Variant of D-psicose 3-epimerase and uses thereof

Abstract

The present invention relates to an improved variant of a D-psicose 3-epimerase and its uses.

Claims

1. A variant of a parent D-psicose 3-epimerase selected from: a) SEQ ID NO: 2 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 2 and having a Serine at position 211; b) SEQ ID NO: 5 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 5 and having a Serine at position 211; c) SEQ ID NO: 6 with a G210S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 6 and having a Serine at position 210; d) SEQ ID NO: 7 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 7 and having a Serine at position 211; e) SEQ ID NO: 8 with a G213S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 8 and having a Serine at position 213; f) SEQ ID NO: 9 with a G223S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 9 and having a Serine at position 223; or g) SEQ ID NO: 10 with a G213S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 10 and having a Serine at position 213.

2. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 2 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 2 and having a Serine at position 211.

3. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 5 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 5 and having a Serine at position 211.

4. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 6 with a G210S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 6 and having a Serine at position 210.

5. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 7 with a G211S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 7 and having a Serine at position 211.

6. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 8 with a G213S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 8 and having a Serine at position 213.

7. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 9 with a G223S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 9 and having a Serine at position 223.

8. The variant according to claim 1, wherein the variant comprises SEQ ID NO: 10 with a G213S substitution or an amino acid sequence having at least 90% identity with SEQ ID NO: 10 and having a Serine at position 213.

9. An isolated nucleic acid encoding a variant according to claim 1.

10. A recombinant expression vector comprising a nucleic acid according to claim 9.

11. A recombinant host cell comprising a nucleic acid according to claim 9 or a recombinant expression vector comprising said nucleic acid.

12. The recombinant host cell according to claim 11, wherein the nucleic acid encoding said variant is integrated into the host cell's chromosome.

13. The recombinant host cell according to claim 11, wherein the host cell is a GRAS strain (Generally Recognized As Safe).

14. The recombinant host cell according to claim 13, wherein the host cell is a Bacillus subtilis strain in which the gene encoding for bacillopeptidase F is inactivated.

15. A method for producing a D-psicose 3-epimerase variant comprising culturing the recombinant host cell according to claim 11, and optionally recovering the produced D-psicose 3-epimerase variant from the resulting culture.

16. A method for producing D-psicose comprising contacting a variant according to claim 1 with D-fructose in conditions suitable for the D-psicose 3-epimerase activity and optionally recovering produced D-psicose.

17. The method according to claim 16, wherein the D-fructose is previously or simultaneously produced by a glucose isomerase from D-glucose.

18. An enzymatic composition comprising a D-psicose 3-epimerase variant according to claim 1 and an additional enzyme.

19. A food product comprising a recombinant host cell according to claim 11.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Multiple sequence alignment of DTEase family enzymes and their homologs. Amino acid sequence were from C. cellulolyticum DPEase (Clce-DPEase; GeneBank Accession No: ACL75304), SEQ ID NO: 4, Clostridium sp. (Clsp-DPEase; YP_005149214.1), SEQ ID NO: 5, C. scindens DPEase (Clsc-DPEase; EDS06411.1), SEQ ID NO: 6, A. tumefaciens DPEase (Agtu-DPEase; AAL45544), SEQ ID NO: 7, C. bolteae DPEase (Clbo-DPEase; EDP19602), SEQ ID NO: 9, Ruminococcus sp. DPEase (Rusp-DPEase; ZP_04858451), SEQ ID NO: 8, P. cichorii DTEase (Psci-DTEase; BAA24429), SEQ ID NO: 10, and R. sphaeroides DTEase (Rhsp-DTEase; AC059490), SEQ ID NO: 11. The alignment was performed using the ClustalW2 program (World Wide Web site: ebi.ac.uk/Tools/clustalw2/index.html). Amino acid residues that are identical in all the displayed sequences are marked by asterisks (*); strongly conserved or weakly conserved residues are indicated by colons (:) or dots (.), respectively.

(2) FIG. 2. Comparison of pH profiles between wild-type and G211S mutant of C. cellulolyticum DPEase.

(3) FIG. 3. SDS-PAGE analysis of purified G211S DTEase variant and protein markers stained with Coomassie Blue. Lane 1, Bacillus subtilis producing DPEase; Lane 2, protein marker.

(4) FIG. 4 shows the construction of plasmid pDGI-7S6-DPE used for inserting DPEase gene in Bacillus subtilis strains according to approach 1 (Cre/Lox recombination system) described in Example 2.

(5) FIG. 5 shows the main steps of approach 1 described in Example 2 to produce DPEase-expressing B. subtilis strains.

(6) FIG. 6 shows the construction of plasmid pDGI-DP used for inserting the DPEase gene in Bacillus subtilis strains according to approach 2 (mazF-based system) described in Example 2.

(7) FIG. 7 shows the main steps of approach 2 described in Example 2 to produce DPEase-expressing B. subtilis strains.

EXAMPLE 1

(8) The inventors prepared, by site-directed mutagenesis, DPEase variants of C. cellulolyticum by replacing the codon GGC encoding Gly in position 211 (SEQ ID NO: 1) by the codons AGC, GCC, GAC, CGC, TGG and CTC, encoding respectively the substitutions G211S, G211A, G211D, G211T, G211W and G211L.

(9) The DPEase variants have been expressed in Bacillus subtilis, expressed and purified (FIG. 3).

(10) Enzyme properties and kinetic parameters of the wild-type and variants of DPEase from C. cellulolyticum for substrate D-psicose have been determined and the results are given in Table 1.

(11) The G211S variant showed improved characteristics in comparison with the wild-type DPEase (Table 1), and also with the other known enzymes (Table 2). In particular, it is a weak-acid stable enzyme with more than 80% activity in the pH range from 6 to 8 (FIG. 2), and has a catalysis efficiency of approximately 150.6, and a half-life of at least 10 hours at 55° C. and/or a half life of at least 6.5 hours at 60° C. In addition, the host is a food-grade microorganism. These attributes are important in the bioproduction of a food-grade D-psicose with a more efficient production cycle and lower production costs.

(12) Materials and Methods

(13) Chemicals and Reagents

(14) Taq DNA polymerase, deoxynucleoside triphosphate (dNTP), chemicals for PCR, T4 DNA ligase and plasmid miniprep kit were obtained from Takara (Dalian, China). The resin for protein purification, the Chelating Sepharose Fast Flow, was obtained from GE (Uppsala, Sweden). Electrophoresis reagents were purchased from Bio-Rad. Isopropyl β-D-1-thiogalactopyranoside (IPTG) and all chemicals used for enzyme assays and characterization were at least of analytical grade, obtained from Sigma (St. Louis, Mo., USA) and Sinopharm Chemical Reagent (Shanghai, China). Oligonucleotides were synthesized by Sangon Biological Engineering Technology and Services (Shanghai, China).

(15) Plasmids, Bacterial Strains, and Culture Conditions

(16) The plasmid pET-22b(+) was obtained from Novagen (Darmstadt, Germany). The E. coli DH5α and E. coli BL21(DE3) were obtained from Tiangen Biotechnology (Beijing, China). Bacillus subtilis WB600 and the plasmid pMA5 were obtained from Invitrogen (Carlsbad, Calif., USA). The bacterial strains were grown in Luria-Bertani medium in a rotary shaker (200 rpm) at 37° C.

(17) Preparation of DPEase Variants of C. cellulolyticum in E. coli

(18) (1) Primer design for protein modification was as following:

(19) TABLE-US-00001 Forward mutagenic primers: G211S Forward primer1: (SEQ ID No 12) CATTTACACACTAGCGAATGTAATCGT  G211A Forward primer2: (SEQ ID No 13) CATTTACACACTGCCGAATGTAATCGT  G211D Forward primer3: (SEQ ID No 14) CATTTACACACTGACGAATGTAATCGT  G211R Forward primer4: (SEQ ID No 15) CATTTACACACTCGCGAATGTAATCGT  G211W Forward primer5: (SEQ ID No 16) CATTTACACACTTGGGAATGTAATCGT  G211L Forward primer6: (SEQ ID No 17) CATTTACACACTCTCGAATGTAATCGT  Reverse primer:  (SEQ ID No 18) 5′-AGTGTGTAAATGTCCCAAGTAAGAGCCCGC-3′ (2) Amplify the plasmid using the above primers by PCR technique. Template: pET-Cc-dpe DNA polymerase: Pfu PCR program: PCR amplification was performed by Pfu DNA polymerase for 20 cycles consisting of 94° C. for 30 s, 60° C. for 30 s, and 72° C. for 5 min, followed by an extension step of 10 min at 72° C. (3) After PCR, add 1 ul Dpni restriction enzyme (10 U/μL) into 200 μl PCR product, and incubate at 37° C. for 4 h, to digest and eliminate the template DNA. (4) The DNA was purified by Gel Extraction Kit. (5) The 5′-phosphorylation and ligation reactions of mutation fragments were performed together at 16° C. for 12 h, and the reaction system was as follows:

(20) TABLE-US-00002 Mutation DNA 7.5 μl 10 × T4 ligase buffer   1 μl PNK 0.5 μl T4 ligase   1 μl (6) The DNA was transformed into E. coli DH5α. The transformants were selected at 37° C. on the LB agar plates containing 100 m/mL ampicillin. (7) The plasmid was extracted and identified by nucleotide sequencing. (8) The reconstructed plasmid was transformed into E. coli BL21.

(21) The transformants were selected at 37° C. on the LB agar plates containing 100 μg/mL ampicillin.

(22) Preparation of DPEase Variants of C. cellulolyticum in B. subtilis (1) PCR

(23) To subclone the different variant genes to B. subtilis expression plasmid, forward (5′-CGCCATATGAAACATGGTATATACTACGC-3′—SEQ ID NO: 19) and reverse primer (5′-CGCGGATCCTTGTTAGCCGGATCTC-3′—SEQ ID NO: 20) were designed to introduce the NdeI and BamHI restriction sites. Using the reconstructed pET-22b(+) plasmids harboring different DPEase variant genes, PCR amplification was separately performed by Taq Plus DNA polymerase for 35 cycles consisting of 94° C. for 1 min, 60° C. for 1 min, and 72° C. for 1 min, followed by a final extension step of 10 min at 72° C. (2) Purify the PCR products separately using the Gel Extraction Kit. (3) The purified PCR products and B. subtilis expression plasmid pMA5 were digested by restriction enzyme NdeI and BamHI (4) DNA fragment and pMA5 were ligated by T4 DNA Ligase, and then the mixture was transformed into E. coli DH5α. (5) The transformants were selected at 37° C. on the LB agar plates containing 100 μg/mL ampicillin. (6) The reconstructed plasmids were extracted and identified by restriction enzyme digestion and nucleotide sequencing. (7) The reconstructed pMA5 plasmids harboring the wild-type or variant DPEase gene were separately transformed into B. subtilis WB600 by electroporation. The transformants were selected at 37° C. on the LB agar plates containing 100 m/mL Kanamycin.

(24) Purification of DPEase Variants of C. cellulolyticum

(25) To purify the recombinant DPEase variants, the centrifuged cell pellets were resuspended in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, pH 7.5) and disrupted by sonication at 4° C. for 6 min (pulsations of 3 s, amplify 90) using a Vibra-Cell 72405 sonicator, and cell debris was removed by centrifugation (20,000 g, 20 min, 4° C.). The cell-free extract was applied onto a Chelating Sepharose Fast Flow resin column (1.0 cm×10.0 cm), previously chelating Ni.sup.2+, and equilibrated with a binding buffer (50 mM Tris-HCl, 500 mM NaCl, pH 7.5). Unbound proteins were eluted from the column with a washing buffer (50 mM Tris-HCl, 500 mM NaCl, 50 mM imidazole, pH 7.5). Then the DPEase variants were eluted from the column with an elution buffer (50 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.5). The active fractions were pooled and dialyzed overnight against 50 mM Tris-HCl buffer (pH 7.5) containing 10 mM ethylenediaminetetraacetic acid (EDTA) for 48 h at 4° C. Subsequently, the enzyme was dialyzed against 50 mM EDTA-free Tris-HCl buffer (pH 7.5).

(26) DPEase Assay

(27) The activity was measured by the determination of the amount of produced D-psicose from D-fructose. The reaction mixture of 1 mL contained D-fructose (50 g/L), Tris-HCl buffer (50 mM, pH 8.0), 0.1 mM Co.sup.2+, and 0.5 μM enzyme. The reaction mixture was incubated at 55° C. for 2 min, and the reaction was stopped after 10 min by boiling. The generated D-psicose was determined by the HPLC method. One unit of enzyme activity was defined as the amount of enzyme catalyzing the formation of 1 μmol of D-psicose/min at pH 8.0 and 55° C.

(28) Effect of Temperature and pH

(29) The optimum temperature of enzyme activity was measured by assaying the enzyme samples over the range of 35-70° C. for 2 min. Two buffer systems, sodium phosphate (50 mM, pH 6.0-7.0) and Tris-HCl (50 mM, pH 7.5-9.0), were used for measuring the optimum pH of enzyme activity. The thermal stability of the enzyme was studied by incubating the enzyme in Tris-HCl buffer (50 mM, pH 8.0) at various temperatures. At given time intervals, samples were withdrawn and the residual activity was measured under standard assay conditions. To determine the pH stability, the enzyme was incubated at pH 6.0-9.0 at 4° C. for up to 2 h, and the remaining enzyme activity was measured at time intervals under standard assay conditions.

(30) Determination of Kinetic Parameters Kinetic parameters of DPEase variants were determined in 50 mM Tris-HCl buffer (pH 8.0) containing 0.1 mM Co.sup.2+ and 5-200 mM substrate for reaction at 55° C. The enzyme reactions were stopped after 10 min by boiling, and the amount of D-psicose was determined by the HPLC assay. Kinetic parameters, such as the Michaelis-Menten constant (K.sub.m) and turnover number (k.sub.cat) values for substrates, were obtained using the Lineweaver-Burk equation and quantification of enzyme concentration.

(31) Analytical Methods

(32) The concentrations of D-fructose and D-psicose were analyzed by HPLC equipped with a refractive index detector and a Ca.sup.2+-carbohydrate column (Waters Sugar-Pak 1, Waters Corp., Milford, Mass.), which was eluted with water at 85° C. and 0.4 mL/min. Protein concentration was determined according to the method of Bradford using bovine serum albumin as a standard. SDS-PAGE was carried out according to the method of Laemmli. Gels (12% w/v polyacrylamide) were stained with Coomassie Brilliant Blue and destained with an aqueous mixture of 10% (v/v) methanol/10% (v/v) acetic acid.

(33) TABLE-US-00003 TABLE 1 Enzyme properties and kinetic parameters of the wild-type and mutant enzymes of DPEase from C. cellulolyticum for substrate D-psicose .sup.aNR, not reported.

(34) TABLE-US-00004 TABLE 2 Enzyme properties and kinetic parameters of DTEase family enzymes for D- psicose production k.sub.cat/K.sub.m Equilibrium for D- Optimum ratio between fructose DTEase family Optimum temp. D-psicose and Half-life (mM.sup.−1 enzymes pH (° C.) D-fructose (thermostability) min.sup.−1) Reference C. cellulolyticum 6.5 55 33:67 (55° C.) 10.1 h (55° C.) 150.6 Invention DPEase mutant 7.2 h (60° C.) of G211S C. cellulolyticum 8.0 55 32:68 (55° C.) 9.5 h (55° C.) 62.7 Mu et al. DPEase 6.8 h (60° C.) 2011 Clostridium sp. 8.0 65 28:72 (65° C.) 0.25 h.sup.b (60° C.) 58.7 Mu et al. DPEase 2013 C. bolteae 7.0 55 32:68 (60° C.) 2.6 h.sup.b (55° C.) 59.4.sup.c Jia et al. 2013 C. scindens 7.5 60 28:72 (50° C.) 1.8 h.sup.b (50° C.) 8.72 Zhang et al. 2013 Ruminococcus 7.5-8.0 60 28:72 1.6 h (60° C.) 16 Zhu et al. sp. DPEase 2012 A. tumefaciens 8.0 50 32:68 (30° C.) 8.90 min (55° C.) 85 Kim et al. DPEase 33:67 (40° C.) 3.99 min (60° C.) 2006 A. tumefaciens NR.sup.a NR NR 0.46 h (55° C.) 101 Choi et al. DPEase mutant 2011 of S213C A. tumefaciens NR NR NR 1.06 h (55° C.) 105 Choi et al. DPEase mutant 2011 of I33L A. tumefaciens NR NR NR 4.4 h (55° C.) 134 Choi et al. DPEase mutant 2011 of S213C + I33L Rhizobium 9.0-9.5 50 23:77 NR NR Maruta et DTEase al. 2010 P. cichorii 7.5 60 20:80 (30° C.) 1 h (50° C.) NR Itoh et al. DTEase 1994 R. sphaeroides 9.0 40 23:77 (40° C.) NR NR Zhang et DTEase al. 2009 .sup.aNR, not reported. .sup.bThe half-life values were converted from the original references with the unit of min. .sup.cThe value was converted from the orginal reference with the unit of mM.sup.−1 s.sup.−1.

Example 2: Chromosomal Integration and Production of Microbial Strain Producing D-Psicose Epimerase

(35) The inventors constructed five strains with chromosomal integration of D-psicose epimerase. To avoid antibiotic addition and antibiotic-resistant gene (ARG) within the strain, the strains were constructed by chromosomal integration without inserting ARG by two approaches, i.e., Cre/Lox and mazF-based systems. The Cre/Lox system is to construct a strain with chromosomal integration with ARG and knock it out by Cre recombinase (Approach 1). The other is to construct a strain with chromosomal integration with the mazF gene and knock it out by the p43-DPE gene (Approach 2). Three strains of Bacillus subtilis were used as host strains, i.e., 1A751, WB600, and WB800.

(36) Approach 1. Cre/Lox System-Based Genome Engineering in Bacillus subtilis

(37) 1.1 Introduction

(38) The Cre/Lox recombination system is a simple two-component system currently recognized as a powerful DNA recombination tool. The general principle behind the Cre/Lox system relies upon the ability of Cre recombinase to identify, bind and recombine DNA between two loxP sites; each of these 34 bp target DNA sequences consists of two 13 bp inverted repeat sequences, flanking a central, 8 bp, directional core. By using the Cre/Lox recombination system, the antibiotic-resistant gene (ARG) was knocked out.

(39) 1.2 Methods

(40) Based on Cre/Lox recombination system, to construct a strain with chromosomal integration without ARG contains several steps as follows (see also FIG. 4):

(41) a. Splice DPEase-Coding Gene with Promoter p43 by Overlap Extension PCR.

(42) Promoter p43 and DPEase-coding gene were spliced by overlap extension PCR. Then the PCR-produced p43-DPE cassette was cloned into pMD19-T to create pP43DPE.

(43) b. Insert p43-DPE Gene (p43-DPE) and Pectinomycin-Resistant Gene (Lox71-Spc-Lox66) into Shuttle Plasmid Vector pDGIEF to Build a Reconstructed Plasmid pDGI-756-DPE.

(44) Plasmid pDGI-756-DPE was constructed as follows. The SalI- and XmaI-flanked fragment containing the lox71-spc-lox66 cassette was transferred from p7S6 to the corresponding sites of pDGIEF, giving pDGI-756; then NheI/SalI digested pP43DPE was cloned into the corresponding sites of pDGI-756 to yield pDGI-756-DPE (Figure. 4).

(45) c. Transform the Reconstructed Plasmid into B. subtilis for Chromosomal Integration.

(46) The pDGI-756-DPE plasmid was linearized by XhoI and transformed into B. subtilis strains (1A751, WB600, and WB800) by chemical transformation (Keith et al., Appl Microbiol Biotechnol, 2013, 97:6803-6811(host 1A751); Zhang et al., Bioresource Technology, 2013, 146: 543-548(host WB600); Nguyen et al. Microbial Cell Factories, 2013, 12:79 (host WB800)). B. subtilis amylase gene homologous arms were used to homologously recombine between the integration vector and chromosomal DNA. Through chromosomal integration, the p43-DPE cassette and lox71-spc-lox66 cassette were inserted into the chromosomal DNA.

(47) d. Screen the Integrated B. subtilis by Spectinomycin.

(48) The recombinant strains were screened on the LB plate with 100 ug/mL Spectinomycin.

(49) e. Transform the pTSC Plasmid into B. subtilis (7S6-DPE), and then were Screened by Erythromycin.

(50) pTSC plasmid harbored Cre recombinase gene was transformed into B. subtilis (pDGI-756-DPE) competent cells. The B. subtilis (7S6-DPE, pTSC) strains were screened on the LB plate with 200 ug/mL Erythromycin.

(51) f. Screen B. subtilis (Lox-DPE, pTSC) Strains by Erythromycin and Spectinomycin.

(52) If the Spectinomycin-resistant gene was knocked out, the strains could not grow on the LB plate with 200 ug/mL Erythromycin and 100 ug/mL Spectinomycin, but could grow on the LB plate with 200 ug/mL Erythromycin. Based on this, B. subtilis (lox-DPE, pTSC) strains were screened and selected.

(53) g. Screen B. subtilis (Lox-DPE) Strains by Erythromycin.

(54) pTSC was a temperature-sensitive plasmid which cannot replicate when the plate was incubated in 42° C. If the pTSC plasmid was lost in B. subtilis strains, the strains could not grow on the LB plate with 200 ug/mL Erythromycin. After incubation in 42° C. for two days, B. subtilis (lox-DPE) strains were screened and selected on the LB plate and LB plate with 200 ug/mL Erythromycin.

(55) h. Validate for Knock-Out of Antibiotic Resistant Gene.

(56) Two test methods were used to validate for knock-out of antibiotic resistant gene, PCR and screening on antibiotic plates. The PCR amplification was performed using the primers of the B. subtilis amylase homologous arms gene. The DNA fragment was sequenced and aligned with the antibiotic resistant gene sequence to make sure the antibiotic resistant gene was knocked out. Meanwhile, the primers of the antibiotic resistant gene were also used. If the PCR amplification was failed, the antibiotic resistant gene did not exist in the constructed strains. The other test method was screening on antibiotic plates. If the strains could not grow on antibiotic plates, the antibiotic resistant gene was knocked out.

(57) Approach 2. mazF-Based Genome Engineering in Bacillus subtilis

(58) 2.1 Introduction

(59) mazF is an Escherichia coli toxin gene which can be used as a novel counter-selectable marker for unmarked chromosomal manipulation in Bacillus subtilis. mazF was placed under the control of a xylose-inducible expression system. The Bacillus subtilis strains harboring the mazF cassette cannot grow on the xylose-containing medium. If the mazF cassette is replaced by the p43-DPE cassette, the strains can grow on the xylose-containing medium.

(60) 2.2 Methods

(61) Based on this, unmarked chromosomal integration in Bacillus subtilis contains several steps as follows (see also FIG. 7):

(62) a. Insert p43-DPE Gene (p43-DPE) into Shuttle Plasmid Vector pDGIEF to Build a Reconstructed Plasmid pDGI-DPE.

(63) Plasmid pDGI-DPE was constructed as follows. The XmaI- and Sal I-flanked fragment containing the p43-DPE cassette was transferred from pP43DPE to the corresponding sites of pDGIEF, giving pDGI-DPE (FIG. 6).

(64) b. Transform the Reconstructed Plasmid pDGREF into B. subtilis for Chromosomal Integration.

(65) The pDGREF plasmid was linearized by Cla I and transformed into B. subtilis strains (1A751, WB600, WB800) by chemical transformation. B. subtilis amylase gene homologous arms were used to homologously recombine between the integration vector and chromosomal DNA. Through chromosomal integration, the mazF cassette was inserted into the chromosomal DNA.

(66) c. Screen the Integrated B. subtilis by Spectinomycin and Xylose.

(67) The recombinant strains were screened on the LB plate with 100 μg/mL Spectinomycin. Then the positive clones were streaked on the Spectinomycin (100 μg/mL)-xylose (2%)-containing LB plate and Spectinomycin (100 ug/mL)-containing LB plate, respectively. The positive clones which could not grow on the xylose-containing plate were used for the next step.

(68) d. Transform the pDGI-DPE Plasmid into B. subtilis (REF), and then were Screened by Xylose.

(69) pDGI-DPE plasmid harbored p43-DPE gene was linearized by Xho I and transformed into B. subtilis (REF) competent cells. The B. subtilis (DPE) strains were screened on the LB plate with 2% xylose.

(70) Results

(71) Five strains were selected by these two approaches. After the B. subtilis strains were selected, the strains were fermented in lab medium. The enzyme activity was determined as described in Example 1, to ensure the DPEase-coding gene was inserted into the chromosomal DNA.

(72) Enzyme activity was determined for all the selected strains. The highest enzymatic activity was detected for the 1A751 strain. The enzymatic activity reached 03.45 U/mL, which was close to the initial activity detected for the plasmid-dependent B. subtilis.

(73) TABLE-US-00005 Plasmid replicative Approach 1 Approach 2 Host WB600 1A751 WB600 WB800 1A751 WB600 Enzyme ~5 3.43 1.39 0.40 3.45 1.40 activity (U/mL)

(74) TABLE-US-00006 SEQUENCE LISTING TABLE SEQ ID No Description 1 Nucleic acid sequence of the parent D-psicose 3-epimerase from Clostridium cellulolyticum 2 Amino acid sequence of the parent D-psicose 3-epimerase from Clostridium cellulolyticum 3 Nucleic acid sequence of the D-psicose 3-epimerase variant derived from Clostridium cellulolyticum 4 Amino acid sequence of the D-psicose 3-epimerase variant derived from Clostridium cellulolyticum 5 Amino acid sequence of Clostridium sp. DPEase 6 Amino acid sequence of C. scindens DPEase 7 Amino acid sequence of A. tumefaciens DPEase 8 Amino acid sequence of Ruminococcus sp. DPEase 9 Amino acid sequence of C. bolteae DPEase 10 Amino acid sequence of P. cichorii DTEase 11 Amino acid sequence of R. sphaeroides DTEase 12-20 Primers