Pleurotus eryngii var. ferulae strain
09781899 · 2017-10-10
Assignee
Inventors
- Kyong Yeal Kwon (Chungcheongnam-do, KR)
- Seong Jin Lee (Chungcheongnam-do, KR)
- Ook Jin Jeong (Chungcheongnam-do, KR)
- Ki Moon Park (Gyeonggi-do, KR)
- Jae Young Rho (Chungcheongnam-do, KR)
Cpc classification
International classification
Abstract
The present invention relates to Pleurotus eryngii var. ferulae. More particularly, the present invention relates to a novel Pleurotus eryngii var. ferulae strain line following a line of DDL01 (KACC93085P) which is obtained by selecting a conventionally known Pleurotus eryngii var. ferulae strain and then cross-breeding the selected strain with the Pleurotus eryngii var. ferulae strain DDL01 (accession number: KACC93085P), and also relates to a fruit body obtained through cultivation of the strain.
Claims
1. A novel Pleurotus eryngii var. ferulae strain representative inoculum having been deposited under Accession No.: KCCM11288P.
2. The novel Pleurotus eryngii var. ferulae strain P48-24s of claim 1, wherein when the novel strain is inoculated at regular intervals on a medium, no confrontation lines are formed between the inocula after replacement culture.
3. A fruit body of Pleurotus eryngii var. ferulae, produced by a novel Pleurotus eryngii var. ferulae strain P48-24s representative inoculum having been deposited under Accession No.: KCCM11288P.
4. The fruit body of claim 3, wherein the fruit body has a pileus surface that is fully ivory white, without any other colors mixed therein.
5. The fruit body of claim 3, wherein the fruit body has a bisporous basidium.
6. A mycelial culture of the novel Pleurotus eryngii var. ferulae strain P48-24s, representative inoculum having been deposited under Accession No.: KCCM11288P.
7. An inoculum, comprising the mycelial culture of claim 6.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION
(5) Terms used herein are selected from among the terminology currently used in the art, but rarely made by the present inventor. In this case, the terms should not be understood as they are, but appreciated in the context of the description or meanings for which they are used.
(6) To explain the technical constitution of the present invention in detail, reference should now be made to the drawings and preferred embodiments.
(7) The embodiments are illustrative, and thus, the present invention may be practiced in other modifications. In drawings, the same reference numerals are used throughout the different drawings to designate the same or similar components.
(8) The present invention features a the novel Pleurotus eryngii var. ferulae strain of the commercialized strain DDL01 (KACC93085P) lineage that is improved in morphological property to attract consumer's attention, and a fruit body produced by culturing the novel strain.
(9) The fruit body produced by the novel Pleurotus eryngii var. ferulae strain of the present invention has a pileus surface that is fully ivory white and/or free of lists.
(10) For use in generating the novel Pleurotus eryngii var. ferulae strain, DDL01 (KACC93085P), DAC7322, and DAC7421 were selected from among the strains stored in the institute attached to the company Dole-A-Che by test culturing. In the following experiments, they were used as parent strains.
Example 1: Culture of Novel Pleurotus eryngii Var. Ferulae Strain P48-24s
(11) Of strains stored in the institute attached to the company Dole-A-Che, DDL01 (KACC93085P), DAC7322, and DAC7421 were employed as parent stains in this Example.
(12) (1) Isolation of Monospore
(13) After removing the stipe from each of the Pleurotus eryngii var. ferulae strains DDL01, DAC7322 and DAC7421, the pileus thus left was placed on a petri dish such that the gills faced downwards. After 24 hours, the pileus was withdrawn, and the spores dropped on the petri dish were diluted to a suitable concentration in sterilized water. The dilution was spread over a potato agar plate, followed by incubation at 25° C. Primary hyphae germinated from 7 days after incubation were isolated with tooth picks, and then were inoculated into respective potato agar plates. After incubation at 25° C. for 14 days, hyphae were partly isolated from the potato agar plates and observed under a microscope to determine the presence or absence of clamps. Only the hyphae that were observed to have no clamps were immersed in a 10% glycerol solution before cold storage.
(14) (2) Crossing
(15) Crossing was performed between the cold-stored monospore (monokaryotic) hyphae from the same or different Pleurotus eryngii var. ferulae strains, and between the cold-stored monospore (monokaryotic) hyphae and the hyphae (dikaryotic) of the parent strains. The hyphae were inoculated into respective potato agar plates, and cultured at 25° C. for 14 days. For use in crossing, selection was made only of the hyphae that well grew to produce high mycelial mass. The mycelia grown on the potato agar plates were cut in a size of 1 cm circle to give mycelial blocks. They were inoculated at regular intervals of 3 cm onto a potato agar plate to conduct cross breeding. After incubation of the inoculated potato agar plate at 25° C. for 21˜28 days, the hyphae were observed under a microscope. Only the strains that had clamps formed in the monokaryotic mycelia blocks were selected.
(16) (3) Culture of Crossed Strains
(17) Sawdust was mixed at a volume ratio of 8:2 with rice bran, and adjusted to have a water content of 64%, after which the mixture was added in an amount of 580 g to each of 850 cc culture bottles. The mixture was perforated at the center from the top to the bottom, using a 2 cm bar, followed by autoclaving at 121° C. for 60 min. Thereafter, the bottles were cooled to 20° C., inoculated with the selected strains, and incubated at 24° C. for 30 days in a dark place. After completion of the incubation, mycelia were scraped and subjected to a breeding test, such as germination and breeding at 14˜18° C. and at a humidity of 80˜95% under 100˜200 Lux.
(18) (4) Selection of the Novel Crossed Strain Pleurotus eryngii Var. Ferulae P48˜24s
(19) The strains obtained by monosporic crossing were bred and screened to select monospores P7329W, P7330W, and P7332W of DDL01(KACC93085P) featuring an ivory white color on the pileus of the fruit body. Of them, P7332W was primarily crossed with DAC7322 (dikaryotic) to give a crossed strain DAC7348. Then, crossing was performed between monospores of DAC7348 and DAC7421 to select crossed strains exhibiting ivory white pilei. Also selection was made of a crossed strain that was semi-hemispherical and took an ivory white color on the pileus of the fruit body without any other colors mixed therein. This strain was termed P48-24s, and was duly deposited at the Korean Culture Center of Microorganism (having the address of KCCM, 3F Yurim B/D, 361-221, Hongje-1-dong, Sudaemun-gu, Seoul 120-091, Republic of Korea) under the Access number of KCCM11288P on Jun. 25, 2012. The deposit has been made under the terms of the Budapest Treaty and all restrictions imposed by the depositor on the availability to the public of the biological material will be irrevocably removed upon the granting of a patent.
Example 2: Breeding of P48-24S-Lineage Pleurotus eryngii Var. Ferulae Strains 1 to 5
(20) (1) Isolation of monospore, (2) Crossing, and (3) Culture of crossed strains were carried out in the same manner as in Example 1, with the exception that the novel strain P48-24s selected in Example 1 was used as a parent strain. Crossing the monospores from the novel strain P48-24s resulted in P48-24s lineage Pleurotus eryngii var. ferulae Strains 1 to 5, that is, P48-24S progenies 1 to 5.
Experimental Example 1: Mycological Feature of Novel Crossed Strain P48-24s and P48-24S Lineage Pleurotus eryngii Var. Ferulae Strains 1 to 5
(21) The novel crossed strain P48-24s obtained in Example 1 and the P48-24S lineage Pleurotus eryngii var. ferulae Strains 1 to 5 obtained in Example 2 were examined for mycological feature as follows.
(22) 1) State of growth on potato dextrose agar (PDA) plate (25° C.): on day 7, colonies with a diameter of 40.7 mm. White hyphae populated densely. Aerial mycelia grew straight, with moderate mass.
(23) 2) State of growth on mushroom complete medium (MCM) (25° C.) on day 7, colonies with a diameter of 36.1 mm. White hyphae populated densely. Aerial mycelia grew straight, with moderate mass.
(24) 3) State of growth on mycological agar (MA) plates (25° C.) on 7 day, colonies with a diameter of 40.3 mm. White hyphae populated densely. Aerial mycelia grew straight, with moderate mass.
(25) 4) State of growth on corn meal agar (CMA) plate (25° C.): on day, colonies with a diameter of 39.3 mm. White hyphae populated densely. Aerial mycelia grew straight, with very small mass.
(26) 5) State of growth on sabouraud dextrose agar (SDA) plate (25° C.): on day 7, colonies with a diameter of 38.5 mm. White hyphae populated densely. Later, mycelia partly turned redish yellow. Aerial mycelia grew straight with moderate mass.
(27) 6) Optimal temperature for hyphal growth: After seed fungi was inoculated into a 5 mm hole of PDA media and incubated at different temperatures for 7 days, diameters of the colonies thus formed were measured. At around 26° C., hyphae grew optimally.
(28) 7) Optimal pH for hyphal growth: After a glucose-peptone-yeast extract broth was sterilized, and adjusted to different pH values, seed fungi were inoculated to 25 mL aliquots of the broth, and cultured in a stationary manner at 25° C. for 12 days. Dry mycelial mass was measured, indicating an optimal pH of around 5.5.
Experimental Example 2: Genetic Features of Novel Strain P48-24s, and P48-24S-Lineage Pleurotus eryngii Var. Ferulae Strains 1 to 5
(29) Examination was made of genetic features of the strains obtained in Examples. On the ground of the mycological taxonomic fact that two hyphae are different to each other if different in fertility factor, both parents and genetically related cultivars were subjected to replacement culture on agar plates to determine whether they were different or identical in fertility factor. Two different stains were seeded at a distance of 3 cm from each other on an agar plate and cultured at 25° C. for 14˜21 days, after which the formation of a confrontation line between the two colonies was observed (when a confrontation line was formed, + while no lines, −). The results are summarized in Table 1. Herein, P48-24S-Lineage Pleurotus eryngii var. ferulae strains 1 to 5 were progenies from P48-24S, obtained by crossing monospores of the novel strain P48-24S.
(30) TABLE-US-00001 TABLE 1 Progeny 5 Strains P48-24S from P48-24S P. nebrodensis (China) + + P. nebrodensis (Hwanghoo + + P. ferulae var. + + fuscus(KCTC 26065) P. eryngii (cultured) + + P. ferulae(China) + + P. eryngii var. + + ferulae(DAC 7322) P. eryngii var. + + ferulae(DAC 7421) P. eryngii var. + + ferulae(DDL01) P48-24s − − Progeny 1 from P48-24S − − Progeny 2 from P48-24S − − Progeny 3 from P48-24S − − Progeny 4 from P48-24S − −
Experimental Example 3: Molecular Biological Identification of Novel Strain P48-24s
(31) (1) Base Sequencing of ITS Region
(32) Using a bead beating method, DNA was extracted from cultivars. ITS (internal transcribed spacer) was amplified from the DNA by PCR (polymerase chain reaction) using a primer set of ITS1 (TCCGTAGGTGAACCTGCGG; SEQ ID NO: 1)/ITS4 (TCCTCCGCTTATTGATATGC; SEQ ID NO: 2). The Product was purified, and base sequenced in Macrogen (SEQ ID NO: 3).
(33) TABLE-US-00002 > P48-24s GGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGG CATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGAT CTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAAC GTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATG TCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACT TTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAAT GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAA CGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCA TTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGT TGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGG ACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGC ACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACA ATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCT
(34) (2) Analysis of Genetic Features
(35) The gene the base sequences of which were determined were modified at two portions and used to search for most similar base sequences by BLAST searching. More accurate genetic analysis was performed on them.
(36) All base sequences were aligned using ClustalW2 (Multiple Sequence Alignment). On the basis of the alignments, evolutionary distances were calculated by Bayesian MCMC run using MrBayes version 3.1 program, and molecular evolutionary relations are shown by maximum likelihood in
Experimental Example 4: Morphological Feature of Fruit Body of Novel Strain P48-24s
(37) [Examination with Naked Eye]
(38) The pileus ranges in diameter 15-90 mm, with an optimum size of 20-55 mm. Initially, the pileus is semi-hemispherical and has an edge that is internally rolled for a significant period of time. When fully matured, the pileus spreads semi-hemispherically, flat with a slightly recessed center, or flat. Its surface is pale yellowish white-ivory white, and smooth. The texture is very thick, dense, and of flesh with elasticity at the central region, but becomes thin at the edge. The pileus emanates a typical mushroom flavor, tastes sweet, and gives a good crisp chewing sensation. The gills are long and decurrent against the stipe, and are densely populated. Short gills are of mono- to tribranch type, and white at an initial stage, but turn pale grayish yellow or pale grayish orange as the mushroom grows. Each gill blade is wide and flat.
(39) The stipe has a size of 15-55×50-150×mm (base 27 mm), with preference for a cylindrical morphology with a size of 20-40×70-90 mm. It becomes somewhat thicker towards the ground side while the aerial part becomes thin and then thick as it runs towards the top. Often, it is bent. Its surface is pale yellowish white to ivory white, has unclear longitudinal fibrous lines, and somewhat rugged, but flat. The stipe is closely packed, white, dense, and of flesh with elasticity.
(40) [Microscopic Examination]
(41) Spores are oval to cylinder-like oval, with a size range of 9.3-9.8×4.3-4.6 μm, and have a wide and flat surface. They are inamyloid as tested in Melzer's solution, and show an ivory white spore print.
(42) The basidium is of dibranch type. As can be seen in
(43) As for the cheilocystidia, its morphology is a club, a spindle, or a club-like spindle, with a size range of 25-35×5-8 μm. Generally, it has a 1-3 pin-like protrusions at the top, and its cell wall is thin and transparent.
(44) There are no pleurocystidia.
(45) The fruit body is of a monomitic tissue type with a parallel-interwoven texture, and there is a clamp in the septum of the hyphae
Experimental Example 5: Culture of Novel Strain P48-24s and P48-24S-Lineage Pleurotus eryngii Var. Ferulae Strains 1 to 5
(46) 1. Medium Preparation
(47) A mixture of 8:2 of sawdust:rice bran (volume ratio, 40-50 g per 850 cc bottle) was used as a medium. Sawdust and rice bran were completely mixed by stirring, and adjusted to have a final water content of 68˜70%.
(48) 2. Filling
(49) The medium was introduced in an amount of 480-520 g into an 850 cc bottle.
(50) 3. Sterilization
(51) Autoclaving was performed at 120° C. for 60 min (effective sterilizing time). When reference was made to the temperature of the autoclave, autoclaving was extended to 90 min (850 cc bottle).
(52) 4. Cooling
(53) The medium was cooled to 20° C. in a clean environment.
(54) 5. Inoculation
(55) An inoculum per bottle was about 15 cc.
(56) 6. Culturing
(57) The culture condition was maintained at 18° C. for 25 days, and then at 23° C. for 8˜10 days. Humidity was set to be 60˜70% for the first culturing, and to be 70˜80% for the second culturing. In the atmosphere, carbon dioxide was maintained at a concentration of 3,000 ppm or less. Light was completely blocked for the culturing period of 30 days.
(58) 7. Mycelium Scraping
(59) The number of sprouts was restrained by scraping gills to a distance of 15˜20 mm.
(60) 8. Germination
(61) Germination was carried out at 14-15° C. while the humidity was maintained at 90-95% for early germination of 3-5 days and at 70˜80% for late germination of 3-5 days. In the atmosphere, carbon dioxide was maintained at a concentration of 1,000 ppm or less. Light was provided by a lamp in the daytime. The culture bottles were turned upside down for 5-8 days. When mushroom primodia grew about 1 cm in the later germination stage, the culture bottles were placed upright.
(62) 9. Breeding
(63) To synchronize the sizes of young mushrooms formed at the mouth of the bottle, the temperature was set to be 11-12° C. and prevented from being elevated to 14° C. or higher. For the first three days, the temperature was maintained at 11° C. The culture condition was maintained to have a humidity of 70-95% so as to enlarge a difference in humidity between dry and wet states. After germination, the culture bottles were returned upright and incubated for 5-8 days. Immediately after returning upright, a low temperature was maintained so as to prevent a humidity change by dehumification.
(64) 10. Harvest
(65) Mushrooms were harvested when the pilei still retained a hemispherical shape.
(66) The novel Pleurotus eryngii var. ferulae strain P48-24s, and the P48-24S-lineage Pleurotus eryngii var. ferulae strains 1 to 5, obtained in the above Examples, were cultured and harvested. Although keeping the genetic features of DDL01 (KACC93085P), their fruit bodies were improved in pileus morphology and color, compared to the DDL01 (KACC93085P) strain of
(67) Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims.