing the expressed gene the ability to grow in the presence of a corresponding selective agent or lack of an essential nutrient.
(56) As used herein, the terms selectable marker and selective marker refer to a nucleic acid (e.g., a gene) capable of expression in host cell which allows for ease of selection of those hosts containing the vector. Examples of such selectable markers include, but are not limited to, antimicrobials. Thus, the term selectable marker refers to genes that provide an indication that a host cell has taken up an incoming DNA of interest or some other reaction has occurred. Typically, selectable markers are genes that confer antimicrobial resistance or a metabolic advantage on the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequence during the transformation.
(57) A residing selectable marker is one that is located on the chromosome of the microorganism to be transformed. A residing selectable marker encodes a gene that is different from the selectable marker on the transforming DNA construct. Selective markers are well known to those of skill in the art. As indicated above, the marker can be an antimicrobial resistance marker (e.g., amp.sup.R, phleo.sup.R, spec.sup.R, kan.sup.R, ery.sup.R, tet.sup.R, cmp.sup.R and neo.sup.R (see e.g., Guerot-Fleury, 1995; Palmeros et al., 2000; and Trieu-Cuot et al., 1983). In some embodiments, the present invention provides a chloramphenicol resistance gene (e.g., the gene present on pC194, as well as the resistance gene present in the Bacillus licheniformis genome). This resistance gene is particularly useful in the present invention, as well as in embodiments involving chromosomal amplification of chromosomally integrated cassettes and integrative plasmids (See e.g., Albertini and Galizzi, 1985; Stahl and Ferrari, 1984). Other markers useful in accordance with the invention include, but are not limited to auxotrophic markers, such as serine, lysine, tryptophan; and detection markers, such as -galactosidase.
(58) As defined herein, a host cell genome, a bacterial (host) cell genome, or a Bacillus sp. (host) cell genome includes chromosomal and extrachromosomal genes.
(59) As used herein, the terms plasmid, vector and cassette refer to extrachromosomal elements, often carrying genes which are typically not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single-stranded or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell.
(60) As used herein, the term plasmid refers to a circular double-stranded (ds) DNA construct used as a cloning vector, and which forms an extrachromosomal self-replicating genetic element in many bacteria and some eukaryotes. In some embodiments, plasmids become incorporated into the genome of the host cell. in some embodiments plasmids exist in a parental cell and are lost in the daughter cell.
(61) A used herein, a transformation cassette refers to a specific vector comprising a gene (or ORF thereof), and having elements in addition to the foreign gene that facilitate transformation of a particular host cell.
(62) As used herein, the term vector refers to any nucleic acid that can be replicated (propagated) in cells and can carry new genes or DNA segments into cells. Thus, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes). BACs (bacterial artificial chromosomes), PLACs (plant artificial chromosomes), and the like, that are episomes (i.e., replicate autonomously or can integrate into a chromosome of a host organism).
(63) An expression vector refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and know to one skilled in the art. Selection of appropriate expression vectors is within the knowledge of one skilled in the art.
(64) As used herein, the terms expression cassette and expression vector refer to a nucleic acid construct generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell (i.e., these are vectors or vector elements, as described above). The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments. DNA constructs also include a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell. In certain embodiments, a DNA construct of the disclosure comprises a selective marker and an inactivating chromosomal or gene or DNA segment as defined herein.
(65) As used herein, a targeting vector is a vector that includes polynucleotide sequences that are homologous to a region in the chromosome of a host cell into which the targeting vector is transformed and that can drive homologous recombination at that region. For example, targeting vectors find use in introducing mutations into the chromosome of a host cell through homologous recombination. In some embodiments, the targeting vector comprises other non-homologous sequences, e.g., added to the ends (i.e., stuffer sequences or flanking sequences). The ends can be closed such that the targeting vector forms a closed circle, such as, for example, insertion into a vector. For example, in certain embodiments, a parental B. licheniformis (host) cell is modified (e.g., transformed) by introducing therein one or more targeting vectors.
(66) As used herein, the term protein of interest or POI refers to a polypeptide of interest that is desired to be expressed in a modified B. licheniformis (daughter) host cell, wherein the POI is preferably expressed at increased levels (i.e., relative to the unmodified (parental) cell). Thus, as used herein, a POI may be an enzyme, a substrate-binding protein, a surface-active protein, a structural protein, a receptor protein, and the like. In certain embodiments, a modified cell of the disclosure produces an increased amount of a heterologous protein of interest or an endogenous protein of interest relative to the parental cell. In particular embodiments, an increased amount of a protein of interest produced by a modified cell of the disclosure is at least a 0.5% increase, at least a 1.0% increase, at least a 5.0% increase, or a greater than 5.0% increase, relative to the parental cell.
(67) Similarly, as defined herein, a gene of interest or GOI refers a nucleic acid sequence (e.g., a poly nucleotide, a gene or an ORF) which encodes a POI. A gene of interest encoding a protein of interest may be a naturally occurring gene, a mutated gene or a synthetic gene.
(68) As used herein, the terms polypeptide and protein are used interchangeably, and refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one (1) letter or three (3) letter codes for amino acid residues are used herein. The polypeptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term polypeptide also encompasses an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
(69) In certain embodiments, a gene of the instant disclosure encodes a commercially relevant industrial protein of interest, such as an enzyme (e.g., a acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carbonic anhydrases, carboxypeptidases, catalases, cellulases, chitinases, chymosins, cutinases, deoxyribonucleases, epimerases, esterases, -galactosidases, -galactosidases, -glucanases, glucan lysases, endo--glucanases, glucoamylases, glucose oxidases, -glucosidases. -glucosidases, glucuronidases, glycosyl hydrolases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, perhydrolases, polyol oxidases, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, peptidases, rhamno-galacturonases, ribonucleases, transferases, transport proteins, transglutaminases, xylanases, hexose oxidases, and combinations thereof).
(70) As used herein, a variant polypeptide refers to a polypeptide that is derived from a parent (or reference) polypeptide by the substitution, addition, or deletion of one or more amino acids, typically by recombinant DNA techniques. Variant polypeptides may differ from a parent polypeptide by a small number of amino acid residues and may be defined by their level of primary amino acid sequence homology/identity with a parent (reference) polypeptide.
(71) Preferably, variant polypeptides have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99% amino acid sequence identity with a parent (reference) polypeptide sequence. As used herein, a variant polynucleotide refers to a polynucleotide encoding a variant polypeptide, wherein the variant polynucleotide has a specified degree of sequence homology/identity with a parent polynucleotide, or hybridizes with a parent polynucleotide (or a complement thereof) under stringent hybridization conditions. Preferably, a variant polynucleotide has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99% nucleotide sequence identity with a parent (reference) polynucleotide sequence.
(72) As used herein, a mutation refers to any change or alteration in a nucleic acid sequence. Several types of mutations exist, including point mutations, deletion mutations, silent mutations, frame shift mutations, splicing mutations and the like. Mutations may be performed specifically (e.g., via site directed mutagenesis) or randomly (e.g., via chemical agents, passage through repair minus bacterial strains).
(73) As used herein, in the context of a polypeptide or a sequence thereof, the term substitution means the replacement (i.e., substitution) of one amino acid with another amino acid.
(74) As defined herein, an endogenous gene refers to a gene in its natural location in the genome of an organism.
(75) As defined herein, a heterologous gene, a non-endogenous gene, or a foreign gene refer to a gene (or ORF) not normally found in the host organism, but that is introduced into the host organism by gene transfer. As used herein, the term foreign gene(s) comprise native genes (or ORFs) inserted into a non-native organism and/or chimeric genes inserted into a native or non-native organism.
(76) As defined herein, a heterologous control sequence, refers to a gene expression control sequence (e.g., a promoter or enhancer) which does not function in nature to regulate (control) the expression of the gene of interest. Generally, heterologous nucleic acid sequences are not endogenous (native) to the cell, or a part of the genome in which they are present, and have been added to the cell, by infection, transfection, transformation, microinjection, electroporation, and the like. A heterologous nucleic acid construct may contain a control sequence/DNA coding (ORF) sequence combination that is the same as, or different, from a control sequence/DNA coding sequence combination found in the native host cell.
(77) As used herein, the terms signal sequence and signal peptide refer to a sequence of amino acid residues that may participate in the secretion or direct transport of a mature protein or precursor form of a protein. The signal sequence is typically located N-terminal to the precursor or mature protein sequence. The signal sequence may be endogenous or exogenous. A signal sequence is normally absent from the mature protein. A signal sequence is typically cleaved from the protein by a signal peptidase after the protein is transported.
(78) The term derived encompasses the terms originated obtained, obtainable, and created, and generally indicates that one specified material or composition finds its origin in another specified material or composition, or has features that can be described with reference to the another specified material or composition.
(79) As used herein, the term homology relates to homologous polynucleotides or polypeptides. If two or more polynucleotides or two or more polypeptides are homologous, this means that the homologous polynucleotides or polypeptides have a degree of identity of at least 60%, more preferably at least 70%, even more preferably at least 85%, still more preferably at least 90%, more preferably at least 95%, and most preferably at least 98%. Whether two polynucleotide or polypeptide sequences have a sufficiently high degree of identity to be homologous as defined herein, can suitably be investigated by aligning the two sequences using a computer program known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman and Wunsch, (1970). Using GAP with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3.
(80) As used herein, the term percent (%) identity refers to the level of nucleic acid or amino acid sequence identity between the nucleic acid sequences that encode a polypeptide or the polypeptide's amino acid sequences, when aligned using a sequence alignment program.
(81) As used herein, specific productivity is total amount of protein produced per cell per time over a given time period.
(82) As defined herein, the terms purified, isolated or enriched are meant that a biomolecule (e.g., a polypeptide or polynucleotide) is altered from its natural state by virtue of separating it from some, or all of, the naturally occurring constituents with which it is associated in nature. Such isolation or purification may be accomplished by art-recognized separation techniques such as ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, ammonium sulphate precipitation or other protein salt precipitation, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis or separation on a gradient to remove whole cells, cell debris, impurities, extraneous proteins, or enzymes undesired in the final composition. It is further possible to then add constituents to a purified or isolated biomolecule composition which provide additional benefits, for example, activating agents, anti-inhibition agents, desirable ions, compounds to control pH or other enzymes or chemicals.
(83) As used herein, the term ComK polypeptide is defined as the product of a comK gene; a transcription factor that acts as the final auto-regulatory control switch prior to competence development, involved with activation of the expression of late competence genes involved in DNA-binding and uptake and in recombination (Liu and Zuber, 1998, Hamoen et al., 1998). An exemplary ComK nucleic acid is set forth in SEQ ID NO: 92.
(84) As used herein, recombinant includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid sequence or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all as a result of deliberate human intervention. Recombination. recombining or generating a recombined nucleic acid is generally the assembly of two or more nucleic acid fragments wherein the assembly gives rise to a chimeric gene.
(85) As used herein, a flanking sequence refers to any sequence that is either upstream or downstream of the sequence being discussed (e.g., for genes A-B-C, gene B is flanked by the A and C gene sequences). In certain embodiments, the incoming sequence is flanked by a homology box on each side. In another embodiment, the incoming sequence and the homology boxes comprise a unit that is flanked by stuffer sequence on each side. In some embodiments, a flanking sequence is present on only a single side (either 3 or 5), but in preferred embodiments, it is on each side of the sequence being flanked. The sequence of each homology box is homologous to a sequence in the Bacillus chromosome. These sequences direct where in the Bacillus chromosome the new construct gets integrated and what part of the Bacillus chromosome will be replaced by the incoming sequence. In other embodiments, the 5 and 3 ends of a selective marker are flanked by a polynucleotide sequence comprising a section of the inactivating chromosomal segment. In some embodiments, a flanking sequence is present on only a single side (either 3 or 5), while in other embodiments, it is present on each side of the sequence being flanked.
II. Modified Bacillus licheniformis Cells Comprising Enhanced Protein Production Phenotypes
(86) As generally set forth in the Examples section below, Applicant constructed and introduced a series of host modifications into a parental B. licheniformis strain. More particularly, as presented in Examples below (e.g., see TABLE 18), the parental B. licheniformis strain used in this example comprises deletions of the serA1 gene (SEQ ID NO: 30) and the lysA gene (SEQ ID NO: 87), and was named BF140 (serA_lysA). Applicant subsequently introduced certain genetic modifications into the parental B. licheniformis strain (BF140), including (1) the introduction of a 2.sup.nd copy of a wild-type B. licheniformis prsA gene encoding a native prsA protein (named BF561; 2.sup.nd copy prsA), (2) the deletion of the B. licheniformis dltA gene (named BF598; dltA_2.sup.nd copy prsA), (3) the deletion of the B. licheniformis rghR2 gene (named BF602; rghR2_2.sup.nd copy prsA) and (4) the combined deletion of the B. licheniformis rghR2 gene and dltA gene (named BF613; rghR2_dltA_2.sup.nd copy prsA).
(87) Following the construction of the modified strains above, a series of -amylase expression cassettes were introduced into the modified B. licheniformis strains (BF561, BF598, BF602 and BF613) and the parental B. licheniformis strain (BF140). More particularly, as presented in Example 4 below, two (2) copies of five (5) different -amylase expression cassettes (i.e., amylase 1, amylase 2 amylase 3, amylase 4 and amylase 5) were introduced into the B. licheniformis strains.
(88) As further described below in Example 5, the parental (BF140) and modified (BF561, BF598. BF602 and BF613) B. licheniformis strains containing two (2) copies of expression cassettes for amylases 1-5 were assayed for production of amylases (e.g., see TABLE 19). For example, all five (5) of the amylases tested from a diverse group of -amylases demonstrate an improvement in -amylase production in the BF613 modified background (rghR2_dltA_2.sup.nd copy prsA) comprising the deleted dltA-2 (dltA-2) allele (SEQ ID NO: 125), the deleted rghR2 (rghR2) allele (SEQ ID NO: 80) and the insertion of a second copy of the native prsA gene controlled by the native prsA promoter (SEQ ID NO: 124), compared to the unmodified parental host BF140. For amylase 2 and amylase 3, the improvement in a -amylase production in the BF602 modified background (rghR2_2.sup.nd copy prsA), comprising the deleted rghR2 (rghR2) allele (SEQ ID NO: 80) and the second copy of the native prsA gene controlled by the native prsA promoter (SEQ ID NO: 124), is nearly as good as the productivity improvement seen in the BF613 modified host. This observation suggests that for some amylases the productivity improvement only requires the presence of these two (2) alleles (i.e., rghR2_2.sup.nd copy prsA), and that the presence of the dltA-2 allele is not harmful to this improvement.
III. Molecular Biology
(89) As generally set forth above, certain embodiments of the disclosure are related to modified Bacillus licheniformis (daughter) cells derived from parental B. licheniformis cells. More particularly, certain embodiments of the disclosure are related to modified Bacillus (daughter) cells and methods thereof for producing and constructing such modified Bacillus (host) cells (e.g., protein production host cells, cell factories) having increased protein production capabilities, increased secondary metabolite production capabilities and the like.
(90) In certain embodiments, a modified B. licheniformis cell of the disclosure comprises an introduced 2.sup.nd copy of gene or ORF encoding a native prsA protein. In other embodiments, a modified B. licheniformis cell of the disclosure comprises a deleted dltA gene. In certain other embodiments, a modified B. licheniformis cell of the disclosure comprises an introduced 2.sup.nd copy of gene or ORF encoding a native prsA protein and a deleted dltA gene. In other embodiments, a modified B. licheniformis cell of the disclosure comprises a deleted rghR2 gene. In certain other embodiments, a modified B. licheniformis cell of the disclosure comprises an introduced 2.sup.nd copy of gene or ORF encoding a native prsA protein and a deleted rghR2 gene. In other embodiments, a modified B. licheniformis cell of the disclosure comprises a deleted dltA gene and a deleted rghR2 gene. In certain other embodiments, a modified B. licheniformis cell of the disclosure comprises an introduced 2.sup.nd copy of gene or ORF encoding a native prsA protein, a deleted dltA gene and a deleted rghR2 gene.
(91) Thus, certain embodiments of the disclosure provide compositions and methods for genetically modifying (altering) a parental Bacillus cell of the disclosure to generate modified Bacillus cells thereof, and more particularly, modified Bacillus cells which produce an increased amount of endogenous and/or heterologous proteins of interest relative to (unmodified) parental B. licheniformis cells.
(92) Thus, certain embodiments of the disclosure are directed to methods for genetically modifying Bacillus cells, wherein the modification comprises (a) the introduction, substitution, or removal of one or more nucleotides in a gene (or an ORF thereof), or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the gene or ORF thereof, (b) a gene disruption, (c) a gene conversion, (d) a gene deletion, (e) a gene down-regulation, (f) site specific mutagenesis and/or (g) random mutagenesis.
(93) In certain embodiments, a modified Bacillus cell of the disclosure is constructed by reducing or eliminating the expression of a gene set forth above, using methods well known in the art, for example, insertions, disruptions, replacements, or deletions. The portion of the gene to be modified or inactivated may be, for example, the coding region or a regulatory element required for expression of the coding region.
(94) An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, (i.e., a part which is sufficient for affecting expression of the nucleic acid sequence). Other control sequences for modification include, but are not limited to, a leader sequence, a pro-peptidic sequence, a signal sequence, a transcription terminator, a transcriptional activator and the like.
(95) In certain other embodiments a modified Bacillus cell is constructed by gene deletion to eliminate or reduce the expression of at least one of the aforementioned genes of the disclosure. Gene deletion techniques enable the partial or complete removal of the gene(s), thereby eliminating their expression, or expressing a non-functional (or reduced activity) protein product. In such methods, the deletion of the gene(s) may be accomplished by homologous recombination using a plasmid that has been constructed to contiguously contain the 5 and 3 regions flanking the gene. The contiguous 5 and 3 regions may be introduced into a Bacillus cell, for example, on a temperature-sensitive plasmid, such as pE194, in association with a second selectable marker at a permissive temperature to allow the plasmid to become established in the cell. The cell is then shifted to a non-permissive temperature to select for cells that have the plasmid integrated into the chromosome at one of the homologous flanking regions. Selection for integration of the plasmid is effected by selection for the second selectable marker. After integration, a recombination event at the second homologous flanking region is stimulated by shifting the cells to the permissive temperature for several generations without selection. The cells are plated to obtain single colonies and the colonies are examined for loss of both selectable markers (see, e.g., Perego, 1993). Thus, a person of skill in the art may readily identify nucleotide regions in the gene's coding sequence and/or the gene's non-coding sequence suitable for complete or partial deletion.
(96) In other embodiments, a modified Bacillus cell of the disclosure is constructed by introducing, substituting, or removing one or more nucleotides in the gene or a regulatory element required for the transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a frame-shift of the open reading frame. Such a modification may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art (e.g., see, Botstein and Shortle, 1985; Lo et al., 1985; Higuchi et al., 1988; Shimada, 1996; Ho et al., 1989; Horton et al., 1989 and Sarkar and Sommer, 1990). Thus, in certain embodiments, a gene of the disclosure is inactivated by complete or partial deletion.
(97) In another embodiment, a modified Bacillus cell is constructed by the process of gene conversion (e.g., see Iglesias and Trautner, 1983). For example, in the gene conversion method, a nucleic acid sequence corresponding to the gene(s) is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into the parental Bacillus cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It may be desirable that the defective gene or gene fragment also encodes a marker which may be used for selection of transformants containing the defective gene. For example, the defective gene may be introduced on a non-replicating or temperature-sensitive plasmid in association with a selectable marker. Selection for integration of the plasmid is effected by selection for the marker under conditions not permitting plasmid replication. Selection for a second recombination event leading to gene replacement is effected by examination of colonies for loss of the selectable marker and acquisition of the mutated gene (Perego, 1993). Alternatively, the defective nucleic acid sequence may contain an insertion, substitution, or deletion of one or more nucleotides of the gene, as described below.
(98) In other embodiments, a modified Bacillus cell is constructed by established anti-sense techniques using a nucleotide sequence complementary to the nucleic acid sequence of the gene (Parish and Stoker, 1997). More specifically, expression of the gene by a Bacillus cell may be reduced (down-regulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the gene, which may be transcribed in the cell and is capable of hybridizing to the mRNA produced in the cell. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated. Such anti-sense methods include, but are not limited to RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, and the like, all of which are well known to the skilled artisan.
(99) In other embodiments, a modified Bacillus cell is produced/constructed via CRiSPR-Cas9 editing. For example, a gene encoding a protein of interest can be edited or disrupted (or deleted or down-regulated) by means of nucleic acid guided endonucleases, that find their target DNA by binding either a guide RNA (e.g., Cas9) and Cpf1 or a guide DNA (e.g., NgAgo), which recruits the endonuclease to the target sequence on the DNA, wherein the endonuclease can generate a single or double stranded break in the DNA. This targeted DNA break becomes a substrate for DNA repair, and can recombine with a provided editing template to disrupt or delete the gene. For example, the gene encoding the nucleic acid guided endonuclease (for this purpose Cas9 from S. pyogenes) or a codon optimized gene encoding the Cas9 nuclease is operably linked to a promoter active in the Bacillus cell and a terminator active in Bacillus cell, thereby creating a Bacillus Cas9 expression cassette. Likewise, one or more target sites unique to the gene of interest are readily identified by a person skilled in the art. For example, to build a DNA construct encoding a gRNA-directed to a target site within the gene of interest, the variable targeting domain (VT) will comprise nucleotides of the target site which are 5 of the (PAM) proto-spacer adjacent motif (TGG), which nucleotides are fused to DNA encoding the Cas9 endonuclease recognition domain for S. pyogenes Cas9 (CER). The combination of the DNA encoding a VT domain and the DNA encoding the CER domain thereby generate a DNA encoding a gRNA. Thus, a Bacillus expression cassette for the gRNA is created by operably linking the DNA encoding the gRNA to a promoter active in Bacillus cells and a terminator active in Bacillus cells.
(100) In certain embodiments, the DNA break induced by the endonuclease is repaired/replaced with an incoming sequence. For example, to precisely repair the DNA break generated by the Cas9 expression cassette and the gRNA expression cassette described above, a nucleotide editing template is provided, such that the DNA repair machinery of the cell can utilize the editing template. For example, about 500 bp 5 of targeted gene can be fused to about 500 bp 3 of the targeted gene to generate an editing template, which template is used by the Bacillus host's machinery to repair the DNA break generated by the RGEN.
(101) The Cas9 expression cassette, the gRNA expression cassette and the editing template can be co-delivered to filamentous fungal cells using many different methods (e.g., protoplast fusion, electroporation, natural competence, or induced competence). The transformed cells are screened by PCR amplifying the target gene locus, by amplifying the locus with a forward and reverse primer. These primers can amplify the wild-type locus or the modified locus that has been edited by the RGEN. These fragments are then sequenced using a sequencing primer to identify, edited colonies.
(102) In yet other embodiments, a modified Bacillus cell is constructed by random or specific mutagenesis using methods well known in the art, including, but not limited to, chemical mutagenesis (see, e.g., Hopwood, 1970) and transposition (see, e.g., Youngman et al., 1983). Modification of the gene may be performed by subjecting the parental cell to mutagenesis and screening for mutant cells in which expression of the gene has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, use of a suitable oligonucleotide, or subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing methods.
(103) Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N-nitro-N-nitrosoguanidine (MNNG), N-methyl-N-nitrosoguanidine (NTG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the parental cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and selecting for mutant cells exhibiting reduced or no expression of the gene.
(104) In certain other embodiments, a modified Bacillus cell comprises a deletion of an endogenous gene. In other embodiments, a modified Bacillus cell comprises a disruption of an endogenous gene. In certain embodiments, a polynucleotide disruption cassette of the disclosure comprises a marker gene.
(105) In other embodiments, a modified Bacillus cell comprises a down-regulated endogenous gene. For example, in certain embodiments, down-regulating one or more genes set forth above comprises deleting or disrupting the gene's upstream or downstream regulatory elements.
(106) PCT Publication No. WO2003/083125 discloses methods for modifying Bacillus cells, such as the creation of Bacillus deletion strains and DNA constructs using PCR fusion to bypass E. coli.
(107) PCT Publication No. WO2002/14490 discloses methods for modifying Bacillus cells including (1) the construction and transformation of an integrative plasmid (pComK), (2) random mutagenesis of coding sequences, signal sequences and pro-peptide sequences, (3) homologous recombination, (4) increasing transformation efficiency by adding non-homologous flanks to the transformation DNA, (5) optimizing double cross-over integrations, (6) site directed mutagenesis and (7) marker-less deletion.
(108) Those of skill in the art are well aware of suitable methods for introducing polynucleotide sequences into bacterial cells (e.g., E. coli and Bacillus spp.) (e.g., Ferrari et al., 1989, Saunders et al., 1984; Hoch et al., 1967; Mann et al., 1986; Holubova, 1985; Chang et al., 1979; Vorobjeva et al., 1980; Smith et al., 1986; Fisher et. al., 1981 and McDonald, 1984). Indeed, such methods as transformation including protoplast transformation and congression, transduction, and protoplast fusion are known and suited for use in the present disclosure. Methods of transformation are particularly preferred to introduce a DNA construct of the present disclosure into a host cell.
(109) In addition to commonly used methods, in some embodiments, host cells are directly transformed (i.e., an intermediate cell is not used to amplify, or otherwise process, the DNA construct prior to introduction into the host cell). Introduction of the DNA construct into the host cell includes those physical and chemical methods known in the art to introduce DNA into a host cell, without insertion into a plasmid or vector. Such methods include, but are not limited to, calcium chloride precipitation, electroporation, naked DNA, liposomes and the like. In additional embodiments, DNA constructs are co-transformed with a plasmid without being inserted into the plasmid. In further embodiments, a selective marker is deleted or substantially excised from the modified Bacillus strain by methods known in the art (e.g., Stahl et al., 1984 and Palmeros et al., 2000). In some embodiments, resolution of the vector from a host chromosome leaves the flanking regions in the chromosome, while removing the indigenous chromosomal region.
(110) Promoters and promoter sequence regions for use in the expression of genes, open reading frames (ORFs) thereof and/or variant sequences thereof in Bacillus cells are generally known on one of skill in the art. Promoter sequences of the disclosure of the disclosure are generally chosen so that they are functional in the Bacillus cells (e.g., B. licheniformis cells, B. subtilis cells and the like). Certain exemplary Bacillus promoter sequences are presented in Table 6. Likewise, promoters useful for driving gene expression in Bacillus cells include, but are not limited to, the B. subtilis alkaline protease (aprE) promoter (Stahl et al., 1984), the -amylase promoter of B. subtilis (Yang et al., 1983), the -amylase promoter of B. amyloliquefaciens (Tarkinen et al., 1983), the neutral protease (nprE) promoter from B. subtilis (Yang et al., 1984), a mutant aprE promoter (PCT Publication No. WO2001/51643) or any other promoter from B. licheniformis or other related Bacilli. In certain other embodiments, the promoter is a ribosomal protein promoter or a ribosomal RNA promoter (e.g., the rmI promoter) disclosed in U.S. Patent Publication No. 2014/0329309. Methods for screening and creating promoter libraries with a range of activities (promoter strength) in Bacillus cells is describe in PCT Publication No. WO2003/089604.
IV. Culturing Bacillus Cells for Production of a Protein of Interest
(111) In other embodiments, the present disclosure provides methods for increasing the protein productivity of a modified bacterial cell, as compared (i.e., relative) to an unmodified (parental) cell. In certain embodiments, the instant disclosure is directed to methods of producing a protein of interest (POI) comprising fermenting/cultivating a modified bacterial cell, wherein the modified cell secrets the POI into the culture medium. Fermentation methods well known in the art can be applied to ferment the modified and unmodified Bacillus cells of the disclosure.
(112) In some embodiments, the cells are cultured under batch or continuous fermentation conditions. A classical batch fermentation is a closed system, where the composition of the medium is set at the beginning of the fermentation and is not altered during the fermentation. At the beginning of the fermentation, the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a batch with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within typical batch cultures, cells can progress through a static lag phase to a high growth log phase, and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of product.
(113) A suitable variation on the standard batch system is the fed-batch fermentation system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression likely inhibits the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors, such as pH, dissolved oxygen and the partial pressure of waste gases, such as CO.sub.2. Batch and fed-batch fermentations are common and known in the art.
(114) Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and/or product concentration. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate and all other parameters are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off should be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology.
(115) Thus, in certain embodiments, a POI produced by a transformed (modified) host cell may be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, or if necessary, disrupting the cells and removing the supernatant from the cellular fraction and debris. Typically, after clarification, the proteinaceous components of the supernatant or filtrate are precipitated by means of a salt, e.g., ammonium sulfate.
(116) The precipitated proteins are then solubilized and may be purified by a variety of chromatographic procedures, e.g., ion exchange chromatography, gel filtration.
V. Proteins of Interest Produced by Modified (Host) Cells
(117) A protein of interest (POI) of the instant disclosure can be any endogenous or heterologous protein, and it may be a variant of such a POI. The protein can contain one or more disulfide bridges or is a protein whose functional form is a monomer or a multimer. i.e., the protein has a quaternary structure and is composed of a plurality of identical (homologous) or non-identical (heterologous) subunits, wherein the POI or a variant POI thereof is preferably one with properties of interest.
(118) For example, as set forth in the Examples below, the modified Bacillus cells of the disclosure produce an increased amount of endogenous and/or heterologous proteins of interests. Thus, in certain embodiments, a modified cell of the disclosure expresses an endogenous POI, a heterologous POI or a combination of one or more of such POIs. For example, in certain embodiments, a modified Bacillus (daughter) cell of the disclosure produces an increased amount of an endogenous POI relative to a parental Bacillus cell. In other embodiments, a modified Bacillus (daughter) cell of the disclosure produces an increased amount of a heterologous POI relative to a parental Bacillus cell.
(119) Thus, in certain embodiments, a modified Bacillus (daughter) cell of the disclosure produces an increased amount of a POI relative to a parental Bacillus (control) cell, wherein the increased amount of the POI is at least about a 0.01% increase, at least about a 0.10% increase, at least about a 0.50% increase, at least about a 1.0% increase, at least about a 2.0% increase, at least about a 3.0% increase, at least about a 4.0% increase, at least about a 5.0% increase, or an increase greater than 5.0%. In certain embodiments, the increased amount of the POI is determined by assaying enzymatic activity and/or by assaying/quantifying the specific productivity (Qp) thereof. Likewise, one skilled in the art may utilize other routine methods and techniques known in the art for detecting, assaying, measuring, etc. the expression or production of one or more proteins of interest.
(120) In certain embodiments, a modified Bacillus cell of the disclosure exhibits an increased specific productivity (Qp) of a POI relative the (unmodified) parental Bacillus cell. For example, the detection of specific productivity (Qp) is a suitable method for evaluating protein production. The specific productivity (Qp) can be determined using the following equation:
Qp=gP/gDCW.Math.hr
wherein, gP is grams of protein produced in the tank; gDCW is grams of dry cell weight (DCW) in the tank and hr is fermentation time in hours from the time of inoculation, which includes the time of production as well as growth time.
(121) Thus, in certain other embodiments, a modified Bacillus cell of the disclosure comprises a specific productivity (Qp) increase of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.
(122) In certain embodiments, a POI or a variant POI thereof is selected from the group consisting of acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carbonic anhydrases, carboxypeptidases, catalases, cellulases, chitinases, chymosins, cutinases, deoxyribonucleases, epimerases, esterases, -galactosidases, -galactosidases, -glucanases, glucan lysases, endo--glucanases, glucoamylases, glucose oxidases, -glucosidases, -glucosidases, glucuronidases, glycosyl hydrolases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, ligases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, perhydrolases, polyol oxidases, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, peptidases, rhamno-galacturonases, ribonucleases, transferases, transport proteins, transglutaminases, xylanases, hexose oxidases, and combinations thereof.
(123) Thus, in certain embodiments, a POI or a variant POI thereof is an enzyme selected from Enzyme Commission (EC) Number EC 1, EC 2, EC 3, EC 4, EC 5 or EC 6.
(124) For example, in certain embodiments a POI is an oxidoreductase enzyme, including, but not limited to, an EC 1 (oxidoreductase) enzyme selected from EC 1.10.3.2 (e.g., a laccase), EC 1.10.3.3 (e.g., L-ascorbate oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), EC 1.1.1.47 (e.g., glucose 1-dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., lineolate 13S-lipozygenase), EC 1.1.3.13 (e.g., alcohol oxidase), EC 1.14.14.1 (e.g., monooxygenase), EC 1.14.18.1 (e.g., monophenol monooxigenase) EC 1.15.1.1 (e.g., superoxide dismutase), EC 1.1.5.9 (formerly EC 1.1.99.10, e.g., glucose dehydrogenase), EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductase), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosyl amine reductase), EC 1.8.1.X (e.g., disulfide reductase) and EC 1.8.3.2 (e.g., thiol oxidase).
(125) In certain embodiments a POI is a transferase enzyme, including, but not limited to, an EC 2 (transferase) enzyme selected from EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternasucrase), EC 2.4.1.18 (e.g., 1.4 alpha-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucanotransferase), EC 2.4.1.2 (e.g., dextrin dextranase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-alpha-glucanotransferase), EC 2.4.1.333 (e.g., 1,2-beta-oligoglucan phosphor transferase), EC 2.4.1.4 (e.g., amylosucrase), EC 2.4.1.5 (e.g., dextransucrase), EC 2.4.1.69 (e.g., galactoside 2-alpha-L-fucosyl transferase), EC 2.4.1.9 (e.g., inulosucrase), EC 2.7.1.17 (e.g., xylulokinase), EC 2.7.7.89 (formerly EC 3.1.4.15, e.g., [glutamine synthetase]-adenylyl-L-tyrosine phosphorylase), EC 2.7.9.4 (e.g., alpha glucan kinase) and EC 2.7.9.5 (e.g., phosphoglucan kinase).
(126) In other embodiments a POI is a hydrolase enzyme, including, but not limited to, an EC 3 (hydrolase) enzyme selected from EC 3.1.X.X (e.g., an esterase), EC 3.1.1.1 (e.g., pectinase), EC 3.1.1.14 (e.g., chlorophyllase), EC 3.1.1.20 (e.g., tannase), EC 3.1.1.23 (e.g., glycerol-ester acylhydrolase), EC 3.1.1.26 (e.g., galactolipase), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetylesterase), EC 3.1.1.72 (e.g., acetylxylan esterase). EC 3.1.1.73 (e.g., feruloyl esterase), EC 3.1.1.74 (e.g., cutinase), EC 3.1.1.86 (e.g., rhamnogalacturonan acetylesterase), EC 3.1.1.87 (e.g., fumosin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphoric monoester hydrolase), EC 3.1.30.1 (e.g., Aspergillus nuclease Si), EC 3.1.30.2 (e.g., Serratia marcescens nuclease), EC 3.1.3.1 (e.g., alkaline phosphatase), EC 3.1.3.2 (e.g., acid phosphatase), EC 3.1.3.8 (e.g., 3-phytase), EC 3.1.4.1 (e.g., phosphodiesterase 1), EC 3.1.4.11 (e.g., phosphoinositide phospholipase C), EC 3.1.4.3 (e.g., phospholipase C), EC 3.1.4.4 (e.g., phospholipase D), EC 3.1.6.1 (e.g., arylsufatase), EC 3.1.8.2 (e.g., diisopropyl-fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC 3.2.1.101 (e.g., mannan endo-1,6-alpha-mannosidase), EC 3.2.1.11 (e.g., alpha-1,6-glucan-6-glucanohydrolase), EC 3.2.1.131 (e.g., xylan alpha-1,2-glucuronosidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosaminohydrolase), EC 3.2.1.139 (e.g., alpha-glucuronidase), EC 3.2.1.14 (e.g., chitinase), EC 3.2.1.151 (e.g., xyloglucan-specific endo-beta-1,4-glucanase), EC 3.2.1.155 (e.g., xyloglucan-specific exo-beta-1,4-glucanase), EC 3.2.1.164 (e.g., galactan endo-1,6-beta-galactosidase), EC 3.2.1.17 (e.g., lysozyme), EC 3.2.1.171 (e.g., rhamnogalacturonan hydrolase). EC 3.2.1.174 (e.g., rhamnogalacturonan rhamnohydrolase), EC 3.2.1.2 (e.g., beta-amylase), EC 3.2.1.20 (e.g., alpha-glucosidase), EC 3.2.1.22 (e.g., alpha-galactosidase), EC 3.2.1.25 (e.g., beta-mannosidase), EC 3.2.1.26 (e.g., beta-fructofiranosidase), EC 3.2.1.37 (e.g., xylan 1,4-beta-xylosidase), EC 3.2.1.39 (e.g., glucan endo-1,3-beta-D-glucosidase), EC 3.2.1.40 (e.g., alpha-L-rhamnosidase), EC 3.2.1.51 (e.g., alpha-L-fucosidase), EC 3.2.1.52 (e.g., beta-N-Acetylhexosaminidase), EC 3.2.1.55 (e.g., alpha-N-arabinofuranosidase), EC 3.2.1.58 (e.g., glucan 1,3-beta-glucosidase), EC 3.2.1.59 (e.g., glucan endo-1,3-alpha-glucosidase), EC 3.2.1.67 (e.g., galacturan 1,4-alpha-galacturonidase), EC 3.2.1.68 (e.g., isoamylase), EC 3.2.1.7 (e.g., 1-beta-D-fructan fructanohydrolase), EC 3.2.1.74 (e.g., glucan 1,4--glucosidase), EC 3.2.1.75 (e.g., glucan endo-1,6-beta-glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-alpha-mannosidase), EC 3.2.1.80 (e.g., fructan beta-fructosidase), EC 3.2.1.82 (e.g., exo-poly-alpha-galacturonosidase), EC 3.2.1.83 (e.g., kappa-carrageenase), EC 3.2.1.89 (e.g., arabinogalactan endo-1,4-beta-galactosidase), EC 3.2.1.91 (e.g., cellulose 1,4-beta-cellobiosidase), EC 3.2.1.96 (e.g., mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase), EC 3.2.1.99 (e.g., arabinan endo-1,5-alpha-L-arabinanase), EC 3.4.X.X (e.g., peptidase), EC 3.4.11.X (e.g., aminopeptidase), EC 3.4.11.1 (e.g., leucyl aminopeptidase), EC 3.4.11.18 (e.g., methionyl aminopeptidase), EC 3.4.13.9 (e.g., Xaa-Pro dipeptidase), EC 3.4.14.5 (e.g., dipeptidyl-peptidase IV), EC 3.4.16.X (e.g., serine-type carboxypeptidase), EC 3.4.16.5 (e.g., carboxypeptidase C), EC 3.4.19.3 (e.g., pyroglutamyl-peptidase 1), EC 3.4.21.X (e.g., serine endopeptidase), EC 3.4.21.1 (e.g., chymotrypsin), EC 3.4.21.19 (e.g., glutamyl endopeptidase), EC 3.4.21.26 (e.g., prolyl oligopeptidase), EC 3.4.21.4 (e.g., trypsin), EC 3.4.21.5 (e.g., thrombin), EC 3.4.21.63 (e.g., oryzin). EC 3.4.21.65 (e.g., thermomycolin), EC 3.4.21.80 (e.g., streptogrisin A), EC 3.4.22.X (e.g., cysteine endopeptidase), EC 3.4.22.14 (e.g., actinidain), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., ficain), EC 3.4.22.32 (e.g., stem bromelain), EC 3.4.22.33 (e.g., fruit bromelain), EC 3.4.22.6 (e.g., chymopapain), EC 3.4.23.1 (e.g., pepsin A), EC 3.4.23.2 (e.g., pepsin B), EC 3.4.23.22 (e.g., endothiapepsin), EC 3.4.23.23 (e.g., mucorpepsin), EC 3.4.23.3 (e.g., gastricsin), EC 3.4.24.X (e.g., metalloendopeptidase), EC 3.4.24.39 (e.g., deuterolysin), EC 3.4.24.40 (e.g., serralysin), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.14 (e.g., N-acyl-aliphatic-L-amino acid amidohydrolase), EC 3.5.1.2 (e.g., L-glutamine amidohydrolase), EC 3.5.1.28 (e.g., N-acetylmuramoyl-L-alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g., protein-L-glutamine amidohydrolase), EC 3.5.1.5 (e.g., urease), EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase), EC 3.5.1.81 (e.g., N-Acyl-D-amino-acid deacylase), EC 3.5.4.6 (e.g., AMP deaminase) and EC 3.5.5.1 (e.g., nitrilase).
(127) In other embodiments a POI is a lyase enzyme, including, but not limited to, an EC 4 (lyase) enzyme selected from EC 4.1.2.10 (e.g., mandelonitrile lyase), EC 4.1.3.3 (e.g., N-acetylneuraminate lyase), EC 4.2.1.1 (e.g., carbonate dehydratase), EC 4.2.2.- (e.g., rhamnogalacturonan lyase), EC 4.2.2.10 (e.g., pectin lyase), EC 4.2.2.22 (e.g., pectate trisaccharide-lyase), EC 4.2.2.23 (e.g., rhamnogalacturonan endolyase) and EC 4.2.2.3 (e.g., mannuronate-specific alginate lyase).
(128) In certain other embodiments a POI is an isomerase enzyme, including, but not limited to, an EC 5 (isomerase) enzyme selected from EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-psicose 3-epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase) and EC 5.4.99.15 (e.g., (1-+4)--D-glucan 1--D-glucosylmutase).
(129) In yet other embodiments, a POI is a ligase enzyme, including, but not limited to, an EC 6 (ligase) enzyme selected from EC 6.2.1.12 (e.g., 4-coumarate:coenzyme A ligase) and EC 6.3.2.28 (e.g., L-amino-acid alpha-ligase)9
(130) Thus, in certain embodiments, industrial protease producing Bacillus host cells provide particularly preferred expression hosts. Likewise, in certain other embodiments, industrial amylase producing Bacillus host cells provide particularly preferred expression hosts.
(131) For example, there are two general types of proteases which are typically secreted by Bacillus spp., namely neutral (or metalloproteases) and alkaline (or serine) proteases. For example, Bacillus subtilisin proteins (enzymes) are exemplary serine proteases for use in the present disclosure. A wide variety of Bacillus subtilisins have been identified and sequenced, for example, subtilisin 168, subtilisin BPN, subtilisin Carlsberg, subtilisin DY, subtilisin 147 and subtilisin 309 (e.g., WO 1989/06279 and Stahl et al., 1984). In some embodiments of the present disclosure, the modified Bacillus cells produce mutant (i.e., variant) proteases. Numerous references provide examples of variant proteases, such as PCT Publication Nos. WO1999/20770; WO1999/20726; WO1999/20769; WO1989/06279; U.S. RE34,606; U.S. Pat. Nos. 4,914,031; 4,980,288; 5,208,158; 5,310,675; 5,336,611; 5,399,283; 5,441,882; 5,482,849; 5,631,217; 5,665,587; 5,700,676; 5,741,694; 5,858,757; 5,880,080; 6,197,567 and 6,218,165. Thus, in certain embodiments, a modified Bacillus cells of the disclosure comprises an expression construct encoding a protease.
(132) In certain other embodiments, a modified Bacillus cells of the disclosure comprises an expression construct encoding an amylase. A wide variety of amylase enzymes and variants thereof are known to one skilled in the art. For example, International PCT Publication NO. WO2006/037484 and WO 2006/037483 describe variant -amylases having improved solvent stability, Publication No. WO1994/18314 discloses oxidatively stable -amylase variants, Publication No. WO1999/19467, WO2000/29560 and WO2000/60059 disclose Termamyl-like -amylase variants, Publication No. WO2008/112459 discloses -amylase variants derived from Bacillus sp. number 707, Publication No. WO1999/43794 discloses maltogenic -amylase variants, Publication No. WO1990/11352 discloses hyper-thermostable -amylase variants, Publication No. WO2006/089107 discloses -amylase variants having granular starch hydrolyzing activity.
(133) In other embodiments, a POI or variant POI expressed and produced in a modified cell of the disclosure is a peptide, a peptide hormone, a growth factor, a clotting factor, a chemokine, a cytokine, a lymphokine, an antibody, a receptor, an adhesion molecule, a microbial antigen (e.g., HBV surface antigen, HPV E7, etc.), variants thereof, fragments thereof and the like. Other types of proteins (or variants thereof) of interest may be those that are capable of providing nutritional value to a food or to a crop. Non-limiting examples include plant proteins that can inhibit the formation of anti-nutritive factors and plant proteins that have a more desirable amino acid composition (e.g., a higher lysine content than a non-transgenic plant).
(134) There are various assays known to those of ordinary skill in the art for detecting and measuring activity of intracellularly and extracellularly expressed proteins. In particular, for proteases, there are assays based on the release of acid-soluble peptides from casein or hemoglobin measured as absorbance at 280 nm or colorimetrically, using the Folin method (e.g., Bergmeyer et al., 1984). Other assays involve the solubilization of chromogenic substrates (See e.g., Ward, 1983). Other exemplary assays include succinyl-Ala-Ala-Pro-Phe-para-nitroanilide assay (SAAPFpNA) and the 2,4,6-trinitrobenzene sulfonate sodium salt assay (TNBS assay). Numerous additional references known to those in the art provide suitable methods (See e.g., Wells et al., 1983; Christianson et al., 1994 and Hsia et al., 1999).
(135) International PCT Publication No. WO2014/164777 discloses Ceralpha -amylase activity assays useful for amylase activities described herein.
(136) Means for determining the levels of secretion of a protein of interest in a host cell and detecting expressed proteins include the use of immunoassays with either polyclonal or monoclonal antibodies specific for the protein. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence immunoassay (FIA), and fluorescent activated cell sorting (FACS).
VI. Exemplary Embodiments
(137) Non-limiting embodiments of the disclosure include, but are not limited to:
(138) 1. A method for producing an increased amount of a protein of interest (POI) in a modified Bacillus licheniformis cell comprising (a) modifying a parental B. licheniformis cell expressing a POI by introducing therein a polynucleotide comprising a native prsA promoter sequence operably linked to a native prsA open reading frame (ORF) sequence, and (b) fermenting the modified cell under suitable conditions for the production of the POI, wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions.
(139) 2. A method for producing an increased amount of a protein of interest (POI) in a modified Bacillus licheniformis cell comprising (a) modifying a parental B. licheniformis cell by introducing therein (i) an expression cassette encoding a POI and (ii) a polynucleotide comprising a native prsA promoter sequence operably linked to a native prsA open reading frame (ORF) sequence, and (b) fermenting the modified cell under suitable conditions for the production of the POI, wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions.
(140) 3. The method of embodiment 1 or embodiment 2, wherein the introduced polynucleotide comprises a native prsA promoter sequence comprising at least 95% sequence identity to SEQ ID NO: 100.
(141) 4. The method of embodiment 1 or embodiment 2, wherein the introduced polynucleotide comprises a native prsA ORF comprises at least 90% sequence identity to SEQ ID NO: 101.
(142) 5. The method of embodiment 1 or embodiment 2, wherein the parental cell comprises an endogenous prsA gene encoding a native prsA protein.
(143) 6. The method of embodiment 5, wherein the endogenous prsA gene encodes a native prsA protein comprising about 90% sequence identity to SEQ ID NO: 155.
(144) 7. The method of embodiment 1 or embodiment 2, wherein the introduced polynucleotide is integrated into the genome of the modified B. licheniformis cell.
(145) 8. The method of embodiment 1 or embodiment 2, wherein the modified cell further comprises a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122.
(146) 9. The method of embodiment 1 or embodiment 2, wherein the modified cell further comprises a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(147) 10. The method of embodiment 1 or embodiment 2, wherein the modified cell further comprises a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(148) 11. The method of embodiment 1 or embodiment 2, wherein the POI is an enzyme.
(149) 12. The method of embodiment 11, wherein the enzyme is a protease or an amylase.
(150) 13. A modified Bacillus licheniformis cell derived from a parental B. licheniformis cell, wherein the modified cell comprises an introduced polynucleotide comprising a native prsA promoter sequence operably linked to a native prsA open reading frame (ORF) sequence.
(151) 14. A modified Bacillus licheniformis cell derived from a parental B. licheniformis comprising an endogenous prsA gene encoding a native prsA protein, wherein the modified cell comprises an introduced polynucleotide comprising a native prsA promoter sequence operably linked to a native prsA open reading frame (ORF) sequence.
(152) 15. The modified cell of embodiment 13 or embodiment 14, wherein the introduced polynucleotide comprises a native prsA promoter comprising at least 95% sequence identity to SEQ ID NO: 100.
(153) 16. The modified cell of embodiment 13 or embodiment 14, wherein the introduced polynucleotide comprises a native prsA ORF comprises at least 90% sequence identity to SEQ ID NO: 101.
(154) 17. The modified cell of embodiment 13 or embodiment 14, wherein the introduced polynucleotide encodes a native prsA protein comprising about 90% sequence identity to SEQ ID NO: 155.
(155) 18. The modified cell of embodiment 13 or embodiment 14, wherein the introduced polynucleotide is integrated into the genome of the modified B. licheniformis cell.
(156) 19. The modified cell of embodiment 13 or embodiment 14, comprising a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122.
(157) 20. The modified cell of embodiment 13 or embodiment 14, comprising a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(158) 21. The modified cell of embodiment 13 or embodiment 14, comprising a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122 and a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(159) 22. The modified cell of embodiment 13 or embodiment 14, comprising an introduced expression cassette encoding a heterologous protein of interest (POI).
(160) 23. The modified cell of embodiment 22, wherein the POI is an enzyme.
(161) 24. The modified cell of embodiment 13 or embodiment 14, wherein the parental cell expresses an endogenous POI.
(162) 25. A protein of interest produced by the modified cell of embodiment 22 or embodiment 24.
(163) 26. A modified Bacillus licheniformis cell producing an increased amount of a protein of interest (POI) relative to a parental B. licheniformis cell, wherein the modified cell is derived from a parental B. licheniformis cell expressing a POI, wherein the modified cell comprises an introduced polynucleotide comprising a native prsA promoter sequence operably linked to a native prsA open reading frame (ORF) sequence and comprises a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158, wherein the modified cell produces an increased amount of the POI relative to the parental strain when fermented under the same condition.
(164) 27. The modified cell of embodiment 26, further comprising a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122.
(165) 28. A modified Bacillus licheniformis cell producing an increased amount of a protein of interest (POI) relative to a parental B. licheniformis cell, wherein modified cell is derived from a parental B. licheniformis cell expressing a POI, wherein the modified cell comprises an introduced polynucleotide comprising a native prsA promoter operably linked to a native prsA open reading frame (ORF) and comprises a deleted or disrupted dltA gene comprising at least 90% sequence identity to SEQ ID NO: 122, wherein the modified cell produces an increased amount of the POI relative to the parental strain when fermented under the same condition.
(166) 29. The modified cell of embodiment 28, further comprising a deleted or disrupted rghR2 gene comprising at least 90% sequence identity to SEQ ID NO: 121 or SEQ ID NO: 158.
(167) 30. The modified cell of embodiment 26 or embodiment 28, wherein the native prsA promoter comprises at least 95% sequence identity to SEQ ID NO: 100.
(168) 31. The modified cell of embodiment 26 or embodiment 28, wherein the native prsA ORF comprises at least 90% sequence identity to SEQ ID NO: 101.
(169) 32. The modified cell of embodiment 26 or embodiment 28, wherein the native prsA protein comprises about 90% sequence identity to SEQ ID NO: 155.
(170) 33. The modified cell of embodiment 26 or embodiment 28, wherein the POI is an enzyme.
(171) 34. The modified cell of embodiment 33, wherein the enzyme is a protease or an amylase.
(172) 35. A protein of interest produced by the modified cell of embodiment 26 or embodiment 28.
EXAMPLES
(173) Certain aspects of the present invention may be further understood in light of the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art.
Example 1
Construction of Cas9 Vectors Targeting rghR2 Pathway Genes
(174) The Cas9 protein from S. pyogenes (SEQ ID NO: 1) was codon optimized for Bacillus (SEQ ID NO: 2) with the addition of an N-terminal nuclear localization sequence (NLS; APKKKRKV; SEQ ID NO: 3), a C-terminal NLS (KKKKLK; SEQ ID NO: 4), a deca-histidine tag (HHHHHHHHHH; SEQ ID NO: 5), the aprE promoter from B. subtilis (SEQ ID NO: 6) and a terminator sequence (SEQ ID NO: 7) and was amplified using Q5 DNA polymerase (NEB) per
(175) TABLE-US-00001 Forward ATATATGAGTAAACTTGGTCTGACA SEQIDNO:8 GAATTCCTCCATTTTCTTCTGCTAT Reverse TGCGGCCGCGAATTCGATTACGAAT SEQIDNO:9 GCCGTCTCCC
manufacturer's instructions with the forward (SEQ ID NO: 8) and reverse (SEQ ID NO: 9) primer pair set forth below in TABLE 1.
Table 1
Forward and Reverse Primer Pair
(176) The backbone (SEQ ID NO: 10) of plasmid pKB320 (SEQ ID NO: 11) was amplified using Q5
(177) TABLE-US-00002 Forward GGGAGACGGCATTCGTAATCGAATT SEQIDNO:12 CGCGGCCGCA Reverse ATAGCAGAAGAAAATGGAGGAATTC SEQIDNO:13 TGTCAGACCAAGTTTACTCATATAT
DNA polymerase (NEB) per manufacturer's instructions with the forward (EQ ID NO: 12) and reverse (SEQ ID NO: 13) primer pair set forth below in TABLE 2.
Table 2
Forward and Reverse Primer Pair
(178) The PCR products were purified using Zymo clean and concentrate 5 columns per manufacturer's instructions. Subsequently, the PCR products were assembled using prolonged overlap extension PCR (POE-PCR) with Q5 Polymerase (NEB) mixing the two fragments at equimolar ratio. The POE-PCR reactions were cycled: 98 C. for five (5) seconds, 64 C. for ten (10) seconds, 72 C. for four (4) minutes and fifteen (15) seconds for 30 cycles. Five (5) l of the POE-PCR (DNA) was transformed into Top10 E. coli (Invitrogen) per manufacturer's instructions and selected on lysogeny (L) Broth (Miller recipe; 1% (w/v) Tryptone, 0.5% Yeast extract (w/v), 1% NaCl (w/v)), containing fifty (50) g/ml kanamycin sulfate and solidified with 1.5% Agar. Colonies were allowed to grow for eighteen (18) hours at 37 C. Colonies were picked and plasmid DNA prepared using Qiaprep DNA miniprep kit per manufacturer's instructions and eluted in fifty-five (55) l of ddH2O. The plasmid DNA was Sanger sequenced to verify correct assembly, using the sequencing primers set forth below in TABLE 3.
(179) TABLE-US-00003 TABLE3 SEQUENCINGPRIMERS Reverse CCGACTGGAGCTCCTATATTACC SEQIDNO:14 Reverse GCTGTGGCGATCTGTATTCC SEQIDNO:15 Forward GTCTTTTAAGTAAGTCTACTCT SEQIDNO:16 Forward CCAAAGCGATTTTAAGCGCG SEQIDNO:17 Forward CCTGGCACGTGGTAATTCTC SEQIDNO:18 Forward GGATTTCCTCAAATCTGACG SEQIDNO:19 Forward GTAGAAACGCGCCAAATTACG SEQIDNO:20 Forward GCTGGTGGTTGCTAAAGTCG SEQIDNO:21 Forward GGACGCAACCCTCATTCATC SEQIDNO:22 Reverse CAGGCATCCGATTTGCAAGG SEQIDNO:23 Forward GCAAGCAGCAGATTACGCG SEQIDNO:24
(180) The correctly assembled plasmid, pRF694 (SEQ ID NO: 25) was used to construct plasmids pRF801 (SEQ ID NO: 26) and pRF806 (SEQ ID NO: 27) for editing the B. licheniformis genome at target site 1 (TS1; SEQ ID NO: 28) and target site 2 (TS2; SEQ ID NO: 29) as described below.
(181) The serA1 open reading frame (SEQ ID NO: 30) of B. licheniformis contains a unique target site, target site 1 (TS1; SEQ ID NO: 28) in the reverse orientation. The target site lies adjacent to a protospacer adjacent motif (SEQ ID NO: 31) in the reverse orientation. The target site can be converted into the DNA encoding a variable targeting domain (SEQ ID NO: 32).
(182) The DNA sequence encoding the VT domain (SEQ ID NO: 32) is operably fused to the DNA sequence encoding the Cas9 endonuclease recognition domain (CER, SEQ ID NO: 33) such that when transcribed by RNA polymerase of the bacterial cell, it produces a functional gRNA targeting target site 1 (SEQ ID NO: 34). The DNA encoding the gRNA was operably linked to a promoter operable in Bacillus sp. cells (e.g., the spac promoter; SEQ ID NO: 35) and a terminator operable in Bacillus sp. cells (e.g., the t0 terminator of phage lambda; SEQ ID NO: 36), such that the promoter was positioned upstream (5) of the DNA encoding the gRNA (SEQ ID NO: 33) and the terminator is positioned downstream (3) of the DNA encoding the gRNA (SEQ ID NO: 33).
(183) An editing template to delete the serA1 gene in response to Cas9/gRNA cleavage was created by amplification of two homology arms from B. licheniformis genomic DNA (gDNA). The first fragment corresponds to the 500 bp directly upstream of the serA1 open reading frame (SEQ ID NO: 37). This fragment was amplified using Q5 DNA polymerase per the manufacturer's instructions and the forward (SEQ ID NO: 38) and reverse (SEQ ID NO: 39) primers listed in TABLE 4 below. The primers incorporate 18 bp homologous to the 5 end of the second fragment on the 3 end of the first fragment and 20 bp homologous to pRF694 to the 5 end of first fragment.
(184) TABLE-US-00004 TABLE4 FORWARDANDREVERSEPRIMERPAIR Forward TGAGTAAACTTGGTCTGACAAATGGTTCTT SEQIDNO: TCCCCTGTCC 38 Reverse AGGTTCCGCAGCTTCTGTGTAAGATTTCCT SEQIDNO: CCTAAATAAGCGTCAT 39
(185) The second fragment corresponds to the 500 bp directly downstream of the 3 end of the serA1 open reading frame (SEQ ID NO: 40). This fragment was amplified using Q5 DNA polymerase per manufacturer's instructions and the forward (SEQ ID NO: 41) and reverse (SEQ ID NO: 42) primers listed in TABLE 5 below. The primers incorporate 28 bp homologous to the 3 end of the first fragment on the 5 end of the second fragment and 21 bp homologous to pRF694 on the 3 end of the second fragment.
(186) TABLE-US-00005 TABLE5 FORWARDANDREVERSEPRIMERPAIR Forward ATGACGCTTATTTAGGAGGAAATCTTACACA SEQIDNO: GAAGCTGCGGAACCT 41 Reverse CAGAAGAAAATGGAGGAATTCGAATATCGAC SEQIDNO: CGGAACCCAC 42
(187) The DNA encoding the target site 1 gRNA expression cassette (SEQ ID NO: 43), the first (SEQ ID NO: 37) and second homology arms (SEQ ID NO: 40) were assembled into pRF694 (SEQ ID NO: 25) using standard molecular biology techniques generating pRF801 (SEQ ID NO: 26), an E. coli-B. licheniformis shuttle plasmid containing a Cas9 expression cassette (SEQ ID NO: 2), a gRNA expression cassette (SEQ ID NO: 43) encoding a gRNA targeting target site 1 within the serA1 open-reading frame and an editing template (SEQ ID NO: 44) composed of the first (SEQ ID NO: 37) and second (SEQ ID NO: 40) homology arms. The plasmid was verified by Sanger sequencing with the oligos set forth in TABLE 3.
(188) The rghR1 open reading frame of B. licheniformis (SEQ ID NO: 45) contains a unique target site on the reverse strand, target site 2 (TS2; SEQ ID NO: 29). The target site lies adjacent to a protospacer adjacent motif (SEQ ID NO: 46) on the reverse strand. The DNA sequence encoding the target site (SEQ ID NO: 29) is operably fused to the DNA sequence encoding the Cas9 endonuclease recognition domain (CER, SEQ ID NO: 33) such that when transcribed by RNA polymerase of the bacterial cell it produces a functional gRNA targeting target site 2 (SEQ ID NO: 47). The DNA encoding the gRNA was operably linked to a promoter operable in Bacillus sp. cells (e.g., the spac promoter from B. subtilis; SEQ ID NO: 35) and a terminator operable in Bacillus sp. cells (e.g., the t0 terminator of phage lambda; SEQ ID NO: 36), such that the promoter was positioned 5 of the DNA encoding the gRNA (SEQ ID NO: 47) and the terminator is positioned 3 of the DNA encoding the gRNA (SEQ ID NO: 47).
(189) An editing template to modify the rghR1 gene in response to Cas9/gRNA cleavage was created by amplification of two homology arms from B. licheniformis genomic DNA (gDNA). The first fragment corresponds to the 500 bp directly upstream of the rghR1 open reading frame (SEQ ID NO: 48). This fragment was amplified using Q5 DNA polymerase per the manufacturer's instructions and the primers listed in TABLE 6 below. The primers incorporate 23 bp homologous to the 5 end of the second fragment on the 3 end of the first fragment and 20 bp homologous to pRF694 to the 5 end of first fragment.
(190) TABLE-US-00006 TABLE6 FORWARDANDREVERSEPRIMERPAIR Forward TGAGTAAACTTGGTCTGACATTGATA SEQIDNO:49 TTCAGCACCCTGCG Reverse TGTGCCGCGGAGAAGTATGGCCAAAA SEQIDNO:50 CCTCGCAATCTC
(191) The second fragment corresponds to the 500 bp directly downstream of the 3 end of the rghR1 open reading frame (SEQ ID NO: 51). This fragment was amplified using Q5 DNA polymerase per manufacturer's instructions and the primers listed in TABLE 7 below. The primers incorporate 20 bp homologous to the 3 end of the first fragment on the 5 end of the second fragment and 21 bp homologous to pRF694 on the 3 end of the second fragment.
(192) TABLE-US-00007 TABLE7 FORWARDANDREVERSEPRIMERPAIR Forward GAGATTGCGAGGTTTTGGCCATACTT SEQIDNO:52 CTCCGCGGCACA Reverse CAGAAGAAAATGGAGGAATTCATTTC SEQIDNO:53 TCGGGTTTAAACAGCCAC
(193) The DNA encoding the target site 2 gRNA expression cassette (SEQ ID NO: 54), the first (SEQ ID NO: 48) and second homology arms (SEQ ID NO: 51) were assembled into pRF694 (SEQ ID NO: 25) using standard molecular biology techniques generating pRF806 (SEQ ID NO: 27), an E. coli-B. licheniformis shuttle plasmid containing a Cas9 expression cassette (SEQ ID NO: 2), a gRNA expression cassette (SEQ ID NO: 54) encoding a gRNA targeting target site 2 within the rghR1 open-reading frame and an editing template (SEQ ID NO: 55) composed of the first (SEQ ID NO: 48) and second (SEQ ID NO: 51) homology arms. The plasmid was verified by sanger sequence with the oligos set forth in TABLE 3.
Example 2
Construction of Cas9 Y155H Variant and Associated Targeting Plasmids
(194) In the present example, the Y155H variant of S. pyogenes Cas9 (SEQ ID NO: 56) is constructed in the pRF801 (SEQ ID NO: 26) and pRF806 plasmids (SEQ ID NO: 27). To introduce the Y155H variant in the pRF801 plasmid (SEQ ID NO: 26), or the pRF806 plasmid (SEQ ID NO: 27), site-directed mutagenesis was performed using Quikchange mutagenesis kit per the manufacturer's instructions and the oligos in TABLE 8 below using pRF801 (SEQ ID NO: 26) or pRF806 (SEQ ID NO: 27) as template DNA.
(195) TABLE-US-00008 TABLE8 FORWARDANDREVERSEPRIMERPAIR Forward GATCTGCGTTTAATCCATCTTGCG SEQIDNO:57 TTAGCGCAC Reverse GTGCGCTAACGCAAGATGGATTAA SEQIDNO:58 ACGCAGATC
(196) The resultant products of the reaction, pRF827 (SEQ ID NO: 59) contained a Cas9 Y155H variant expression cassette (SEQ ID NO: 60), a gRNA expression cassette (SEQ ID NO: 43) encoding a gRNA targeting target site 1 within the serA1 open-reading frame, and an editing template (SEQ ID NO: 44) composed of the first (SEQ ID NO: 37) and second (SEQ ID NO: 40) homology arms; or pRF856 (SEQ ID NO: 61) which contained a Cas9 Y155H variant expression cassette (SEQ ID NO: 60), a gRNA expression cassette (SEQ ID NO: 54) targeting target site 2 within the rghR1 open reading frame and an editing template (SEQ ID NO: 55) composed of the first (SEQ ID NO: 48) and second (SEQ ID NO: 51) homology arms. The plasmid DNAs were Sanger sequenced to verify correct assembly, using the sequencing primers set forth in TABLE 3.
(197) Construction of Plasmid pRF862
(198) Plasmid pRF862 (SEQ ID NO: 62) was constructed by moving a fragment (SEQ ID NO: 63) of the Cas9 open-reading frame containing the Y155H substitution from pRF827 (SEQ ID NO: 59) amplified using the primers set forth in TABLE 9.
(199) TABLE-US-00009 TABLE9 FORWARDANDREVERSEPRIMERPAIR Forward CACGTCGTAAAAATCGTATT SEQIDNO:64 Reverse CAAACAGACCATTITTCTTT SEQIDNO:65
(200) A second fragment (SEQ ID NO: 66) was amplified from pRF694 (SEQ ID NO: 25) such that it contained the entire plasmid except the fragment contained on the pRF827 fragment above (SEQ ID NO: 63). This fragment shared homology with the 5 and 3 ends of the pRF827 fragment (SEQ ID NO: 60) for assembly and was amplified using the primers set forth in TABLE 10.
(201) TABLE-US-00010 TABLE10 FORWARDANDREVERSEPRIMERPAIR Forward AAAGAAAAATGGTCTGTTTG SEQIDNO:67 Reverse AATACGATTTTTACGACGTG SEQIDNO:68
(202) The two fragments were assembled using NEBuilder according to manufacturer's instructions and transformed into E. coli competent cells. Plasmid sequence was verified by the method of Sanger as set forth in TABLE 3. A sequence verified isolate was stored as plasmid pRF862 (SEQ ID NO: 62).
(203) pRF869 (SEQ ID NO: 69), a plasmid that targets the rghR2 ORF (SEQ ID NO: 70) and inserts three (3) in-frame stop codons, was constructed using two parts. The first part (SEQ ID NO: 71) containing the editing template (SEQ ID NO: 72) to modify the rghR2 ORF (SEQ ID NO: 70), and a gRNA expression cassette (SEQ ID NO: 73) targeting the rghR2 ORF (SEQ ID NO 70) was synthesized by IDT and was amplified for assembly using the primers set forth in TABLE 11.
(204) TABLE-US-00011 TABLE11 FORWARDANDREVERSEPRIMERPAIR Forward CGTGCGGCCGCGAATTC SEQIDNO:74 Reverse CCTGATACCGGGAGACGGCATTCGTAATC SEQIDNO:75
(205) The synthetic fragment was inserted into pRF862 (SEQ ID NO: 62) by amplifying pRF862 using the primers set forth in TABLE 12.
(206) TABLE-US-00012 TABLE12 FORWARDANDREVERSEPRIMERPAIR Forward GAATTCGCGGCCGCACG SEQIDNO:76 Reverse GATTACGAATGCCGTCTCCCGGTATCAGG SEQIDNO:77
(207) The two parts were assembled using NEBuilder according to manufacturer's instructions and transformed into E. coli. Plasmid sequence was verified by the method of Sanger as set forth in TABLE 3. A sequence verified isolate was stored as pRF869 (SEQ ID NO: 69).
(208) Several additional Cas9 plasmids were assembled as described above in Examples 1 and 2. Those plasmids are listed below in TABLE 13, along with the target site sequence and the editing template effect.
(209) TABLE-US-00013 TABLE13 ADDITIONALCAS9PLASMIDSFOREDITINGB.LICHENIFORMISCELLS Target Editing Editing SEQ argetsiteand andPAM template template Plasmid ID TPAMsequence SEQID effect SEQID pRF879 78 GCGAGCGGCTCAAAGAGCTGAGG 79 rghR2 80 pRF946 81 GAGCTTCTTTTTCTTGAGCACGG 82 cat 83 pZM221 84 TCCAGTTGACGTATCGATTCCGG 85 dltA-2 86
(210) For all plasmids, rolling-circle amplification (RCA) was used to amplify and make the plasmids suitable substrates for transformation using the TruPrime RCA kit (Sygnis).
Example 3
Construction of Modified Host Strains
(211) In the present example, a series of host modifications were introduced into a parental B. licheniformis strain. The parental B. licheniformis strain contains deletions of the serA1 (SEQ ID NO: 30) and the lysA genes (SEQ ID NO: 87) and is named BF140.
(212) A version of BF140 containing the pBl.comK plasmid (SEQ ID NO: 88) (Liu and Zuber, 1998, Hamoen et al., 1998) which contains a spectinomycin marker (SEQ ID NO: 89), the DNA encoding the XylR repressor (SEQ ID NO: 90) and the xylA promoter (SEQ ID NO: 91) of B. subtilis operably linked to the DNA encoding the B. licheniformis ComK protein (SEQ ID NO: 92), was transformed with a linear PCR product targeting the catH locus for integration of a second copy of the prsA gene of B. licheniformis (SEQ ID NO: 93). The construct contains an upstream homology arm to the catH locus (SEQ ID NO: 94) operably linked to the catH promoter (SEQ ID NO: 95), the DNA encoding the CatH protein (SEQ ID NO: 96) operably linked to a dual terminator (SEQ ID NO: 97) composed of the catH terminator (SEQ ID NO: 98) operably linked to the spoVG terminator of B. subtilis (SEQ ID NO: 99).
(213) The construct then contains the prsA promoter of B. licheniformis (SEQ ID NO: 100) operably linked to the prsA coding sequence (SEQ ID NO: 101) operably linked to the terminator from the amyL gene of B. licheniformis (SEQ ID NO: 102) operably linked to a downstream homology arm for the catH locus (SEQ ID NO: 103). Briefly. BF140/pBl.comK competent cells were generated. The BF140/pBl.comK strain was grown overnight in L broth containing one hundred (100) ppm spectinomycin at 37 C. with 250 RPM shaking. The culture was diluted the next day to an OD.sub.600 of 0.7 of fresh L broth containing one hundred (100) ppm spectinomycin. This new culture was grown for one (1) hour at 37 C., 250 RPM shaking. D-xylose was added to 0.1% w.Math.v.sup.1. The culture was grown for an additional four (4) hours at 37 C. and 250 RPM shaking. The cells were harvested at 1700.Math.g for seven (7) minutes. The cells were resuspended in volume of the spent culture medium containing 10% v.Math.v.sup.1 DMSO. One hundred (100) l of cells were mixed with ten (10) l of the catH::[catH prsAp-prsA] integration fragment (SEQ ID NO: 94). The cell/DNA mixture was incubated at 1400 RPM, 37 C. for one and a half (1.5) hours. The mixture was then plated on L agar plates contain ten (10) ppm chloramphenicol. The inoculated plates were incubated at 37 C. for forty-eight (48) hours.
(214) Colonies that formed on L agar containing ten (10) ppm chloramphenicol were screened using colony PCR to confirm the modification of the catH locus using primers listed in TABLE 14 and standard PCR techniques.
(215) TABLE-US-00014 TABLE14 FORWARDANDREVERSEPRIMERPAIR Forward TCGTTCTGAATGAGCAAGCA SEQIDNO:104 Reverse TGTTAATCAGGCCGACGATC SEQIDNO:105
(216) This PCR product, a 2676 bp fragment (SEQ ID NO: 106), was sequenced using the method of Sanger and the primers listed in TABLE 15.
(217) TABLE-US-00015 TABLE15 SANGERSEQUENCINGPRIMERS 1915 AACCTATATGACAGCCGGAG SEQIDNO:107 1916 GGCAAAATCCACTTAAGCCAC SEQIDNO:108 1054 AACGAGTTGGAACGGCTTGC SEQIDNO:109
(218) An isolate with the correct catH::[catH prsAp-prsA]integration (SEQ ID NO: 93) was stored as strain BF547.
(219) A version of BF547 containing the pBl.comK plasmid (SEQ ID NO: 88) was made competent as described above. One hundred (100) l of competent cells were mixed with five (5) l of pRF946 (SEQ ID NO: 81) RCA and incubated at 1400 RPM, 37 C. for one and a half (1.5) hours. The mixture was plated on L agar plates containing twenty (20) ppm kanamycin to select for plasmid transformation. The plates were incubated at 37 C. for forty-eight (48) hours.
(220) Colonies that formed on L agar containing twenty (20) ppm kanamycin were screened for colony PCR to confirm the deletion of the DNA encoding the 3 end of the catH promoter and the DNA encoding the CatH protein (SEQ ID NO: 110), while retaining the catH::[prsAp-prsA]cassette (SEQ ID NO: 111) using standard PCR techniques and primers listed in above TABLE 14.
(221) Correct colonies containing the catH::[prsAp-prsA]cassette (SEQ ID NO: 111) produced a PCR product of 1990 bp (SEQ ID NO: 112), as opposed to the parent colonies containing the catH::[catH prsAp-prsA] cassette (SEQ ID NO: 93, which produced a PCR product of 2676 bp in length (SEQ ID NO: 106). The difference was assessed visually using standard gel electrophoresis techniques. Isolates with the correct sized PCR product were sequenced using primer 1915 (SEQ ID NO: 107) and primer 1916 (SEQ ID NO: 108) in TABLE 15 above.
(222) A sequence verified isolate that contained catH::[prsAp-prsA]cassette (SEQ ID NO: 111) and was phenotypically sensitive to chloramphenicol (10 ppm) was stored as BF561.
(223) A version of BF561 containing the pBl.comK plasmid (SEQ ID NO: 88) was made competent as described above. One hundred (100) l of competent cells were mixed with five (5) l of either pZM221 (SEQ ID NO: 84) or pRF879 (SEQ ID NO: 78) RCA and incubated at 1400 RPM and 37 C. for one and a half (1.5) hours. The mixtures were plated on L agar plates containing twenty (20) ppm kanamycin to select for cells transformed with the plasmid.
(224) For cells transformed with pZM221 (SEQ ID NO: 84) that formed colonies on the L agar plates containing twenty (20) ppm kanamycin, the colonies were screened for the dltA-2 allele (SEQ ID NO: 86), a deletion of 700 bp of the dltA coding sequence using standard PCR techniques and the primers in TABLE 16.
(225) TABLE-US-00016 TABLE16 FORWARDANDREVERSEPRIMERPAIR Forward GGGTACCTCCATGGTAAAGT SEQIDNO:113 Reverse ACGTATTAATGCAGTAGCCG SEQIDNO:114
(226) Colonies with the dltA-2 allele produce a PCR product of 2067 bp (SEQ ID NO: 115) with the primers in TABLE 16, while the parental cells containing the intact dltA gene produce a PCR product of 2767 bp (SEQ ID NO: 116). This can be differentiated using standard electrophoresis techniques. A colony containing the 700 bp internal deletion of dltA (SEQ ID NO: 86) was stored as BF598.
(227) For cells transformed with pRF879 (SEQ IN NO: 78) that formed colonies on the L agar plates containing twenty (20) ppm kanamycin the colonies were screened for the rghR2 allele (SEQ ID NO: 80), a deletion of the rghR2 coding sequence except for the first nine (9) and last nine (9) bp, using standard PCR techniques and the primers in TABLE 17 below.
(228) TABLE-US-00017 TABLE17 FORWARDANDREVERSEPRIMERPAIR Forward GGATACGCCGATTTCAATGGC SEQIDNO:117 Reverse GGCTATGTGCTGGGGGAATT SEQIDNO:118
(229) Colonies with the rghR2 allele (SEQ ID NO: 80) produce a PCR product of 1523 bp (SEQ ID NO: 119) using the primers in TABLE 17, while the parental cells containing the intact rghR2 gene produce a PCR product of 1922 bp (SEQ ID NO: 120). The difference between these two products can be differentiated using standard electrophoresis techniques. A colony containing the deletion of the rghR2 gene (SEQ ID NO: 84) was stored as BF602.
(230) A version of BF598 containing the pBl.comK plasmid (SEQ ID NO: 88) was made competent as described above. One hundred (100) l of competent cells were mixed with five (5) l of pRF879 (SEQ ID NO: 78) RCA and incubated at 1400 RPM and 37 C. for lone and a half (1.5) hours. The mixtures were plated on L agar plates containing twenty (20) ppm kanamycin to select for cells transformed with the plasmid.
(231) For cells transformed with pRF879 (SEQ IN NO: 78) that formed colonies on the L agar plates containing twenty (20) ppm kanamycin the colonies were screened for the rghR2 allele (SEQ ID NO: 80), a deletion of the rghR2 coding sequence except for the first nine (9) and last nine (9) bp, using standard PCR techniques and the primers in TABLE 17 above.
(232) Colonies with the rghR2 allele (SEQ ID NO: 80) produce a PCR product of 1523 bp (SEQ ID NO: 119) using the primers in TABLE 17, while the parental cells containing the intact rghR2 gene produce a PCR product of 1922 bp (SEQ ID NO: 120). The difference between these two products can be differentiated using standard electrophoresis techniques. A colony containing the deletion of the rghR2 gene (SEQ ID NO: 80) was stored as BF613. TABLE 18 below indicates the modified host strains created in the present example, with the SEQ ID number for the three (3) modified loci in the example.
(233) TABLE-US-00018 TABLE 18 MODIFIED HOST STRAINS rghR2 dltA catH locus allele allele SEQ ID Strain Relative genotype SEQ ID SEQ ID NO BF140 lysA_serA pBl.comKsyn 121 122 123 BF561 BF140 cat::[prsAp-prsA] 121 122 124 BF598 BF561 dltA-2 121 125 125 BF602 BF561 rghR2 80 122 125 BF613 BF598 rghR2 80 125 125
Example 4
Construction of Amylase Expressing Strains in Modified Host Strains
(234) In the present example a series of amylase and amylase variant expression cassettes were introduced into the strain lineages listed in Example 2, TABLE 18 above.
(235) Amylase 1
(236) Amylase 1 (SEQ ID NO: 126) is the native alpha amylase of B. licheniformis, commonly referred to as AmyL. The first cassette of amylase 1 (SEQ ID NO: 127) was integrated into the serA1 locus (SEQ ID NO: 44) and contains the serA1 ORF (SEQ ID NO: 30) and the synthetic p3 promoter (SEQ ID NO: 128) operably linked to the DNA encoding the modified B. subtilis aprE 5 UTR (SEQ ID NO: 129) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 1 (SEQ ID NO: 131) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102). The second cassette (SEQ ID NO: 132) of amylase 1, integrated in the lysA locus (SEQ ID NO: 133), contains the DNA encoding LysA (SEQ ID NO: 134) and the synthetic p2 promoter (SEQ ID NO: 135) operably linked to the DNA encoding the modified B. subtilis aprE 5 UTR (SEQ ID NO: 129) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 1 (SEQ ID NO: 131) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102).
(237) Amylase 2
(238) Amylase 2 (SEQ ID NO: 136) is a variant Bacillus sp. -amylase described in PCT Publication No. WO2018/184004 (incorporated herein by reference in its entirety). The first cassette of amylase 2 (SEQ ID NO: 137) was integrated into the serA1 locus (SEQ ID NO: 44) and contains the serA1 ORF (SEQ ID NO: 30) and the B. subtilis rrnI promoter (SEQ ID NO: 138) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis Amy L signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 2 (SEQ ID NO: 140) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102). The second cassette of amylase 2 (SEQ ID NO: 141), integrated in the lysA locus (SEQ ID NO: 133) or the amyL locus (SEQ ID NO: 142), contains the DNA encoding LysA (SEQ ID NO: 134) and the synthetic p3 promoter (SEQ ID NO: 128) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 2 (SEQ ID NO: 140) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102).
(239) Amylase 3
(240) Amylase 3 (SEQ ID NO: 143) is a variant Cytophaga sp. -amylase (e.g., see PCT Publication Nos. WO2014/164777; WO2012/164800 and WO2014/16483, each incorporated herein by reference in its entirety). The first cassette of amylase 3 (SEQ ID NO: 144) was integrated into the serA1 locus (SEQ ID NO: 44) and contains the serA1 ORF (SEQ ID NO: 30) and the synthetic p3 promoter (SEQ ID NO: 128) operably linked to the DNA encoding the modified B. subtilis aprE 5 UTR (SEQ ID NO: 129) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 3 (SEQ ID NO: 145) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102). The second cassette of amylase 3 (SEQ ID NO: 146), integrated in the lysA locus (SEQ ID NO: 133), contains the DNA encoding LysA (SEQ ID NO: 134) and the synthetic p2 promoter (SEQ ID NO: 135) operably linked to the DNA encoding the modified B. subtilis aprE 5 UTR (SEQ ID NO: 129) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 3 (SEQ ID NO: 145) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102).
(241) Amylase 4
(242) Amylase 4 (SEQ ID NO: 147) is a variant Cytophaga sp. -amylase (e.g., see PCT Publication Nos. WO2014/164777, WO2012/164800 and WO2014/16483, each incorporated herein by reference in its entirety). The first cassette of amylase 4 (SEQ ID NO: 148) was integrated into the serA1 locus (SEQ ID NO: 44) and contains the serA1 ORF (SEQ ID NO: 30) and the synthetic p3 promoter (SEQ ID NO: 128) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 4 (SEQ ID NO: 149) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 129). The second cassette of amylase 4 (SEQ ID NO: 150), integrated in the lysA locus (SEQ ID NO: 133), contains the DNA encoding LysA (SEQ ID NO: 134) and the synthetic p2 promoter (SEQ ID NO: 135) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 4 (SEQ ID NO: 149) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102).
(243) Amylase 5
(244) Amylase 5 (SEQ ID NO: 151) is a variant Bacillus sp. 707 -amylase (see PCT Publication No. WO2008/153805 and US Patent Publication No. US2014/0057324). The first cassette of amylase 5 (SEQ ID NO: 152) was integrated into the serA1 locus (SEQ ID NO: 44) and contains the serA1 ORF (SEQ ID NO: 30) and the synthetic p3 promoter (SEQ ID NO: 128) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 5 (SEQ ID NO: 153) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102). The second cassette of amylase 5 (SEQ ID NO: 154), integrated in the lysA locus (SEQ ID NO: 133), contains the DNA encoding LysA (SEQ ID NO: 134 and the synthetic p2 promoter (SEQ ID NO: 135) operably linked to the DNA encoding the B. subtilis aprE 5 UTR (SEQ ID NO: 139) operably linked to the DNA encoding the B. licheniformis AmyL signal sequence (SEQ ID NO: 130) operably linked to the DNA encoding amylase 5 (SEQ ID NO: 153) operably linked to the B. licheniformis amyL transcriptional terminator (SEQ ID NO: 102).
(245) All amylase expression cassettes were transformed into the modified host strains using the methods described PCT Publication No. WO2019/040412 (incorporated herein by referenced in its entirety).
Example 5
Effect of Modified Host Backgrounds on Amylase Production
(246) In the present example the modified host strains (i.e., TABLE 19; BF140, BF561, BF598, BF602 and BF613) containing two copies of expression cassettes for amylases 1-5 (Example 4) were assayed for production of -amylase using standard small scale or lab-scale fermentation conditions (as described in PCT Publication No. WO2018/156705 and WO2019/055261, each incorporated herein by reference). Alpha-amylase production was quantified using the method of Bradford or the Ceralpha assay. The relative improvement in production of amylase is compared to the unmodified host comprising the same -amylase expression cassettes presented below in TABLE 19.
(247) TABLE-US-00019 TABLE 19 RELATIVE PERFORMANCE OF DIFFERENT MODIFIED HOST STRAINS ON AMYLASE PRODUCTION Amylase Amylase SEQ ID SEQ ID NO NO BF140 BF561 BF598 BF602 BF613 Amylase 1 1.00 ND 1.17 1.21 1.33 Amylase 2 1.00 1.72 1.83 1.87 1.87 Amylase 3 1.00 1.00 0.99 1.09 1.10 Amylase 4 1.00 1.48 1.45 1.56 1.62 Amylase 5 1.00 1.42 1.38 ND 1.41
(248) Thus, all five (5) of the amylases tested from a diverse group of -amylases demonstrate an improvement in -amylase production in the BF613 modified background comprising the deleted dltA-2 (dltA-2) allele (SEQ ID NO: 125), the deleted rghR2 (rghR2) allele (SEQ ID NO: 80) and the insertion of a second copy of the native prsA gene controlled by the native prsA promoter (SEQ ID NO: 124), compared to the unmodified host BF140.
(249) For amylase 2 and amylase 3, the improvement in -amylase production in the BF602 modified background comprising the deleted rghR2 (rghR2) allele (SEQ ID NO: 80) and the second copy of the native prsA gene controlled by the native prsA promoter (SEQ ID NO: 124), is nearly as good as the improvement seen in the BF613 modified host, suggesting that for some amylases the improvement only requires the presence of these two alleles, but also that the presence of the dltA-2 allele is not harmful to this improvement.
REFERENCES
(250) PCT Publication No. WO1989/06279 PCT Publication No. WO1990/11352 PCT Publication No. WO1994/18314 PCT Publication No. WO1999/19467 PCT Publication No. WO1999/20726 PCT Publication No. WO1999/20769 PCT Publication No. WO1999/20770 PCT Publication No. WO1999/43794 PCT Publication No. WO2000/29560 PCT Publication No. WO2000/60059 PCT Publication No. WO2001/51643 PCT Publication No. WO2002/14490 PCT Publication No. WO2003/083125 PCT Publication No. WO2003/089604 PCT Publication No. WO2006/037483 PCT Publication No. WO2006/037484 PCT Publication No. WO2006/089107 PCT Publication No. WO2008/112459 PCT Publication No. WO2014/164777 PCT Publication No. WO2019/040412 PCT Publication No. WO2018/156705 PCT Publication No. WO2019/055261 U.S. Publication No. US2014/0329309 U.S. Pat. No. 4,914,031 U.S. Pat. No. 4,980,288 U.S. Pat. No. 5,208,158 U.S. Pat. No. 5,310,675 U.S. Pat. No. 5,336,611 U.S. Pat. No. 5,399,283 U.S. Pat. No. 5,441,882 U.S. Pat. No. 5,482,849 U.S. Pat. No. 5,665,587 U.S. Pat. No. 5,700,676 U.S. Pat. No. 5,741,694 U.S. Pat. No. 5,858,757 U.S. Pat. No. 5,880,080 U.S. Pat. No. 6,197,567 U.S. Pat. No. 6,218,165. U.S. RE34,606 Albertini and Galizzi, Bacteriol., 162:1203-1211, 1985. Bergmeyer et al., Methods of Enzymatic Analysis vol. 5, Peptidases. Proteinases and their Inhibitors, Verlag Chemie, Weinheim, 1984. Botstein and Shortle. Science 229: 4719, 1985. Brode et al., Subtilisin BPN variants: increased hydrolytic activity on surface-bound substrates via decreased surface activity, Biochemistry, 35(10):3162-3169, 1996. Caspers et al., Improvement of Sec-dependent secretion of a heterologous model protein in Bacillus subtilis by saturation mutagenesis of the N-domain of the AmyE signal peptide. Appl. Microbiol. Biotechnol., 86(6):1877-1885, 2010. Chang et al., Mol. Gen. Genet., 168:11-115, 1979. Christianson et al., Anal. Biochem., 223:119-129, 1994. Devereux et a/., Nucl. Acid Res., 12: 387-395, 1984. Earl et al., Ecology and genomics of Bacillus subtilis. Trends in Microbiology., 16(6):269-275, 2008. Ferrari et al., Genetics, in Harwood et al. (ed.), Bacillus, Plenum Publishing Corp., 1989. Fisher et. al., Arch. Microbiol., 139:213-217, 1981.
Guerot-Fleury, Gene, 167:335-337, 1995. Hamoen et al., Controlling competence in Bacillus subtilis: shared used of regulators, Microbiology, 149:9-17, 2003. Hamoen et al., Genes Dev. 12:1539-1550, 1998. Higuchi et al., Nucleic Acids Research 16: 7351, 1988. Ho et al., Gene 77: 61, 1989. Hoch et al., J. Bacteriol., 93:1925-1937, 1967. Holubova, Folia Microbiol., 30:97, 1985. Hopwood. The Isolation of Mutants in Methods in Microbiology (J. R. Norris and D. W. Ribbons, eds.) pp 363-433, Academic Press, New York, 1970. Horton et al., Gene 77: 61, 1989. Hsia et al., Anal Biochem., 242:221-227, 1999. Iglesias and Trautner, Molecular General Genetics 189: 73-76, 1983. Jensen et al., Cell-associated degradation affects the yield of secreted engineered and heterologous proteins in the Bacillus subtilis expression system Microbiology, 146 (Pt 10:2583-2594, 2000. Kontinen and Sarvas, The PrsA lipoprotein is essential for protein secretion in Bacillus subtilis and sets a limit for high-level secretion, Mol. Microbiol. May; 8(4):727-737, 1993. Liu and Zuber, 1998, Lo et al., Proceedings of the National Academy of Sciences USA 81: 2285, 1985. May et al. Inhibition of the D-alanine:D-alanyl carrier protein ligase in Bacillus subtilis increases the bacterium's susceptibility to antibiotics that target the cell wall, FEBS Journal, 272: 2993-3003, 2005. McDonald, J. Gen. Microbiol., 130:203, 1984. Needleman and Wunsch. J. Mol. Biol., 48: 443, 1970. Ogura & Fujita, FEMS Microbiol Lett., 268(1): 73-80, 2007. Olempska-Beer et al., Food-processing enzymes from recombinant microorganismsa review Regul. Toxicol. Pharmacol., 45(2):144-158, 2006. Palmeros et al., Gene 247:255-264, 2000. Raul et al., Production and partial purification of alpha amylase from Bacillus subtilis (MTCC 121) using solid state fermentation, Biochemistry Research International, 2014. Sarkar and Sommer, BioTechniques 8: 404, 1990. Saunders et al., J. Bacteriol., 157:718-726, 1984. Shimada, Meth. Mol. Biol. 57: 157, 1996 Smith and Waterman, Adv. Appl. Math., 2: 482, 1981. Smith et al., Appl. Env. Microbiol., 51:634 1986. Stahl and Ferrari. J. Bacteriol., 158:411-418, 1984. Stahl et al, J. Bacteriol., 158:411418, 1984. Trieu-Cuot et al., Gene, 23:331-341, 1983. Van Dijl and Hecker, Bacillus subtilis: from soil bacterium to super-secreting cell factory. Microbial Cell Factories, 12(3). 2013. Vorobjeva et al., FEMS Microbiol. Let., 7:261-263, 1980. Ward, Proteinases, in Fogarty (ed.)., Microbial Enzymes and Biotechnology. Applied Science, London, pp 251-317, 1983. Wells et al., Nucleic Acids Res. 11:7911-7925, 1983. Westers et al., Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism, Biochimica et Biophysica Acta., 1694:299-310, 2004.